KEGG   Mycobacterium tuberculosis CCDC5079: CFBS_1155Help
Entry
CFBS_1155         CDS       T02679                                 

Gene name
celA2a
Definition
cellulase celA2a
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mtur  Mycobacterium tuberculosis CCDC5079
Pathway
Starch and sucrose metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:mtur00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    CFBS_1155 (celA2a)
Enzymes [BR:mtur01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.4  cellulase
     CFBS_1155 (celA2a)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1214246..1214350
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

  All links  
No link information was found.   
DBGET integrated database retrieval system