KEGG   Plasmodium chabaudi: PCHAS_112600Help
Entry
PCHAS_112600      CDS       T01108                                 

Gene name
PC000791.00.0
Definition
(RefSeq) acetyl-CoA synthetase, putative
  KO
K01895  
acetyl-CoA synthetase [EC:6.2.1.1]
Organism
pcb  Plasmodium chabaudi
Pathway
Glycolysis / Gluconeogenesis
Pyruvate metabolism
Propanoate metabolism
Metabolic pathways
Biosynthesis of secondary metabolites
Biosynthesis of antibiotics
Carbon metabolism
Brite
KEGG Orthology (KO) [BR:pcb00001]
 Metabolism
  Overview
   01200 Carbon metabolism
    PCHAS_112600 (PC000791.00.0)
  Carbohydrate metabolism
   00010 Glycolysis / Gluconeogenesis
    PCHAS_112600 (PC000791.00.0)
   00620 Pyruvate metabolism
    PCHAS_112600 (PC000791.00.0)
   00640 Propanoate metabolism
    PCHAS_112600 (PC000791.00.0)
Enzymes [BR:pcb01000]
 6. Ligases
  6.2  Forming carbon-sulfur bonds
   6.2.1  Acid-thiol ligases
    6.2.1.1  acetate---CoA ligase
     PCHAS_112600 (PC000791.00.0)
Lipid biosynthesis proteins [BR:pcb01004]
 Acyl-CoA synthetase
  Short/medium chain acyl-CoA synthetase
   PCHAS_112600 (PC000791.00.0)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
UniProt: 
Position
11
AA seq 904 aa AA seqDB search
MNNAEHNGVASKMDSSKIDNIDIDENIFLNSKSFPVNEAYEVDQNKFGGNNQIKDIKEYK
RMYEESIKNPELFWGDMAKNNLRWSQLFNKTYIGNFNKGNVSWFVNGKINACDNCVDRWV
EKHPNKTAIIWEKDTPNDSKKISYQKLLEKVCKIANLLKMYGVKKQDCVTIYLPMIPELI
YSMLACARIGAIHNVVFAGYSTRSLSERIISSGSTILITSDFGLRGGKLTKLKNIADGAM
EMTGMIKTCIVFKNKTKINDQNNSILNSKSNNLYNSSNICSQGSSHFLQYYTVGNATHKN
NNDPSQNGHDSVLHNDTNDANLSQNNKIDKKGAKEKDIQTLNKLISKNTNLNKKTQNKES
GTYKELYSNNDQYRIDGKENKLNENGAQMNGHISYDNNMINHNQVNAFEQLNNYNMHNGQ
PNCEQNCKSKYDFDENICTLKEGRDINGSLLMKNMRPYCPIEYVDSEDFLCILYTSGSTG
KPKGVTHTTAGYLLYAFATSKYIFDIKDDDIFGCVADIGWVTGHTYVVYGPLLNGITTTL
FSSIPTYPDCSRYWSLIQTHKITQFYTAPTALRTLMKHGDYYIKNYDLSSCRILGSVGEP
INPETWRWYYNVVGKKKCVIVDTYWQTETGGIVIAPIPHLFKMKPGSASLPFFGIQLEIL
NSKTLEPLNGPNVCGILCIKSSWPGMLRTVYGNHNRLIKTYFEPCPNYYFTGDGAYRDED
GYYWISGRIDDTLNVSGHRLGAAEIEHALVQHSCISESAVVSFSHKVKGEGILCFVVKKI
ASLSKYPECNNDNNNDELNNRSILSSNGDIVQNHTHENYTDEKLIEELKQYVRKVIGPIA
TPDIICIVPDLPKTRSGKIIRRILRAIAIGVNDYGDISTVSNYDVIEIIKNKFVESKEKR
YSIS
NT seq 2715 nt NT seq  +upstreamnt  +downstreamnt
atgaataacgcggaacacaatggagttgcttcaaagatggattcatcaaaaattgataat
attgatatagatgaaaatattttccttaatagtaaatcatttccagtaaatgaagcatat
gaggtagatcaaaataaatttggtggtaacaaccaaattaaagatataaaagaatataaa
agaatgtatgaagagagcataaaaaaccctgagttgttttggggtgatatggcaaaaaat
aatttaaggtggtctcaattatttaataagacgtatattggcaattttaataaaggaaat
gttagctggtttgttaatggcaaaataaatgcctgtgacaattgtgttgacagatgggtt
gaaaaacatcctaataagactgccattatatgggaaaaagatacaccaaatgattctaaa
aaaataagctatcaaaaattattagaaaaagtttgtaaaattgctaatttattaaaaatg
tatggagttaaaaaacaagattgtgtaaccatttatttgccaatgataccagaattgata
tattctatgttagcatgcgctagaataggtgctatacacaatgttgtttttgctggatat
tctactaggagtttatcagaaaggataatcagttcaggatcaactattttaattactagc
gattttggcttaaggggtggtaaattaaccaaattaaaaaatattgccgatggggcaatg
gaaatgactggaatgatcaaaacatgtatcgtttttaaaaacaaaacaaaaataaatgat
cagaacaatagcatattaaatagtaaatcaaataatttgtataattcatctaatatatgc
tctcaaggaagtagccatttcttgcaatattacacagttggaaatgcaacacataaaaat
aataatgatccaagtcaaaatgggcatgatagtgtattacataatgatactaatgatgcc
aatttatcccaaaataataaaatcgataaaaagggtgctaaggaaaaagatatacaaaca
cttaataaattaatatcaaaaaataccaatctaaataaaaaaactcaaaacaaggaaagt
ggtacatacaaagaattatatagcaacaatgatcaatatcgaatagatggaaaggaaaat
aaattgaatgaaaatggggcacaaatgaatgggcacatttcatatgataataatatgatt
aaccataatcaagtaaatgcatttgaacagcttaataattataatatgcacaatgggcaa
cccaattgtgagcaaaattgtaaaagtaaatatgattttgatgaaaatatatgtacacta
aaagaaggtcgagatattaatggctcattattaatgaaaaatatgagaccatattgccca
atagaatatgtagatagtgaagattttttatgtatattatatacatctggttctactggg
aaaccgaaaggagtgactcatactactgcagggtatttattatatgcatttgcaacatcc
aaatatatttttgatataaaagatgatgatatttttggttgtgttgctgatataggttgg
gtaacaggccatacttatgtagtatatggaccattattaaatggaataacaaccacctta
ttttcatctatacctacctatcctgattgtagtagatattggagcttaatacaaactcat
aaaataacacaattttatacagcccctactgcacttagaactttaatgaagcatggtgat
tattatattaaaaattatgatttatcatcttgtagaatattaggaagtgtaggagaacct
ataaacccagaaacatggagatggtattataatgttgttggaaaaaaaaaatgtgtaatt
gtcgatacatattggcaaacagaaacgggaggtattgttattgcacccataccccattta
tttaaaatgaaaccaggatctgcttctttaccattttttggtatccaattagaaatatta
aattcaaaaacattagagccattaaatggcccaaatgtatgtggtatattatgtataaaa
agttcatggccaggtatgttaagaacagtttatggaaatcataatagattaatcaaaaca
tattttgaaccatgccccaattactattttactggagatggtgcatatagagatgaagat
gggtattattggatatcaggaaggattgatgatacactaaatgtatcaggtcataggcta
ggcgctgcagaaattgaacacgcattagttcaacattcttgcatttctgaatcagccgtt
gtatctttttctcataaagttaaaggggaaggtattctatgttttgtcgttaaaaaaatt
gcaagtctttcaaaatatccagaatgtaataatgataataataatgatgaactaaataat
cgatctatattaagttcaaatggcgatattgtacaaaatcatactcatgaaaattatacc
gatgaaaaattgatagaagaattgaaacaatatgttagaaaagttattgggccaattgct
acaccagatataatatgtattgtccctgatttgccaaaaacaagaagtggaaaaattata
agaagaatattaagagctatagcaatcggagtgaatgattatggggatatatcaactgtt
tcaaattatgatgttattgaaattattaaaaataaatttgtggaatctaaggaaaaacgt
tattccatatcataa

DBGET integrated database retrieval system