KEGG   Mycobacterium tuberculosis RGTB423: MRGA423_06810Help
Entry
MRGA423_06810     CDS       T01994                                 

Definition
cellulase CELA2A
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mti  Mycobacterium tuberculosis RGTB423
Pathway
Starch and sucrose metabolism
Metabolic pathways
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:mti00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
Position
1216392..1216496
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system