KEGG   Plasmodium chabaudi: PCHAS_051230Help
Entry
PCHAS_051230      CDS       T01108                                 

Gene name
PC000339.04.0
Definition
(RefSeq) protoporphyrinogen oxidase (EC:1.3.3.4)
  KO
K00231  
oxygen-dependent protoporphyrinogen oxidase [EC:1.3.3.4]
Organism
pcb  Plasmodium chabaudi
Pathway
Porphyrin and chlorophyll metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:pcb00001]
 Metabolism
  Metabolism of cofactors and vitamins
   00860 Porphyrin and chlorophyll metabolism
    PCHAS_051230 (PC000339.04.0)
Enzymes [BR:pcb01000]
 1. Oxidoreductases
  1.3  Acting on the CH-CH group of donors
   1.3.3  With oxygen as acceptor
    1.3.3.4  protoporphyrinogen oxidase
     PCHAS_051230 (PC000339.04.0)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
UniProt: 
Position
5
AA seq 634 aa AA seqDB search
METNDKTYDFILVGGGIYSCCMYYYLKKHNPEIKILIIEKGNKLGGCIQTETYNNNVIYE
LGANVFKLCNNSYKLIKDLNLCDQIAIINKGLVRYISYENKLYPLYLSFLGYIYFPLISF
TNKIKLIYKILFKKYKHVNSYHYDISIKNYMKENFDSQHYQYLLLPLIYGSSGGHGDISA
LSFLSRNLKLVHNNKNSLRIWNEKIKTIDNDIISKSSLTNFNNNNSMNVKKCSQSSCAST
EYDDNVTLLNHADTNHNEHGHNRKNTYTTENSDINTNANTIESVPISKPVSITTPAHKQT
PYKRLNKNVDERNKQPLFENGTPNQYKQNFVLSIIGYSLKIIRNVFFSINYTIYKYFPML
YSNIGNKFLQRIEEEEKKKYIGKTVSLNYGLYEFIRHLKKHIHENDISANTELNYIEKNM
KNNIWTCNINKNNTKTNIYSKNIILTVNSKMCANILRKILPTQIKNNLEQFSYSSLMTAN
IYFNKEDITIPKNLFGLLSAEQNAHILGCFYANNMFTNRCENNKILLTLYIRDTNLPSEN
NDEQLKKNILNNLKNILPINNDAKPTILNVTKWKDILPAYSENYENKLKEFLNELENPQY
QNLFVDAGWITGTSISDRISSAMELSDYIIKKKY
NT seq 1905 nt NT seq  +upstreamnt  +downstreamnt
atggaaacaaacgataaaacgtatgattttattctggtcggaggggggatatacagttgt
tgtatgtattattatttaaagaagcacaatccagaaatcaaaattttaattattgaaaag
ggaaataaactaggaggttgtatacaaacagagacatataataataatgtaatatatgaa
ttaggggcaaatgtatttaaactatgtaataatagttataagttaattaaagacttaaat
ttatgtgatcaaattgcaataataaataaaggattagtacgatatatatcttatgaaaat
aaattatatccactatatttaagttttttaggatacatatattttcctttaatttcattt
acaaataaaattaaattaatatataaaatattatttaaaaaatataagcatgttaattca
tatcattatgatatatctataaaaaattatatgaaagaaaatttcgattctcagcattat
caatatttgttgttaccgttaatatatggatctagtggggggcatggagatatttctgca
ctttcttttttgtctcgaaatttgaagcttgttcataataataaaaattcattaagaata
tggaatgaaaaaataaaaaccattgataatgacattatttccaagtctagtcttacaaat
tttaacaataataattcaatgaatgtaaaaaaatgttctcaatcaagttgtgcatcaacc
gagtatgatgataatgtcacactactaaatcatgcagacacaaatcataatgaacatggt
cataatagaaaaaatacatataccaccgaaaacagtgatataaatacaaatgctaataca
attgaatcggtgcccatttcaaaacccgtttctataacaacaccagcacacaaacagact
ccctacaaacgccttaataaaaatgttgatgaaagaaacaaacagccattgtttgaaaat
ggcacaccgaatcaatataaacaaaacttcgtgttatccatcattggttattcactaaaa
attattagaaatgtttttttttctataaattatacaatatataaatatttccctatgcta
tatagtaatataggtaataaatttttacaacgtattgaagaagaagaaaaaaaaaaatat
attggaaaaacagtatcattgaattatggattatatgaatttattcgtcatctaaaaaaa
catatacatgaaaatgatatatcagcaaatacagaattaaattatatagaaaaaaatatg
aaaaataatatatggacatgtaatataaataaaaataatacaaaaacaaatatatatagt
aaaaatattatattaactgttaattcaaaaatgtgtgcaaatatattaagaaaaatttta
cctacccaaataaaaaataatcttgaacaattttcctattcatctttaatgacagcaaat
atatattttaataaagaagatataacaatacctaaaaatttatttggcttattatcagcg
gaacaaaatgcacatatacttggctgtttttatgcaaataatatgtttacaaataggtgt
gaaaataataaaattttattaaccttatatataagagacaccaatctaccttctgaaaac
aatgatgaacaattaaaaaaaaatatattaaataatttaaaaaacattctaccaattaat
aatgatgctaaaccaactatattaaatgtaacaaaatggaaagatattttacctgcatat
tcagaaaattatgaaaataaattaaaagaatttttaaatgaattagaaaatccacaatat
caaaatttatttgtagacgcaggatggattactggcacttccatatcagaccgaatatcc
tcagctatggaattgtctgattatatcataaaaaaaaaatattag

DBGET integrated database retrieval system