KEGG   Neisseria gonorrhoeae FA 1090: NGO0991Help
Entry
NGO0991           CDS       T00237                                 

Definition
(RefSeq) succinyl-diaminopimelate desuccinylase
Organism
ngo  Neisseria gonorrhoeae FA 1090
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
Position
complement(962111..963256)
Genome map
AA seq 381 aa AA seqDB search
MTETQSLELAKALISRPSVTPDDRDCQKLLAERLHKIGFAAEELHFGDTKNIWLRRGTKA
PVVCFAGHTDVVPTGPVEKWDSPPFEPTERDGRLYGRGAADMKTSIACFVTACERFVAEH
PDHQGSIALLITSDEEGDALDGTTKVVDVLKARGELIDYCIVGEPTAVDKLGDMIKNGRR
GSLSGSLTVKGKQGHIAYPHLAVNPIHTFAPALLELTQEIWDEGNEYFPPTSFQISNING
GTGATNVIPGELNVKFNFRFSTESTETGLKQRVHAILDKHGVQYDLQWSCSGQPFLTHAG
KLTDVARTAIAETCGVEAELSTTGGTSDGRFIKAIAKELIELGPSNATIHQINENVRLDD
IPKLSAVYERILARLLAEKAV
NT seq 1146 nt NT seq  +upstreamnt  +downstreamnt
atgaccgaaacccaatccctagaactcgccaaagcgttgatttcccgcccgtccgttacc
cccgacgaccgagattgccaaaaactgcttgccgaacgcctgcacaaaatcggttttgcg
gctgaagaactccatttcggcgacaccaaaaacatctggttgcgacgcggcacgaaagct
cccgtcgtctgttttgcagggcataccgacgttgtgccgacaggtcctgttgaaaaatgg
gattcgcccccgttcgaaccgaccgagcgcgacggaagattatacgggcgcggcgcggcg
gacatgaaaaccagcatcgcctgtttcgttaccgcctgcgaacgctttgttgccgaacat
cccgaccatcaaggcagcattgcactcttgattacttccgacgaagagggcgatgcactg
gacggcacgaccaaagtcgtcgatgtgttgaaagcacgcggagagttgattgactactgc
atcgtcggcgaaccgaccgccgtggacaaattgggcgatatgattaaaaacggccggcgc
ggctcgctgtcgggcagcctgaccgtcaaaggcaagcaagggcatattgcttatcctcat
ttggcggtgaatcccatacatacttttgccccggccttgttagagctgacgcaggaaatt
tgggatgaaggcaacgaatatttcccgccgaccagctttcaaatttccaatatcaacggc
ggcacaggcgcgaccaacgtcattccgggcgagctgaacgtcaaatttaatttccgcttc
tccacagagtccaccgaaacagggctgaaacaacgcgtccacgccattttggacaaacac
ggcgtgcaatacgatttgcagtggtcgtgttcgggacagcccttcctgacccacgcgggc
aaactgaccgacgtggcacgcaccgccattgccgaaacctgcggcgttgaggccgaattg
tccaccaccggcggcacttcggacggacgcttcattaaagccattgcgaaagaactcatc
gaattaggcccgtccaatgccaccatccaccaaatcaacgaaaatgtgcggctggacgat
attccgaagctgtcggcggtgtatgagaggatattggcgcggttgttggctgaaaaggcc
gtctga

DBGET integrated database retrieval system