KEGG   Mycobacterium tuberculosis CTRI-2: MTCTRI2_1119Help
Entry
MTCTRI2_1119      CDS       T01993                                 

Gene name
celA2a
Definition
endo-1,4-beta-glucanase
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mto  Mycobacterium tuberculosis CTRI-2
Pathway
Starch and sucrose metabolism
Metabolic pathways
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:mto00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1215954..1216058
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system