KEGG   Mycobacterium tuberculosis KZN 4207: TBSG_02911Help
Entry
TBSG_02911        CDS       T01690                                 

Definition
cellulase celA2a
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mtk  Mycobacterium tuberculosis KZN 4207
Pathway
Starch and sucrose metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:mtk00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    TBSG_02911
Enzymes [BR:mtk01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.4  cellulase
     TBSG_02911
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
complement(3193208..3193312)
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system