KEGG   Neisseria gonorrhoeae FA 1090: NGO1492Help
Entry
NGO1492           CDS       T00237                                 

Definition
(RefSeq) phospholipase
Organism
ngo  Neisseria gonorrhoeae FA 1090
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
Position
complement(1455598..1456746)
Genome map
AA seq 382 aa AA seqDB search
MPTMGAEMNTRNMRYILLTGLLPTASAFGETALQCAALTDNVTRLACYDRIFAAQLPSSA
GQEGQESKAVLNLTETVRSSLDKGEAVIVVEKGGDALPADSAGETADIYTPLSLMYDLDK
NDLRGLLGVREHNPMYLMPFWYNNSPNYAPSSPTRGTTVQEKFGQQKRAETKLQVSFKSK
IAENLFKTRADLWFGYTQRSDWQIYNQGRKSAPFRNTDYKPEIFLTQPVKADLPFGGRLR
MLGAGFVHQSNGQSRPESRSWNRIYAMAGMEWGKLTVIPRVWVRAFDQSGDKNDNPDIAD
YMGYGDVKLQYRLNDRQNVYSVLRYNPKTGYGAIEAAYTFPIKGKLKGVVRGFHGYGESL
IDYNHKQNGIGIGLMFNDWDGI
NT seq 1149 nt NT seq  +upstreamnt  +downstreamnt
atgccgacaatgggggcggagatgaatacacgaaatatgcgctatattcttttgacagga
ctgttgccgacggcatccgcttttggagagaccgcgctgcaatgcgccgctttgacggac
aatgttacgcgtttggcgtgttacgacaggatttttgcggcacagcttccgtcttcggca
gggcaggaagggcaggagtcgaaagccgtactcaatctgacggaaaccgtccgcagcagc
ttggataagggcgaggcggtcattgttgttgaaaaaggcggggatgcgcttcctgccgac
agtgcgggcgaaaccgccgatatctatacgcctttgagcctgatgtacgacttggacaaa
aacgatttgcgcgggctgttgggcgtacgcgaacacaatccgatgtaccttatgccgttt
tggtataacaattcgcccaactatgccccgagttcgccgacgcgcggtacgactgtacag
gaaaaattcggacagcagaaacgtgcggaaaccaaattgcaggtttcgttcaaaagcaaa
attgccgaaaatttgtttaaaacccgcgcggatctgtggttcggctacacccaaagatcc
gattggcagatttacaaccaaggcaggaaatccgcgccgttccgcaatacggattacaaa
cctgaaattttcctgacccagcctgtgaaggcggatttgccgttcggcggcaggctgcgt
atgctcggtgcgggttttgtccaccagtccaacggacagagccgtcccgaatcgcgttcg
tggaacaggatttatgccatggcaggcatggaatggggcaaattgacggtgattccgcgc
gtgtgggtgcgtgcgttcgatcagagcggcgataaaaacgacaatcccgatattgccgac
tatatggggtatggcgacgtgaagctgcagtaccgcctgaacgacaggcagaatgtgtat
tccgtattgcgctacaaccccaaaacgggctacggcgcgattgaagccgcctacacgttt
ccgattaagggcaaactcaaaggcgtggtacgcggattccacggttacggcgagagcctg
atcgactacaaccacaagcagaacggtatcggtatcgggttgatgttcaacgactgggac
ggcatctga

  All links  
No link information was found.   
DBGET integrated database retrieval system