KEGG   Mycobacterium tuberculosis H37Rv: Rv3374Help
Entry
Rv3374            gene      T00015                                 

Gene name
echA18'
Definition
pseudogene
Organism
mtu  Mycobacterium tuberculosis H37Rv
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
TubercuList: 
UniProt: 
Position
3788368..3788616
Genome map
NT seq 249 nt NT seq  +upstreamnt  +downstreamnt
ttggtgcaaaaggtcgtcgcaccacaggatttggcggccgcgacggccaaactggtcggc
caggtctgtcggcaatccgcggtgaccatgcgtgcggcgaaggtggtcgccaacatgcac
ggccgagcgctgaccggcgccgacaccgatgcgctgatccggttcggtgtcgaagcctac
gagggggcggacctacgcgaaggggtggcggccttcagccagggacgcccacccaaattt
gatgattag

DBGET integrated database retrieval system