KEGG   Neisseria gonorrhoeae FA 1090: NGO0711Help
Entry
NGO0711           CDS       T00237                                 

Definition
(RefSeq) alcohol dehydrogenase
Organism
ngo  Neisseria gonorrhoeae FA 1090
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
Position
710377..711393
Genome map
AA seq 338 aa AA seqDB search
MKAMVYHGANDIRFEEKPRPQIIDPTDAVVKIVKTTICGTDLGIWKGKNPEVADGRILGH
EGIGIVEEVGEAVKNIKVGDKVIISCVSKCCTCDNCKIQLYSHCRNGGWILGYMIDGTQA
EYVRTPYADNSLVPPHDNVNEEIALLLSDALPTAHEIGVQYGDVKPGDTVFIAGAGPVGM
SALLTAQLYSPAAIIVCDMDENRLKPAKELGATHTISPASGDVSKQVFAIVGEDGVDCAI
EAVGIPATWNMCQDIVKPGGHIAVVGVHGQSVDFKLEKLWIKNLAITTGLVNANTTEILM
KAIFSSSVDYTKMLTHRFKFSQLEKPTTCSNTPPKTKR
NT seq 1017 nt NT seq  +upstreamnt  +downstreamnt
atgaaagcaatggtttatcacggcgcaaacgacatccgttttgaagaaaaaccccgcccg
cagattatcgatccgaccgatgcggtggtgaaaatcgtcaaaaccacgatttgcggtacc
gacttgggtatttggaaaggcaaaaaccccgaagtcgccgacggtcgtatcctcggtcat
gaaggcatcggtattgtagaagaagtcggcgaggctgtaaaaaacatcaaagtcggcgat
aaagtcattatttcatgcgtcagcaaatgctgcacttgcgacaactgcaaaatccaactt
tattcgcactgccgcaacggcggctggattttgggctatatgattgacggcacgcaggcc
gaatacgtccgcacgccttatgccgacaacagcctcgtgccgccgcacgacaacgtcaac
gaagaaatcgccctgctgttgagcgacgctttaccgaccgcccacgaaatcggcgtgcaa
tacggcgatgtgaaacccggcgataccgtattcatcgcaggtgccggccctgtcggtatg
tccgccttgttgaccgcccaactgtatagccctgccgccattatcgtgtgcgatatggac
gaaaaccgtttgaaaccggcgaaagagttgggcgcgacccataccatcagccccgcttcc
ggcgacgtctccaaacaagttttcgccatcgtcggcgaagacggcgtagattgtgccatc
gaagcggtcggtatccctgcaacttggaatatgtgccaagacatcgtgaaacccggcggt
catatcgccgtcgtcggcgtacacggtcaatccgttgatttcaaactggaaaaactgtgg
attaaaaatcttgccatcactaccggtttggtcaatgccaacaccaccgaaatactgatg
aaggcaattttcagcagctcagtggattacaccaaaatgttgacccaccgtttcaaattc
agccaattggaaaagcctacgacgtgttcaaacacgccgccgaaaaccaagcgatga

DBGET integrated database retrieval system