KEGG   Mycobacterium tuberculosis Haarlem/NITR202: I917_07745Help
Entry
I917_07745        CDS       T02654                                 

Definition
celA2a
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mtuh  Mycobacterium tuberculosis Haarlem/NITR202
Pathway
Starch and sucrose metabolism
Metabolic pathways
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:mtuh00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1218280..1218384
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system