KEGG   Mus musculus (mouse): 382522Help
Entry
382522            misc_RNA  T01002                                 

Gene name
Hist3h2bb-ps, 4930534G10Rik, 4933432H21, B2Hist3h2bb, Hist3h2bb, R75370
Definition
(RefSeq) histone cluster 3, H2bb, pseudogene
Organism
mmu  Mus musculus (mouse)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
MGI: 
Ensembl: 
Position
11; 11 B1.3
NT seq 465 nt NT seq  +upstreamnt  +downstreamnt
atgcctgatccttcatttgaatgcaaggcatacaaatattcttgctacaggggcgtccgc
gtttccgtagtacaactagacattatgcctgatccatccaaatcagctccagcccccaag
aaaggctccaaaaaggcggtcaccaaggcgcagaaaaaggatggcaagaaacgcaaacgg
ggccgcaaggagagctactccatctacgtgtacaaggtgctgaagcaggtgcatccggac
accggcatctcgtctaaggccatgggcatcatgaactcgttcgtcaatgacatcttcgag
cgcatcgccagcgaggcctcccgcctggcgcattacaacaagcgctcgaccatcacgtcc
cgcgaggtgcagacagccgtgcgcctgctgctgcccggggagctggccaagcatgctgtg
tccgagggcaccaaggcagtcaccaaatacaccagctccaagtga

DBGET integrated database retrieval system