KEGG   Neisseria gonorrhoeae FA 1090: NGO1730Help
Entry
NGO1730           CDS       T00237                                 

Gene name
ruvA
Definition
(RefSeq) Holliday junction ATP-dependent DNA helicase RuvA
Organism
ngo  Neisseria gonorrhoeae FA 1090
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
NCBI-ProteinID: 
Position
1690144..1690728
Genome map
AA seq 194 aa AA seqDB search
MISRLTGKLVEKNPPQIVIDVNGVGYEADVSMQTFYNLPPVGESVQLFTQLIIREDAHLL
FGFATAEERKTFRQLIKVGGIGAKTALGILSAMTADELARAVAEEDVKRLSSAPGIGKKT
AERMVLELRGKLVAHTVTDGLFAASPAADETEDIVSTLLALGYNEREAKAAVKGVPKGTD
VGEGVRLALKNLLK
NT seq 585 nt NT seq  +upstreamnt  +downstreamnt
atgatcagcagactgaccggcaaactggttgaaaaaaaccctccgcaaatcgtcatcgat
gtcaacggtgtcggttatgaagccgacgtatcgatgcagaccttctacaacctgccgccc
gtgggtgaaagcgtacaactgtttacccagcttatcattcgggaagacgcacatctttta
tttggttttgccactgcggaagaacgcaagaccttccgccaactgattaaggtcggcggc
atcggcgcgaaaacggctttgggcattttgtcggcgatgacggcagacgagctggcgcgg
gcggttgcagaagaagatgtcaaacgcctctcctccgctccgggaatcggcaaaaaaacc
gccgaacgtatggtcttggaactgcgcggcaagctggtcgcgcatacggtaacggacggg
ctgtttgccgcctcacccgccgccgacgaaacggaagacatcgtcagcacgctgcttgcg
ctgggttacaacgaacgcgaggcaaaagcggcggtcaaaggcgttccgaaggggacggac
gtgggcgaaggcgtgcgccttgccctgaaaaacctgctgaaataa

  All links  
No link information was found.   
DBGET integrated database retrieval system