KEGG   Mus musculus (mouse): 16939Help
Entry
16939             CDS       T01002                                 

Gene name
Lor, AI036317, S77319
Definition
loricrin
Orthology
K10385  
loricrin
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
MGI: 
Ensembl: 
Vega: 
UniProt: 
Position
3 F1; 3 40.14 cM
AA seq 486 aa AA seqDB search
MSHQKKQPTPCPPVGCGKTSGGGGGGGGGGGGGYYSGGGSGCGGGSSGGGSSCGGGGGGS
YGGGSSCGGGGGSGGGVKYSGGGGGSSCGGGYSGGGGGSSCGGGYSGGGGGSSCGGGYSG
GGGGSSCGGGSYSGGGSSCGGGGGSGGGVKYSGGGGGGGSSCGGGSSGGGGGGSSCGGGS
GGGGSYCGGSSGGGSSGGCGGGSGGGKYSGGGGGSSCGGGYSGGGGSSGGSSCGGGYSGG
GGSSCGGGGGYSGGGGSSCGGGSSGGGGGGSSQQYQCQSYGGGSSGGSSCGGRYSGGGGS
SCGGGYSGGGGSSCGGGSSGGGSSCGGSGGGGYSGGGGGSCGGGSSGGGGGYYSSQQTSQ
TSCAPQQSYGGGSSGGGGSCGGGSSGGGGGGGCYSSGGGGSSGGCGGGYSGGGGGCGGGS
SGGSGGGCGGGSSGGSGGGCGGGYSGGGGGGSSCGGGSSGGGSGGGKGVPVCHQTQQKQA
PTWPCK
NT seq 1461 nt NT seq  +upstreamnt  +downstreamnt
atgtctcaccagaaaaagcagcccactccctgccctcctgtgggttgtggaaagacctct
ggtggaggaggaggcggcggcggcggcggcggcggcggctattatagcggtggcggctct
ggctgcggaggcggctcatctggaggaggctctagctgtggaggcggaggcggtggttcc
tatggaggtggttccagctgcggcggtggaggcggctccggtgggggcgtcaagtactcc
ggaggcggcggtggctctagctgcggcggcggctactccggaggcggtggtggctctagc
tgcggcggtggctactctgggggcggcggcggctccagctgcggaggtggctactccgga
ggcggcggcggctccagctgcggcggcggcagctactccgggggtggctccagctgtgga
ggcggtggcggctctggtgggggcgtcaagtactccggaggtggtggcggcggcggctct
agctgcggcggcggctcctccgggggtggcggcggcggctccagctgcggaggcggatca
ggaggcggcggctcctactgcggaggctcctctggaggcggcagctccggtggctgcggc
ggcggttccggaggcggcaagtactctggtggcggcggtggctccagctgcggaggcggc
tattccggcggcggtggaagcagcggcggctctagctgtggcggcggctactcaggtggc
ggtggatccagctgcggcggcggcggcggctattccggtggcggcggcagcagctgcgga
ggtggttcctccggtggcggcggcggcggatcgtcccaacagtatcagtgccagagctac
ggaggcggttctagcggtggctccagctgcggcggccgttactccgggggcggaggctcc
agctgcggtggcggctactccgggggcggaggctctagctgcggaggcggctcctctggt
ggtggctccagttgcggcggcagcggcggcggcggctattccggtggtggcggtggcagc
tgcggcggcggctcctctggcggcggagggggctattactcctctcagcagaccagtcag
acctcctgcgccccccagcagagctacggagggggctcttccggaggaggtggtagctgt
ggaggtggctcctctggcggcggtggcggcggtggctgctactccagcggtggtggcggc
agcagcggtggctgcggtggaggctactccggaggcggcggtggctgtggcggcggctct
tccgggggcagcggcggtggctgcggaggtggctcttccggaggcagcggcggtggctgc
ggaggaggctactccggaggcggaggcggtggctccagctgcggaggcggctcctctggt
ggcggctctggaggtggcaagggtgtgccagtctgccaccagacccagcagaagcaggcg
cctacctggccgtgcaagtaa

DBGET integrated database retrieval system