KEGG   Pseudomonas aeruginosa PA38182: BN889_02362Help
Entry
BN889_02362       CDS       T03031                                 

Definition
putative trehalose synthase
Orthology
K05343  
maltose alpha-D-glucosyltransferase/ alpha-amylase [EC:5.4.99.16 3.2.1.1]
Organism
paeu  Pseudomonas aeruginosa PA38182
Pathway
Starch and sucrose metabolism
Metabolic pathways
Brite
KEGG Orthology (KO) [BR:paeu00001]
 Metabolism
  Carbohydrate metabolism
   00500 Starch and sucrose metabolism
    BN889_02362
Enzymes [BR:paeu01000]
 3. Hydrolases
  3.2  Glycosylases
   3.2.1  Glycosidases, i.e. enzymes that hydrolyse O- and S-glycosyl compounds
    3.2.1.1  alpha-amylase
     BN889_02362
 5. Isomerases
  5.4  Intramolecular transferases
   5.4.99  Transferring other groups
    5.4.99.16  maltose alpha-D-glucosyltransferase
     BN889_02362
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
Position
2441087..2441527
Genome map
AA seq 146 aa AA seqDB search
MVQGDARFIDFEGEPARSLEERRQRHSPMKDVGGMLRSFDYAAAMVLRNAQSTDSSEQAD
SARRKVAMRYRSEARDAFLAGYRAAAAGLMHAWHGREGEGAALALACLEKAAYELLYEAD
YRPDWLEVPLAGLAELTEHLLKGKNR
NT seq 441 nt NT seq  +upstreamnt  +downstreamnt
atggtccagggcgacgcacgcttcatcgacttcgagggcgagccggcgcgcagcctggaa
gagcgccgccagcgccacagtccgatgaaggacgtcggcggcatgctgcgctcgttcgac
tacgcggcggcgatggtcctgcgcaacgcgcagagcaccgatagctcggaacaggccgac
agcgcccggcgcaaggtcgccatgcgctatcgcagcgaagcccgcgacgccttcctggcc
ggctatcgggccgccgcggcgggtctcatgcacgcctggcacggtcgcgaaggcgagggg
gcggcgctggccctggcctgcctggaaaaggccgcctacgaactgctctacgaagccgac
taccgccccgactggctggaagtgcctctcgccggtctggccgaactcaccgaacacctc
ctgaagggcaagaaccgatga

DBGET integrated database retrieval system