KEGG   Mycobacterium tuberculosis Haarlem: TBHG_03960Help
Entry
TBHG_03960        CDS       T02845                                 

Definition
cellulase CelA2a
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mtul  Mycobacterium tuberculosis Haarlem
Pathway
Starch and sucrose metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:mtul00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    TBHG_03960
Enzymes [BR:mtul01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.4  cellulase
     TBHG_03960
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1220687..1220791
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system