KEGG   Mycobacterium tuberculosis 7199-99: MT7199_1116Help
Entry
MT7199_1116       CDS       T02617                                 

Definition
putative CELLULASE CELA2A (ENDO-1,4-BETA-GLUCANASE) (ENDOGLUCANASE) (CARBOXYMETHYL CELLULASE) (EC:3.2.1.4)
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mtub  Mycobacterium tuberculosis 7199-99
Pathway
Starch and sucrose metabolism
Metabolic pathways
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:mtub00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1220083..1220187
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system