KEGG   Mycobacterium tuberculosis RGTB423: MRGA423_16805Help
Entry
MRGA423_16805     CDS       T01994                                 

Definition
polyphosphate glucokinase ppgK
Orthology
K00886  
polyphosphate glucokinase [EC:2.7.1.63]
Organism
mti  Mycobacterium tuberculosis RGTB423
Pathway
Glycolysis / Gluconeogenesis
Amino sugar and nucleotide sugar metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glycolysis (Embden-Meyerhof pathway), glucose => pyruvate
Nucleotide sugar biosynthesis, glucose => UDP-glucose
Class
Metabolism; Overview; Carbon metabolism [PATH:mti01200]
Metabolism; Carbohydrate metabolism; Glycolysis / Gluconeogenesis [PATH:mti00010]
Metabolism; Carbohydrate metabolism; Amino sugar and nucleotide sugar metabolism [PATH:mti00520]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
Position
3011495..3011680
Genome map
AA seq 61 aa AA seqDB search
MLIAIENAIWPDLFIAGGGISRKADKWVPLLENRTPVVPAALQNTAGIVGAAMASVADTT
H
NT seq 186 nt NT seq  +upstreamnt  +downstreamnt
gtgctcatcgccatcgagaacgcgatctggcctgacctgttcatcgccggcggcggcatc
agccgcaaggccgacaaatgggtgccgctactggaaaaccgcacaccagtagtgcccgcg
gccctgcagaacaccgccggaattgtcggtgcggccatggcctctgtcgcagatacgacg
cactga

DBGET integrated database retrieval system