KEGG   Nocardiopsis dassonvillei: Ndas_2360Help
Entry
Ndas_2360         CDS       T01248                                 

Definition
ROK family protein
Orthology
K00845  
glucokinase [EC:2.7.1.2]
Organism
nda  Nocardiopsis dassonvillei
Pathway
Glycolysis / Gluconeogenesis
Galactose metabolism
Starch and sucrose metabolism
Amino sugar and nucleotide sugar metabolism
Streptomycin biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Glycolysis (Embden-Meyerhof pathway), glucose => pyruvate
Brite
KEGG Orthology (KO) [BR:nda00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    Ndas_2360
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    Ndas_2360
   00052 Galactose metabolism
    Ndas_2360
   00500 Starch and sucrose metabolism
    Ndas_2360
   00520 Amino sugar and nucleotide sugar metabolism
    Ndas_2360
  Biosynthesis of other secondary metabolites
   00521 Streptomycin biosynthesis
    Ndas_2360
   00524 Butirosin and neomycin biosynthesis
    Ndas_2360
Enzymes [BR:nda01000]
 2. Transferases
  2.7  Transferring phosphorus-containing groups
   2.7.1  Phosphotransferases with an alcohol group as acceptor
    2.7.1.2  glucokinase
     Ndas_2360
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif Motif
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1:complement(2806562..2807470)
Genome map
AA seq 302 aa AA seqDB search
MSAVVAVDVGGTLTKAALVDADHRVLLARRTPTPTGPRVAEAVIDTAAALVGELRSASRD
APVAAVGAVVPGIVDVGRGVAVWSENLLWRDVPVRDRLAERCGLPVALGHDVAAGGLAEQ
RLGAARGHEDAVFVPIGTGLSAALLLGGRAHTAGGFAGEMGHVDVGHGGPCACGATGCLE
AIASAAAIARRYAERTGRPTREAREVADLLVRGDPDARRVWDEAVDALALGLSWISAVLA
PRVIVVGGGLARSGELLLAPLRERLEARLTFHRRPDVVPAALGDEAGCLGAALLARELLE
RP
NT seq 909 nt NT seq  +upstreamnt  +downstreamnt
gtgagcgccgtcgtcgccgtcgacgtcggcggaaccctgaccaaggcggccctcgtggac
gccgaccacagggtgctcctcgcccgcaggacgcccacgcccacgggaccccgcgtcgcc
gaggccgtgatcgacaccgccgccgccctcgtcggggagctgcgctccgcgtcccgggac
gccccggtcgcggcggtcggggcggtcgtccccggcatcgtcgacgtcgggcgcggggtg
gcggtgtggtcggagaacctcctctggcgcgacgtgccggtacgcgaccggctcgccgag
cgctgcgggctgcccgtcgccctcgggcacgacgtggccgccggaggcctggccgaacag
cggctcggcgccgcgcgcggccacgaggacgccgtcttcgtccccatcggcaccggcctg
tcggcggccctgctcctgggcgggcgggcgcacaccgcgggcggcttcgcgggcgagatg
ggacacgtggacgtgggccacggcgggccgtgcgcctgcggcgccaccgggtgcctggag
gcgatcgcctcggccgcggccatcgcccgccgctacgccgagcgcacggggcggcccacc
cgggaggcccgtgaggtggccgacctcctcgtacggggcgaccccgacgccaggcgggtg
tgggacgaggccgtggacgccctggcgctcggcctctcctggatcagcgccgtgctcgcc
ccgcgggtcatcgtggtcggcggcggtctggcccggtccggcgaactgctgctcgccccg
ctgcgcgaacggctcgaagcccgcctgaccttccaccggcgtccggacgtggtccccgcc
gcgctgggcgacgaggccgggtgcctgggcgcggcgctgctggcccgggaactgctggag
cgcccgtga

DBGET integrated database retrieval system