KEGG   Plasmodium falciparum 3D7: PF14_0183Help
Entry
PF14_0183         CDS       T00095                                 

Definition
signal recognition particle, RNP, putative
Organism
pfa  Plasmodium falciparum 3D7
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
PlasmoDB: 
GeneDB: 
UniProt: 
Position
14:complement(782104..782304)
Genome map
AA seq 66 aa AA seqDB search
MQKEWDAIIFLRIFNILKIPAYHKTSVTEHILLEREYVEVMMNHEPPQAGNRAGLVIADV
RCEDYG
NT seq 201 nt NT seq  +upstreamnt  +downstreamnt
atgcaaaaggaatgggatgctataatatttctgagaattttcaatatcttaaaaattccc
gcctatcacaagacgtcagttactgaacatattcttctggagagagaatatgttgaagta
atgatgaatcatgaaccgcctcaggctggaaacagagcagggttagtgatcgctgacgta
cggtgtgaagattacggttga

DBGET integrated database retrieval system