KEGG   Mycobacterium tuberculosis H37Rv: Rv3233cHelp
Entry
Rv3233c           gene      T00015                                 

Definition
(RefSeq) pseudogene
Organism
mtu  Mycobacterium tuberculosis H37Rv
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
TubercuList: 
Position
complement(3609781..3610371)
Genome map
NT seq 591 nt NT seq  +upstreamnt  +downstreamnt
gtgattgccggtgccttgggcaactggctgatgtcacgcggtgaagctgtggcaccgacc
gcgactgttcgggcgatggcgccgctgtcggtctatgccgacgaccaactcgactcaacc
ggccctggtcaggcgatcagccaggtgacaccgttcttggttgacctcccggtgggggag
ggcaatgccgtagtgcggttgtcgcagatcgcgcacgccaccgaatccaacccgaccgcc
gccagcctggtcgatgccaggactatcgtcacgttgtcggggttagcaccggccactttg
cacgccatgggggtgcgggtcgccactagcttttcggcacggttgttcaatctgttgatc
accaatgcccccggaacccagtcgcagatgtacattgcgggtaccaagctgctggagacc
tactccgtgccgccgctactgcacaaccaggcgctggccatcagcgtgacgtcgtataac
gggatgttgtatttcggcatcaatgccgaccgcgacgcgatgagcgatgtcgatctgctg
ccggggctgttgagccaagcactggacgagcttctggaggcttcgcggtag

DBGET integrated database retrieval system