KEGG   Myxococcus xanthus: MXAN_0099Help
Entry
MXAN_0099         CDS       T00366                                 

Definition
(GenBank) hypothetical protein
Organism
mxa  Myxococcus xanthus
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: 
Motif
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
114381..114485
Genome map
AA seq 34 aa AA seqDB search
MFDYGLGGGACLTGARSPFNMPSTFPLRSETRRR
NT seq 105 nt NT seq  +upstreamnt  +downstreamnt
atgttcgattatgggctcggagggggcgcgtgcttgacgggcgctcgctcgcccttcaac
atgccgtccacgtttcctcttcggagtgagacgcggcggcggtga

DBGET integrated database retrieval system