KEGG   Mycobacterium tuberculosis RGTB423: MRGA423_06810Help
Entry
MRGA423_06810     CDS       T01994                                 

Definition
cellulase CELA2A
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mti  Mycobacterium tuberculosis RGTB423
Pathway
Starch and sucrose metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:mti00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    MRGA423_06810
Enzymes [BR:mti01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.4  cellulase
     MRGA423_06810
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
Position
1216392..1216496
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system