KEGG   Neorickettsia risticii: NRI_0046Help
Entry
NRI_0046          CDS       T00951                                 

Definition
succinate dehydrogenase, hydrophobic membrane anchor protein
Orthology
K00242  
succinate dehydrogenase membrane anchor subunit
Organism
nri  Neorickettsia risticii
Pathway
Citrate cycle (TCA cycle)
Oxidative phosphorylation
Metabolic pathways
Biosynthesis of secondary metabolites
Microbial metabolism in diverse environments
Carbon metabolism
Module
Citrate cycle (TCA cycle, Krebs cycle)
Citrate cycle, second carbon oxidation, 2-oxoglutarate => oxaloacetate
Succinate dehydrogenase, prokaryotes
Brite
KEGG Orthology (KO) [BR:nri00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    NRI_0046
  Carbohydrate metabolism
   00020 Citrate cycle (TCA cycle)
    NRI_0046
   00650 Butanoate metabolism
    NRI_0046
  Energy metabolism
   00190 Oxidative phosphorylation
    NRI_0046
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: 
Motif
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
38521..38658
Genome map
AA seq 45 aa AA seqDB search
MLGLNVIIEDYIASSILRRVLVFLNIIFVGSTLFAFVAVFYRLFF
NT seq 138 nt NT seq  +upstreamnt  +downstreamnt
ttgctcggattgaatgtaataatagaggattacatcgcttcttctattctgcgaagggtc
cttgtttttttgaatattatcttcgtcggctctactctttttgcgtttgtagctgtattt
tatagactatttttttag

DBGET integrated database retrieval system