KEGG   Plasmodium chabaudi: PCHAS_071660Help
Entry
PCHAS_071660      CDS       T01108                                 

Gene name
PC000316.01.0
Definition
(RefSeq) histone acetyltransferase GCN5, putative (EC:2.3.1.48)
  KO
K06062  
histone acetyltransferase [EC:2.3.1.48]
Organism
pcb  Plasmodium chabaudi
Brite
Enzymes [BR:pcb01000]
 2. Transferases
  2.3  Acyltransferases
   2.3.1  Transferring groups other than aminoacyl groups
    2.3.1.48  histone acetyltransferase
     PCHAS_071660 (PC000316.01.0)
Transcription machinery [BR:pcb03021]
 Eukaryotic type
  RNA polymerase II system
   Coactivators
    SAGA/TFTC/STAGA complex
     PCHAS_071660 (PC000316.01.0)
Chromosome [BR:pcb03036]
 Eukaryotic Type
  Histone modification proteins
   HATs (histone acetyltransferases)
    PCHAS_071660 (PC000316.01.0)
   HAT complexes
    PCAF complex
     PCHAS_071660 (PC000316.01.0)
    STAGA complex
     PCHAS_071660 (PC000316.01.0)
    TFTC complex
     PCHAS_071660 (PC000316.01.0)
    SAGA complex
     PCHAS_071660 (PC000316.01.0)
    SLIK complex
     PCHAS_071660 (PC000316.01.0)
    ADA-HAT complex
     PCHAS_071660 (PC000316.01.0)
    HAT-A2 complex
     PCHAS_071660 (PC000316.01.0)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
UniProt: 
Position
7
AA seq 1214 aa AA seqDB search
MECIVASENSRFSPYHSLLTSGNIYNYLDSLQIIGNIHNKYTEINDIVDKVYKERTDLLS
CVKNVKHNDANFEKFQINSITQNVQLLLRYSNAIRMCSSVDNGNGGSENGENGNEGSRND
ENGNEGSGNEGCGSAGSGGGENGNGGDDGNEGDGWEDKKRCGNDDEEDEQKNKNEKSRNG
NNNEDEENGHTNGEINYNVNGMNNLSKQMYDEKMKNKIDMNIKHDNIIGNMPNNMIGNLD
GNNMKYDAFQGNDKMMINGNYINNNMNHPFNINKNLMMNQKNMNLNTAGKTYRGNKINEP
GKTPNGMMVKENEEEYRNDNMNNTGIVNDGKKDFIKPDGMDINNMNNMGNNPNVYNQMMA
GHINRINNNNLLIMKNMNNFNPMNFPMNSHNFNMMPPYNNIGSIINNSMPNMPNMPNSFM
INAQMNGVSNNLNDINIGNPSSAILGILGNPSYNNSGIPNNVDPNLSKKSFSISIDKEKG
NKDSGNKGGNNNETNENGKKNNIKNSSNKNINNVEGGNSKNSIKNIRIENLKFNDNIDLK
NVDGIDLSPYFVNGKYCSKLSNDDKIYNIIYYIVNNSLHEYLTDFYNTEDLGYKEKDEIE
EDENVQSVLKNGIAEGREITSLTPDKNGKEEQDGLVGSPEQINEAEESNKNKRNADEIDG
KGSDKEDEDDDSMIRKKKKIKIENENSGIDSVSKDTQMDDDEKKDGNMASTGKCMNNLKQ
EMKDNENNYILNEITKSICSIINLQQLMPVNTRLNNPGLIYDPNYETIYSKWKSFLKKEQ
SSGNVISKCFSRDFLHTALLCNYDSIIEDLKKTAVKKKIKYFFLHLCLESDLPINVALML
FLNATKQSDKLQSLLPSETGLGYLHRDAGGAKEENMGIITFECITNDREPDHLIKLITLK
NIFSRQLPKMPREYIVRLVFDRNHYTFCLLKKNTVIGGVCFRPYFEQKFAEIAFLAVTST
EQVKGYGTRLMNHLKEHVKKFGIEYFLTYADNFAIGYFRKQGFSQKISMPKERWFGYIKD
YDGGTLMECYIFPNINYLRLSEMLYEQKKTVKKAIHFIKPQIIFKGLNYFTENKGGNLHP
SNIPGLLEIGWKKEYKDMAAKKTQHKEVQLKDQIINVLDYLEKQQSAWPFLKPVSLSEAP
DYYDIIKEPTDILTMRRKARHGEYKTKEDFGIELKRMFDNCRLYNAPTTIYFKYANELQA
LIWPKYEEISEMAK
NT seq 3645 nt NT seq  +upstreamnt  +downstreamnt
atggaatgtattgtagccagtgaaaacagtaggttttccccttatcatagtcttttaaca
agtggaaatatttacaattatttagattcgttacaaattattggaaatattcataataaa
tatacagaaataaatgatatagttgataaggtatataaagagagaacagacttgttgagt
tgtgttaaaaatgtgaaacacaatgatgcgaactttgaaaaatttcaaataaattcgatt
acacaaaatgtacagctattgctgagatatagtaacgcaatccggatgtgtagcagtgtt
gataatgggaatggaggtagtgaaaacggtgagaatggaaatgaagggagtagaaatgat
gagaatggaaacgaaggaagtggaaatgaaggatgtggaagtgctggaagtggtggtgga
gaaaatggaaatggaggggatgatggaaatgaaggtgatggatgggaagataaaaaaaga
tgtgggaatgatgatgaagaggatgaacaaaaaaataaaaatgaaaaatcgagaaatgga
aataataatgaagacgaagaaaatggtcatacaaatggtgaaataaattacaatgtaaat
ggaatgaataatttatcaaaacaaatgtatgatgaaaaaatgaaaaataaaatagatatg
aatataaaacatgataatataattggaaatatgccgaataatatgattggaaatttagat
ggaaataatatgaaatatgatgcatttcaaggaaatgacaaaatgatgataaacggaaat
tatattaataataatatgaaccatccttttaatataaataaaaatttgatgatgaatcaa
aaaaatatgaatttaaatacagcaggaaaaacatatagaggaaataaaataaacgaacca
ggtaaaacaccaaatggaatgatggttaaagagaatgaagaagaatatagaaatgataat
atgaataatactggaatagtcaatgatggaaaaaaagattttataaaaccagatggaatg
gatataaacaatatgaacaacatggggaataatccaaatgtttataatcaaatgatggct
ggacatataaatcgtataaataataacaatcttctaataatgaaaaatatgaataatttt
aatcctatgaatttccctatgaattcccataattttaatatgatgccaccatataataat
ataggaagtataataaataacagcatgcccaacatgcccaatatgcccaatagctttatg
ataaatgcccaaatgaatggagttagtaacaatttaaatgatataaatattggaaaccct
tctagtgctatccttggtattttaggcaacccatcttataataatagtgggatcccaaat
aatgtcgatccaaacttaagtaaaaaaagtttttcaatttctattgataaagagaaaggt
aataaggatagtggaaataaaggtgggaacaataatgaaacgaatgaaaatggaaaaaaa
aataatattaaaaattcaagtaataagaatataaataatgttgaaggaggaaatagtaag
aatagtataaaaaatatacgtattgaaaatttaaaatttaatgataatatagatttaaaa
aatgttgatggaattgatttaagtccatattttgtaaatggaaaatattgttctaaatta
tcgaatgatgataaaatatataatataatttattatattgttaataattcattacatgaa
tatttaactgatttttataatactgaagatttaggatataaagaaaaagatgaaatagaa
gaagacgaaaatgttcaaagcgttttaaaaaatggaattgctgagggtagagaaataact
tcattgaccccagataaaaatggaaaagaagaacaggatggattagttggaagtcctgaa
caaattaacgaagctgaggagagtaataaaaataaaagaaatgccgatgagattgatggg
aagggaagtgataaagaggatgaagatgatgatagtatgatacgaaaaaaaaaaaaaata
aaaattgaaaatgaaaatagtggaatagattcagtttcgaaagatacccaaatggatgat
gatgaaaaaaaagatggtaatatggcaagtacaggcaaatgcatgaataatttgaaacaa
gaaatgaaagataatgaaaataattatatattaaatgaaataacaaaaagtatttgctct
ataataaatttacaacaactaatgcctgtaaatacaagattaaataatcctggtttaatt
tatgatccgaattatgaaaccatatattcaaaatggaaatcctttttaaagaaagaacaa
tcaagtggaaatgttataagtaaatgtttttcacgagattttttacatactgctttatta
tgtaattatgatagtataattgaagatttgaaaaaaacagcagtgaaaaaaaaaataaaa
tatttctttcttcacctttgtttggaatctgatcttcctatcaacgttgcattgatgctc
tttttgaatgcgacgaagcagagcgacaagttgcagtccctacttccttccgaaactggg
ttgggatatctgcatcgagacgcaggaggagcgaaagaagagaacatgggaatcatcacc
tttgagtgcataacaaatgatagagaaccagatcacttaattaaattaataacattaaaa
aatatattttcaaggcaattacctaaaatgcctagagaatatattgtcagacttgtattt
gatagaaatcattatacattttgtttattaaaaaaaaatacagtaattggtggtgtctgt
tttagaccttatttcgaacaaaaatttgctgaaattgcatttttagcagttacatcaaca
gagcaagtaaaaggatatggtactcgtcttatgaaccatttaaaagagcatgtaaaaaaa
tttggaattgaatattttctaacttatgcagataactttgctataggatattttagaaaa
caaggattttcacaaaagatttcgatgccaaaagaaagatggtttggatatataaaagat
tatgatggaggtacattaatggaatgttatattttcccaaatataaattatttaagatta
tctgaaatgttatatgaacaaaaaaaaacagtcaaaaaagctatacattttataaaacct
caaattatatttaaaggattaaattattttactgaaaataaaggaggaaatttacatcct
agtaatataccaggcttattagaaatcggatggaaaaaagaatataaagatatggcagca
aaaaaaacacaacataaagaagttcaactaaaagatcaaattataaatgttcttgattat
ttggaaaaacaacaatctgcttggccatttttaaaacctgttagtctttctgaagcccca
gattattatgacattatcaaagagcctactgatatattgacgatgcgaaggaaggcccgt
cacggcgagtataaaacgaaggaagactttggtattgagctgaagaggatgtttgataac
tgtcgattgtacaacgctccgacgacgatatactttaaatatgctaatgaattacaagcc
ttaatctggcctaaatacgaagaaattagcgaaatggcaaagtaa

DBGET integrated database retrieval system