KEGG   Mus musculus (mouse): 246779Help
Entry
246779            CDS       T01002                                 

Gene name
Il27, IL-27, IL-27p28, Il30, p28
Definition
(RefSeq) interleukin 27
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
MGI: 
Ensembl: 
Vega: 
UniProt: 
Position
7; 7 F3
AA seq 234 aa AA seqDB search
MGQVTGDLGWRLSLLLLPLLLVQAGSWGFPTDPLSLQELRREFTVSLYLARKLLSEVQGY
VHSFAESRLPGVNLDLLPLGYHLPNVSLTFQAWHHLSDSERLCFLATTLRPFPAMLGGLG
TQGTWTSSEREQLWAMRLDLRDLHRHLRFQVLAAGFKCSKEEEDKEEEEEEEEEEKKLPL
GALGGPNQVSSQVSWPQLLYTYQLLHSLELVLSRAVRDLLLLSLPRRPGSAWDS
NT seq 705 nt NT seq  +upstreamnt  +downstreamnt
atgggccaggtgacaggagaccttggctggcggctcagcctgttgctgctacccttgctt
ctggtacaagctggttcctgggggttcccaacagaccccctgagccttcaagagctgcgc
agggaattcacagtcagcctgtaccttgccaggaagctgctctctgaggttcagggctat
gtccacagctttgctgaatctcgattgccaggagtgaacctggacctcctgcccctggga
taccatcttcccaatgtttccctgactttccaggcatggcatcacctctctgactctgag
agactctgcttcctcgctaccacacttcggcccttccctgccatgctgggagggctgggg
acccaggggacctggaccagctcagagagggagcagctgtgggccatgaggctggatctc
cgggacctgcacaggcacctccgctttcaggtgctggctgcaggattcaaatgttcaaag
gaggaggaggacaaggaggaagaggaagaggaggaagaagaagaaaagaagctgccccta
ggggctctgggtggccccaatcaggtgtcatcccaagtgtcctggccccagctgctctat
acctaccagctccttcactccctggagcttgtcctgtctcgggctgttcgggacctgctg
ctgctgtccctgcccaggcgcccaggctcagcctgggattcctaa

DBGET integrated database retrieval system