KEGG   Olsenella uli: Olsu_0776Help
Entry
Olsu_0776         CDS       T01285                                 

Definition
glutathione peroxidase
Orthology
K00432  
glutathione peroxidase [EC:1.11.1.9]
Organism
ols  Olsenella uli
Pathway
Glutathione metabolism
Arachidonic acid metabolism
Brite
KEGG Orthology (KO) [BR:ols00001]
 Metabolism
  Lipid metabolism
   00590 Arachidonic acid metabolism
    Olsu_0776
  Metabolism of other amino acids
   00480 Glutathione metabolism
    Olsu_0776
Enzymes [BR:ols01000]
 1. Oxidoreductases
  1.11  Acting on a peroxide as acceptor
   1.11.1  Peroxidases
    1.11.1.9  glutathione peroxidase
     Olsu_0776
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
JGI: 
UniProt: 
Position
complement(877224..877667)
Genome map
AA seq 147 aa AA seqDB search
MIKPTQKNHWRDIRAPCHAPPPTYPPRVSLRRCVEARCSLAFQLYTILFCNILMPAINRR
EGGRMAGSIYDFTVMAQDGSEEPLADVNGGNESPLYAWLKGQRGGVMGSKIKWNFTRFLV
DCDGRVVERFAPTKTPEDIDASVAAPL
NT seq 444 nt NT seq  +upstreamnt  +downstreamnt
atgataaaacccacgcaaaaaaatcattggagggatattcgggccccctgtcacgcaccg
cctcccacataccctccgcgcgtgagccttcggcggtgcgtggaggcgcggtgttcgctc
gcctttcagttgtatacaatattattttgtaatatattaatgcctgcgatcaaccgacgg
gaaggaggacgcatggcgggctccatctacgatttcaccgtaatggcgcaggacggcagc
gaggagcccctggcagacgtcaacggtggcaacgagtccccgctctacgcctggctcaag
gggcagaggggcggggtcatgggttccaagatcaagtggaacttcaccaggttcctggtc
gattgcgacggacgcgtggttgagcgcttcgcccccaccaagacccccgaggacatcgac
gcctcggtggccgcccccctctag

DBGET integrated database retrieval system