KEGG   Oceanithermus profundus: Ocepr_R0007Help
Entry
Ocepr_R0007       tRNA      T01369                                 

Definition
(GenBank) tRNA-Lys
  KO
K14229  tRNA Lys
Organism
opr  Oceanithermus profundus
Pathway
opr00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:opr00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Ocepr_R0007
Non-coding RNAs [BR:opr03100]
 Transfer RNA
  tRNA
   Ocepr_R0007
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
502552..502628
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gggccgttagctcagtttggtagagcaaccgacttttaatcggttggtcgtaggttcgag
tcctacacggcccacca

DBGET integrated database retrieval system