KEGG   Mycobacterium tuberculosis H37Rv: RVBD_1089AHelp
Entry
RVBD_1089A        CDS       T02178                                 

Definition
cellulase CelA2a
Orthology
K01179  
endoglucanase [EC:3.2.1.4]
Organism
mtv  Mycobacterium tuberculosis H37Rv
Pathway
Starch and sucrose metabolism
Metabolic pathways
Class
Metabolism; Carbohydrate metabolism; Starch and sucrose metabolism [PATH:mtv00500]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1215522..1215626
Genome map
AA seq 34 aa AA seqDB search
MNGAAPTNGAPLSYPSICEGVHWGHLVGGHQPAY
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgaacggtgctgccccaaccaacggcgccccgctgagttacccctcgatctgcgagggc
gtgcactggggccacctcgtcggtgggcaccaacctgcctactga

DBGET integrated database retrieval system