KEGG   Meiothermus ruber DSM 1279: Mrub_1016Help
Entry
Mrub_1016         gene      T01193                                 

Definition
(GenBank) pseudogene
Organism
mrb  Meiothermus ruber DSM 1279
SSDB OrthologParalogGene clusterGFIT
Position
complement(1011229..1012011)
Genome map
NT seq 783 nt NT seq  +upstreamnt  +downstreamnt
atgctacagtcacgcatggaactcagagaaagccgctaccccagcgatctgaccgaccag
gaatgggccatcctggcgcccctgatgcctcagccctccgcctccccccatcgccccagg
gagcatccctggcgggaaatcctgaacggcctcttctacatcacccgcgccggttgcgcc
tggcgcatgatgccctgcgacctgccccttccgttggtggcgcaaatctggtttcctgca
acagatacacaccaccctgcgcgagaaaacccgccgcaaagcaggacgcctgcctgaacc
cagtgcggggattctggacagccagcgcgtgaagaccttgggaaaaggggggtcaggggt
atgacgcgggcaagaaggtaaaggggcgcaaacggcatctgctggtggatacccaggggc
tgtcgaagcggttatcgcgtctgtttgtggatgggggctacaagcgcaggttcgaggaat
gggttcggcgcaccttgagctggacggtggaggtggtgcgcaggccggatgccaacttca
agaccagcctcggaagaggacgcgggggcatcgggggtttgtggtgattccccgcagatg
ggtggtggagcgcaccttacgcagacaagcgtgcctccgcacacggaggcacgtctgctt
ggccctgcctggctcagtttcagccgccggctgaaccgggactatgagcttctacccgag
agctcagagaccttcatctacacggcaatgatccggcttatggtcagaagattggcctcc
tag

DBGET integrated database retrieval system