KEGG   Plasmodium chabaudi: PCHAS_111040Help
Entry
PCHAS_111040      CDS       T01108                                 

Gene name
PC000036.02.0
Definition
(RefSeq) stearoyl-CoA desaturase, putative
  KO
K00507  
stearoyl-CoA desaturase (Delta-9 desaturase) [EC:1.14.19.1]
Organism
pcb  Plasmodium chabaudi
Pathway
Biosynthesis of unsaturated fatty acids
Fatty acid metabolism
Brite
KEGG Orthology (KO) [BR:pcb00001]
 Metabolism
  Overview
   01212 Fatty acid metabolism
    PCHAS_111040 (PC000036.02.0)
  Lipid metabolism
   01040 Biosynthesis of unsaturated fatty acids
    PCHAS_111040 (PC000036.02.0)
Enzymes [BR:pcb01000]
 1. Oxidoreductases
  1.14  Acting on paired donors, with incorporation or reduction of molecular oxygen
   1.14.19  With oxidation of a pair of donors resulting in the reduction of O2 to two molecules of water
    1.14.19.1  stearoyl-CoA 9-desaturase
     PCHAS_111040 (PC000036.02.0)
Lipid biosynthesis proteins [BR:pcb01004]
 Desaturase
  First
   PCHAS_111040 (PC000036.02.0)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
UniProt: 
Position
11
AA seq 942 aa AA seqDB search
MTLQMGFGDTVTAIWSMLDENYWDIKYVGIIYISYIVGLASCYFLRKICSQSFVNFIKVL
KGVLVSIISVMSLKYLNINTRVGINLLHIYNIVQVCSFLEVFSIRTKHPNKKLSSEQTPI
VNKYELDNENADQHTLIGDASQHLEKIAKTILNDKKSLEKNKGILKEKELIEQIEQEEKK
EEEYMKAKNNSNSQKRNNRNKINLVWIYVLLSKTFNVMFFSLFWKLIPNLTIVKIFLTLQ
LCTSLIYTANTVYKNNSNIKLLKKLSDGLNIVYYIFISLFFTKILYTFDDNYNNSIIQNF
AVVSIVFHMYYGYMAFVKYIYDYYKQFRPSLFSFILFFHVFSIIGIIKLYHHEHRKSLLI
QCIAFYLINGFGITFGAHRLWSHRAFKASTFVQVLFLILNSFANQGSVIIWAKNHRLHHK
YSDTKYDPHNIRNGFFYSHVGWLLYQKTKFVKEKEKEIYVDDLLQNPILMLQHKLDPYFN
FFFCFIIPGIYTYYMYNNFWDGFLILGALRWIITLHATWSINSASHSFGHRPYNDDIKAS
NNIFTSIVALGEGCHNYHHVFPYCYAMNENFYILSINPTKYVIQLFYYLGLVWDLKSAQN
ICKEVRLRESLKIEQRNKRLSENIKNQILKKEDTGYITDLMNSFKAFCNDYINISTFMYI
LYFLRDITIMLTIFLIHIWYCYNKYGNGTAFSNLSLENNKLLNIVLFTLFHIILYALPMG
TMFISLYSLVYECKRGLIFKNQFLNNLFGSIISSFILLPYSSEKSRKSLLTSLNEDFFKV
LKGPIYFDLYTIIFSLVSVLYGFIAYGFGHFYFCTFFVIPYIVFNAWLLLYIYLLKNPPC
LNAQIHSKDVDINILNYVAFQSLLEWKKNNSIYQSKKRLYKFVFSFINFMHHHLCYTHVV
EFINSKIPSYRTKEICKYFDKTLDQYYFMRNDKFMEILKEFL
NT seq 2829 nt NT seq  +upstreamnt  +downstreamnt
atgacgttgcaaatgggctttggtgacacagtcaccgctatttggagtatgttagacgaa
aattattgggatattaaatatgtaggaataatatatatatcgtatattgttggtttggct
tcttgctattttttgagaaaaatttgttctcaatcttttgttaattttataaaagtttta
aaaggtgttttagtttcaataatttctgtgatgagcttgaaatatttaaacataaatacc
agggtaggcattaatttacttcacatatataatattgtgcaagtgtgtagctttttagaa
gtatttagcataagaactaaacacccaaataaaaagttgtcaagcgagcaaacaccaatc
gttaataaatatgagttagataatgaaaatgcagatcaacacacattaataggggatgcg
tcacaacatttagaaaaaatagcaaagactattttgaatgacaaaaaatccttagagaaa
aataaaggaatattaaaagaaaaggaacttatagaacaaattgaacaagaagaaaaaaaa
gaagaagaatatatgaaagcaaaaaataatagtaattcccaaaaaagaaataatagaaat
aaaataaatttggtttggatttatgttttactttcaaaaacatttaatgtaatgtttttt
tctttattttggaagttaatacccaatttgacaatagtaaaaatatttttgaccttacag
ttatgtacaagcttgatttatactgctaatacagtttacaaaaacaattcaaatataaaa
ttattgaaaaaattatcagatgggcttaatattgtatattatatttttataagtttattt
tttacaaagatattgtatacatttgatgacaattataataatagtataatacaaaatttc
gcagtcgtttctattgtctttcatatgtattatggatatatggcatttgttaaatatatt
tatgattattataagcaattcagaccatcattattctcatttatattattttttcatgta
ttttccataatcggaataataaaattatatcaccatgaacaccgaaaatccttgttaata
cagtgcatagcattttacctcattaatggatttgggataacatttggtgcccatcgattg
tggtcacatagagcatttaaagctagtacattcgtacaagttttatttctaattttgaat
agttttgcaaatcaaggtagtgtaatcatatgggcaaagaatcatcgtttacatcataaa
tatagtgatacaaaatatgatcctcataatataagaaatggttttttttatagtcatgtt
ggatggttattatatcagaaaacaaaatttgtaaaggaaaaagaaaaggaaatttatgtt
gacgatctattacaaaatccaattcttatgttacaacataaattagatccatatttcaac
ttttttttttgtttcataataccaggtatatatacctactatatgtataacaatttttgg
gatggatttttaattttaggggctcttagatggattattacgttgcatgccacatggtca
attaatagtgcttctcattcatttggacatagaccatataatgatgatataaaagcttct
aacaatatctttacatcaatagtagctcttggagagggatgtcataattatcatcatgta
tttccatattgttatgctatgaatgaaaatttttatattcttagtataaaccccacaaaa
tatgtaatacagcttttttattatttgggattagtatgggatttgaaatcagcacaaaat
atatgtaaagaagtccgattaagagaatcattaaaaatagagcaaagaaataaaagatta
agtgaaaacattaaaaatcaaatattgaaaaaagaagacacaggttatataacagattta
atgaattcctttaaagcattttgtaacgattatataaatatttctacatttatgtatata
ttatactttttaagagatattactattatgcttactattttcctaatccacatatggtat
tgttataataaatatggaaatggaacagccttttcaaatttatcattagaaaataataaa
ctgttaaatattgttttgtttacactatttcatataattctatatgccttacccatggga
acgatgtttataagtctctattcactagtttatgaatgcaaaagaggattaatctttaaa
aatcagttccttaacaacttatttggtagcataatatcatcttttattttattaccatat
tcctctgaaaaatcaagaaaatccttattaacatcactaaatgaagatttctttaaagtt
ttaaaagggccaatatactttgatttatatacaattattttttctttagtatcagtatta
tatggatttattgcttacggatttgggcacttttatttttgcacctttttcgtaatacca
tatatagtttttaatgcatggctattactttatatttatttgttaaagaatccaccatgc
ttaaatgcccagatacattcaaaggacgtagatataaatattttaaattacgttgccttt
caatcattattggaatggaaaaaaaataattcaatttaccaaagcaagaaaagattatat
aaatttgttttctcctttatcaattttatgcatcatcacttatgctacacacatgttgtg
gaatttataaattcaaaaataccaagttatagaacaaaggaaatatgcaaatattttgac
aaaactttagatcagtactattttatgcgtaatgacaagttcatggaaatactaaaagaa
tttttataa

DBGET integrated database retrieval system