
Database: Pfam
Entry: LMBR1
Original site: LMBR1 
#=GF AC   PF04791.15
#=GF DE   LMBR1-like membrane protein
#=GF AU   Waterfield DI, Finn RD, Bateman A
#=GF SE   Pfam-B_6189 (release 7.5)
#=GF GA   29.80 29.80;
#=GF TC   29.90 29.80;
#=GF NC   29.50 29.70;
#=GF BM   hmmbuild HMM.ann SEED.ann
#=GF SM   hmmsearch -Z 26740544 -E 1000 --cpu 4 HMM pfamseq
#=GF TP   Family
#=GF RN   [1]
#=GF RM   12032320
#=GF RT   Disruption of a long-range cis-acting regulator for Shh causes
#=GF RT   preaxial polydactyly. 
#=GF RA   Lettice LA, Horikoshi T, Heaney SJ, van Baren MJ, van der Linde
#=GF RA   HC, Breedveld GJ, Joosse M, Akarsu N, Oostra BA, Endo N, Shibata
#=GF RA   M, Suzuki M, Takahashi E, Shinka T, Nakahori Y, Ayusawa D,
#=GF RA   Nakabayashi K, Scherer SW, Heutink P, Hill RE, Noji S; 
#=GF RL   Proc Natl Acad Sci U S A 2002;99:7548-7553.
#=GF RN   [2]
#=GF RM   11287427
#=GF RT   Molecular cloning of a novel lipocalin-1 interacting human cell
#=GF RT   membrane receptor using phage display. 
#=GF RA   Wojnar P, Lechner M, Merschak P, Redl B; 
#=GF RL   J Biol Chem 2001;276:20206-20212.
#=GF RN   [3]
#=GF RM   11090342
#=GF RT   Acheiropodia is caused by a genomic deletion in C7orf2, the
#=GF RT   human orthologue of the Lmbr1 gene. 
#=GF RA   Ianakiev P, van Baren MJ, Daly MJ, Toledo SP, Cavalcanti MG,
#=GF RA   Neto JC, Silveira EL, Freire-Maia A, Heutink P, Kilpatrick MW,
#=GF RA   Tsipouras P; 
#=GF RL   Am J Hum Genet 2001;68:38-45.
#=GF DR   INTERPRO; IPR006876;
#=GF CC   Members of this family are integral membrane proteins that are
#=GF CC   around 500 residues in length. LMBR1 is not involved in preaxial
#=GF CC   polydactyly, as originally thought [1]. Vertebrate members of
#=GF CC   this family may play a role in limb development [3]. A member of
#=GF CC   this family has been shown to be a lipocalin membrane receptor
#=GF CC   [2]
#=GF SQ   2299
#=GS A0A067R9M0_ZOONE/1-551      AC A0A067R9M0.1
#=GS A0A0A2JD70_PENEN/9-289      AC A0A0A2JD70.1
#=GS LMBD1_ORYSJ/276-490         AC Q658I5.1
#=GS H2Q5U8_PANTR/21-258         AC H2Q5U8.1
#=GS G0R578_ICHMG/1-122          AC G0R578.1
#=GS A0A0D2MSU8_9CHLO/1-303      AC A0A0D2MSU8.1
#=GS A0A061EY95_THECC/235-334    AC A0A061EY95.1
#=GS E5SAB2_TRISP/20-199         AC E5SAB2.1
#=GS K0TCE0_THAOC/19-463         AC K0TCE0.1
#=GS I3M0Z9_ICTTR/1-545          AC I3M0Z9.1
#=GS E0V9N5_PEDHC/17-467         AC E0V9N5.1
#=GS R0KTT4_ANAPL/235-430        AC R0KTT4.1
#=GS G1NYE3_MYOLU/1-572          AC G1NYE3.1
#=GS H2YCN2_CIOSA/1-468          AC H2YCN2.1
#=GS H2U0U9_TAKRU/272-471        AC H2U0U9.1
#=GS J9IM23_9SPIT/1-328          AC J9IM23.1
#=GS Q16UA7_AEDAE/20-487         AC Q16UA7.1
#=GS A0A183ITX8_9BILA/1-548      AC A0A183ITX8.1
#=GS A0A0R3PJV0_ANGCS/152-266    AC A0A0R3PJV0.1
#=GS A0A061ES69_THECC/7-283      AC A0A061ES69.1
#=GS A0A093T627_PHACA/1-410      AC A0A093T627.1
#=GS A0A0R4IR97_DANRE/256-450    AC A0A0R4IR97.1
#=GS J9HY79_9SPIT/1-335          AC J9HY79.1
#=GS W5H0A5_WHEAT/2-368          AC W5H0A5.1
#=GS C3Z9N3_BRAFL/292-485        AC C3Z9N3.1
#=GS A0A077ZU38_STYLE/4-337      AC A0A077ZU38.1
#=GS A0A0R3S0S6_9BILA/1-533      AC A0A0R3S0S6.1
#=GS H7C1Y4_HUMAN/1-45           AC H7C1Y4.1
#=GS A0A0M9A1I3_9HYME/304-484    AC A0A0M9A1I3.1
#=GS A0A077ZP06_TRITR/223-463    AC A0A077ZP06.1
#=GS A0A0N0RT22_9HYPO/12-533     AC A0A0N0RT22.1
#=GS A0A0K0CZV9_ANGCA/150-361    AC A0A0K0CZV9.1
#=GS A0A091UCC9_PHORB/1-248      AC A0A091UCC9.1
#=GS A0A0K0CZV9_ANGCA/358-452    AC A0A0K0CZV9.1
#=GS H0YR04_TAEGU/257-439        AC H0YR04.1
#=GS A0A0V1AAZ9_9BILA/17-294     AC A0A0V1AAZ9.1
#=GS A0A0V1LNM6_9BILA/17-123     AC A0A0V1LNM6.1
#=GS N1QLJ2_SPHMS/19-516         AC N1QLJ2.1
#=GS K7J9S1_NASVI/482-883        AC K7J9S1.1
#=GS A0A183DP83_9BILA/151-451    AC A0A183DP83.1
#=GS G8YPA2_PICSO/1-500          AC G8YPA2.1
#=GS A0A151WQ01_9HYME/17-490     AC A0A151WQ01.1
#=GS V7ANU4_PHAVU/279-488        AC V7ANU4.1
#=GS F8W054_HUMAN/21-112         AC F8W054.1
#=GS Q4CQJ4_TRYCC/273-430        AC Q4CQJ4.1
#=GS A0A0G2K4B6_RAT/2-182        AC A0A0G2K4B6.1
#=GS H2RV14_TAKRU/1-126          AC H2RV14.1
#=GS A0A087X605_POEFO/1-563      AC A0A087X605.1
#=GS A0A0D2BDN3_9EURO/27-468     AC A0A0D2BDN3.1
#=GS A0A0L0SKK9_ALLMA/21-523     AC A0A0L0SKK9.1
#=GS G2RES6_THITE/12-446         AC G2RES6.1
#=GS W7LQM3_GIBM7/9-296          AC W7LQM3.1
#=GS Q0U8Y0_PHANO/7-519          AC Q0U8Y0.2
#=GS A0A0N1HHB2_9EURO/11-302     AC A0A0N1HHB2.1
#=GS K1WGC1_MARBU/10-520         AC K1WGC1.1
#=GS E1Z6S9_CHLVA/4-293          AC E1Z6S9.1
#=GS G3VS13_SARHA/1-546          AC G3VS13.1
#=GS G1SF20_RABIT/256-450        AC G1SF20.1
#=GS A0A0L0HFA1_SPIPN/1-502      AC A0A0L0HFA1.1
#=GS H0WS37_OTOGA/21-258         AC H0WS37.1
#=GS U1NQR3_ASCSU/16-128         AC U1NQR3.1
#=GS H2ASV5_KAZAF/1-485          AC H2ASV5.1
#=GS LMBD3_SELML/233-382         AC D8TFA8.2
#=GS K7UL18_MAIZE/1-497          AC K7UL18.1
#=GS S7Z799_PENO1/8-289          AC S7Z799.1
#=GS A0A067ERY6_CITSI/1-83       AC A0A067ERY6.1
#=GS I0Z9H7_COCSC/123-436        AC I0Z9H7.1
#=GS J9HWH3_9SPIT/1-417          AC J9HWH3.1
#=GS A0A0V1AAZ9_9BILA/278-474    AC A0A0V1AAZ9.1
#=GS I1KSY6_SOYBN/26-525         AC I1KSY6.2
#=GS W9Z916_9EURO/27-307         AC W9Z916.1
#=GS A0A0A0ANW3_CHAVO/237-430    AC A0A0A0ANW3.1
#=GS F4P8T4_BATDJ/5-335          AC F4P8T4.1
#=GS A0A0N4WRL1_HAEPC/8-185      AC A0A0N4WRL1.2
#=GS LMBD2_CAEEL/1-531           AC Q18695.1
#=GS S9VAI4_9TRYP/5-279          AC S9VAI4.1
#=GS A0A093C3S7_9AVES/235-430    AC A0A093C3S7.1
#=GS J3QM78_MOUSE/107-255        AC J3QM78.1
#=GS U6H622_9EIME/55-345         AC U6H622.1
#=GS A0A091J168_9AVES/232-428    AC A0A091J168.1
#=GS B9SQ26_RICCO/7-282          AC B9SQ26.1
#=GS M0SFK9_MUSAM/310-540        AC M0SFK9.1
#=GS A0A078CG22_BRANA/274-489    AC A0A078CG22.1
#=GS H2TMI7_TAKRU/18-259         AC H2TMI7.1
#=GS A0A0G4MKH8_9PEZI/12-494     AC A0A0G4MKH8.1
#=GS R4XDM8_TAPDE/1-492          AC R4XDM8.1
#=GS U6PKA3_HAECO/70-584         AC U6PKA3.1
#=GS A0A0L1HKF7_9PLEO/9-286      AC A0A0L1HKF7.1
#=GS A0A0B2S729_GLYSO/7-293      AC A0A0B2S729.1
#=GS A0A0D9YYG2_9ORYZ/1-498      AC A0A0D9YYG2.1
#=GS A0A194XVS9_9HELO/8-296      AC A0A194XVS9.1
#=GS A0A151P8D5_ALLMI/143-329    AC A0A151P8D5.1
#=GS A0A0N5E3P7_TRIMR/16-275     AC A0A0N5E3P7.1
#=GS E1BV17_CHICK/1-543          AC E1BV17.2
#=GS B9HCW4_POPTR/7-282          AC B9HCW4.1
#=GS A0A087SCC2_AUXPR/423-600    AC A0A087SCC2.1
#=GS A0A0G2J9H4_9EURO/8-444      AC A0A0G2J9H4.1
#=GS A0A0F7TD31_9EURO/12-545     AC A0A0F7TD31.1
#=GS L9JSL5_TUPCH/1-330          AC L9JSL5.1
#=GS A4S681_OSTLU/11-327         AC A4S681.1
#=GS B3RQ62_TRIAD/240-427        AC B3RQ62.1
#=GS LMBRL_MOUSE/268-455         AC Q9D1E5.1
#=GS G3NRH6_GASAC/13-424         AC G3NRH6.1
#=GS W4H1U7_9STRA/1-289          AC W4H1U7.1
#=GS A0A091NEB0_9PASS/1-543      AC A0A091NEB0.1
#=GS A0A023B3V7_GRENI/1-254      AC A0A023B3V7.1
#=GS R7YJT6_CONA1/8-291          AC R7YJT6.1
#=GS H2M442_ORYLA/253-449        AC H2M442.1
#=GS A0A183HC75_9BILA/203-377    AC A0A183HC75.1
#=GS F7HSP4_MACMU/1-263          AC F7HSP4.1
#=GS Q6BPU1_DEBHA/1-502          AC Q6BPU1.2
#=GS A0A0P7BGK3_9HYPO/11-455     AC A0A0P7BGK3.1
#=GS H0WL75_OTOGA/16-429         AC H0WL75.1
#=GS A0A0J6YRB2_COCIT/8-292      AC A0A0J6YRB2.1
#=GS V4LCH4_EUTSA/354-579        AC V4LCH4.1
#=GS A0A091J8R9_9AVES/1-415      AC A0A091J8R9.1
#=GS A0A061E909_THECC/1-498      AC A0A061E909.1
#=GS LMBRL_DANRE/18-278          AC Q803C7.1
#=GS G1QH87_NOMLE/1-259          AC G1QH87.1
#=GS A0A194XLB6_9HELO/12-521     AC A0A194XLB6.1
#=GS A0A166PL68_9PEZI/11-300     AC A0A166PL68.1
#=GS A0A0J7K2J4_LASNI/1-211      AC A0A0J7K2J4.1
#=GS C4JZG1_UNCRE/15-115         AC C4JZG1.1
#=GS A0A017SHX6_9EURO/8-288      AC A0A017SHX6.1
#=GS I3K2D5_ORENI/252-452        AC I3K2D5.1
#=GS H2TMI6_TAKRU/262-451        AC H2TMI6.1
#=GS H9H780_MONDO/21-260         AC H9H780.1
#=GS A0A0M3HMQ0_ASCLU/20-284     AC A0A0M3HMQ0.1
#=GS A1CR57_ASPCL/12-517         AC A1CR57.1
#=GS V4A048_LOTGI/10-294         AC V4A048.1
#=GS S3DCK7_GLAL2/9-518          AC S3DCK7.1
#=GS A0A0A0L1B7_CUCSA/7-283      AC A0A0A0L1B7.1
#=GS S2J6P5_MUCC1/27-530         AC S2J6P5.1
#=GS LMBD1_NEUCR/13-303          AC Q7SDN3.2
#=GS C5L571_PERM5/3-132          AC C5L571.1
#=GS F7HSP6_MACMU/105-284        AC F7HSP6.1
#=GS A0A091SGU5_9AVES/1-417      AC A0A091SGU5.1
#=GS A0A094A7T1_9PEZI/7-289      AC A0A094A7T1.1
#=GS A0A087SVS3_9ARAC/1-43       AC A0A087SVS3.1
#=GS A0A0V0SAW7_9BILA/253-449    AC A0A0V0SAW7.1
#=GS S9W1F2_9TRYP/142-339        AC S9W1F2.1
#=GS G5C9G5_HETGA/1-549          AC G5C9G5.1
#=GS A2RAX9_ASPNC/10-515         AC A2RAX9.1
#=GS J9IT80_9SPIT/1-454          AC J9IT80.1
#=GS A0A135TJX8_9PEZI/12-517     AC A0A135TJX8.1
#=GS A0A022R3P5_ERYGU/1-493      AC A0A022R3P5.1
#=GS W2YY79_PHYPR/6-293          AC W2YY79.1
#=GS W7HME3_9PEZI/8-203          AC W7HME3.1
#=GS D6X0Q3_TRICA/1-538          AC D6X0Q3.1
#=GS X6P0L6_RETFI/4-216          AC X6P0L6.1
#=GS K0R7D7_THAOC/1-583          AC K0R7D7.1
#=GS C9SV87_VERA1/12-124         AC C9SV87.1
#=GS A0A0N0VEY7_9TRYP/265-458    AC A0A0N0VEY7.1
#=GS W6LC00_9TRYP/5-262          AC W6LC00.1
#=GS A0A0E0K5F7_ORYPU/139-610    AC A0A0E0K5F7.1
#=GS I0Z8K5_COCSC/265-491        AC I0Z8K5.1
#=GS A8HPZ9_CHLRE/290-525        AC A8HPZ9.1
#=GS A0A067FB84_CITSI/1-392      AC A0A067FB84.1
#=GS C4M0X4_ENTHI/3-271          AC C4M0X4.1
#=GS A0A094KKJ3_ANTCR/1-127      AC A0A094KKJ3.1
#=GS A0A0D1YJR7_9PEZI/6-516      AC A0A0D1YJR7.1
#=GS A0A0R3TUX7_HYMNN/1-96       AC A0A0R3TUX7.1
#=GS A0A0A0ANW3_CHAVO/1-254      AC A0A0A0ANW3.1
#=GS A0A0N0P7F3_LEPSE/3-492      AC A0A0N0P7F3.1
#=GS A0A093PTM3_9PASS/238-430    AC A0A093PTM3.1
#=GS N4V7J5_COLOR/12-518         AC N4V7J5.1
#=GS G1KHI7_ANOCA/14-291         AC G1KHI7.2
#=GS W5MLV2_LEPOC/22-272         AC W5MLV2.1
#=GS A0A194YGT2_SORBI/7-490      AC A0A194YGT2.1
#=GS A0A078F6T9_BRANA/1-518      AC A0A078F6T9.1
#=GS A0A0N4U1H1_DRAME/25-259     AC A0A0N4U1H1.1
#=GS A0A0A1N0K7_9FUNG/8-194      AC A0A0A1N0K7.1
#=GS A0A094KKJ3_ANTCR/109-311    AC A0A094KKJ3.1
#=GS H2RZ81_TAKRU/1-552          AC H2RZ81.1
#=GS I3K2D5_ORENI/18-257         AC I3K2D5.1
#=GS A0A0F9WZ12_TRIHA/9-290      AC A0A0F9WZ12.1
#=GS X0K5R1_FUSOX/12-523         AC X0K5R1.1
#=GS A0A167R769_PHYB8/8-431      AC A0A167R769.1
#=GS Q57XX2_TRYB2/297-431        AC Q57XX2.1
#=GS A0A016X0Z7_9BILA/1-92       AC A0A016X0Z7.1
#=GS A0A059D5V1_EUCGR/7-489      AC A0A059D5V1.1
#=GS A0A074X3F4_9PEZI/9-287      AC A0A074X3F4.1
#=GS A0A0A0A3U6_CHAVO/1-543      AC A0A0A0A3U6.1
#=GS M4AFY0_XIPMA/10-297         AC M4AFY0.1
#=GS Q22WA5_TETTS/1-503          AC Q22WA5.2
#=GS X0D412_FUSOX/12-523         AC X0D412.1
#=GS A0A087V5A7_BALRE/1-251      AC A0A087V5A7.1
#=GS A0A093GCW6_PICPB/243-371    AC A0A093GCW6.1
#=GS A0A0B2SHM7_GLYSO/1-498      AC A0A0B2SHM7.1
#=GS F4WJT5_ACREC/1-535          AC F4WJT5.1
#=GS A0A139HQD7_9PEZI/8-511      AC A0A139HQD7.1
#=GS A0A151RQJ3_CAJCA/276-488    AC A0A151RQJ3.1
#=GS D3B509_POLPA/22-448         AC D3B509.1
#=GS A0A0N8JVF7_9TELE/271-458    AC A0A0N8JVF7.1
#=GS A0A0V1NK79_9BILA/1-534      AC A0A0V1NK79.1
#=GS A0A093TG25_PHACA/1-543      AC A0A093TG25.1
#=GS D3ZUP8_RAT/1-549            AC D3ZUP8.1
#=GS A0A0J6YGU8_COCIT/15-520     AC A0A0J6YGU8.1
#=GS M0XVI4_HORVD/1-499          AC M0XVI4.1
#=GS A0A0D8Y4R4_DICVI/1-188      AC A0A0D8Y4R4.1
#=GS A0A0D2AM56_9PEZI/9-291      AC A0A0D2AM56.1
#=GS A0A091QT28_9GRUI/1-106      AC A0A091QT28.1
#=GS A0A074SZ96_HAMHA/4-285      AC A0A074SZ96.1
#=GS A0A010RIZ0_9PEZI/10-293     AC A0A010RIZ0.1
#=GS M0TXG3_MUSAM/257-490        AC M0TXG3.1
#=GS A0A0D3FAQ7_9ORYZ/1-498      AC A0A0D3FAQ7.1
#=GS A0A167HPM2_9HYPO/12-521     AC A0A167HPM2.1
#=GS Q22CC8_TETTS/4-272          AC Q22CC8.2
#=GS A0A0G4J4M5_PLABS/3-467      AC A0A0G4J4M5.1
#=GS F4PI14_DICFS/4-511          AC F4PI14.1
#=GS A0A0V0QH19_PSEPJ/184-403    AC A0A0V0QH19.1
#=GS A0A016WPM1_9BILA/1-240      AC A0A016WPM1.1
#=GS K2MYD4_TRYCR/296-457        AC K2MYD4.1
#=GS LMBRL_DANRE/259-451         AC Q803C7.1
#=GS A0A077ZC10_TRITR/1-532      AC A0A077ZC10.1
#=GS A0A0D8Y797_DICVI/1-502      AC A0A0D8Y797.1
#=GS A9RIF8_PHYPA/1-496          AC A9RIF8.1
#=GS B6K3S4_SCHJY/2-447          AC B6K3S4.2
#=GS U6N0W7_9EIME/38-362         AC U6N0W7.1
#=GS A0A075B2X4_9FUNG/1-468      AC A0A075B2X4.1
#=GS E9F792_METRA/10-286         AC E9F792.1
#=GS A0A0V0UQW5_9BILA/9-559      AC A0A0V0UQW5.1
#=GS H3FSB7_PRIPA/1-225          AC H3FSB7.1
#=GS K1P9W7_CRAGI/11-299         AC K1P9W7.1
#=GS F4P8T4_BATDJ/307-542        AC F4P8T4.1
#=GS C4JIE2_UNCRE/8-299          AC C4JIE2.1
#=GS C5G8K1_AJEDR/14-520         AC C5G8K1.2
#=GS A0A183HC75_9BILA/1-200      AC A0A183HC75.1
#=GS A0A087UE13_9ARAC/1-34       AC A0A087UE13.1
#=GS S9UHX5_9TRYP/63-309         AC S9UHX5.1
#=GS A0A183D9X4_9BILA/1-92       AC A0A183D9X4.1
#=GS A0A0E0L791_ORYPU/150-420    AC A0A0E0L791.1
#=GS F0V8P3_NEOCL/279-512        AC F0V8P3.1
#=GS A0A0B0P4C6_GOSAR/244-490    AC A0A0B0P4C6.1
#=GS A0A016WPU0_9BILA/1-242      AC A0A016WPU0.1
#=GS LMBD1_MAGO7/9-443           AC A4RE85.1
#=GS C0NNS1_AJECG/8-293          AC C0NNS1.1
#=GS A0A0L9VTD1_PHAAN/277-488    AC A0A0L9VTD1.1
#=GS G3VSI5_SARHA/268-457        AC G3VSI5.1
#=GS D8TFX8_SELML/1-251          AC D8TFX8.1
#=GS A0A0N0VGA1_9TRYP/3-492      AC A0A0N0VGA1.1
#=GS LMBR1_XENTR/18-269          AC Q5U4X7.1
#=GS A0A0F8CY97_CERFI/4-439      AC A0A0F8CY97.1
#=GS LMBD1_PODAN/12-295          AC B2AA26.1
#=GS A0A0S4JTI8_BODSA/301-500    AC A0A0S4JTI8.1
#=GS A0A135V1Q8_9PEZI/10-291     AC A0A135V1Q8.1
#=GS A0A0N4WRL1_HAEPC/176-336    AC A0A0N4WRL1.2
#=GS S3CDR0_GLAL2/8-306          AC S3CDR0.1
#=GS A0A063C923_9HYPO/11-310     AC A0A063C923.1
#=GS A0A0M9F437_9HYPO/52-561     AC A0A0M9F437.1
#=GS A0A063BM13_9HYPO/12-522     AC A0A063BM13.1
#=GS A0A0C7MZR8_9SACH/2-491      AC A0A0C7MZR8.1
#=GS A0A091P301_LEPDC/2-192      AC A0A091P301.1
#=GS A0A0V1AB61_9BILA/17-221     AC A0A0V1AB61.1
#=GS I0Z9H7_COCSC/1-113          AC I0Z9H7.1
#=GS G3VS14_SARHA/1-523          AC G3VS14.1
#=GS K7HF72_CAEJA/1-321          AC K7HF72.1
#=GS W5PAW8_SHEEP/1-262          AC W5PAW8.1
#=GS F6SQH3_CALJA/1-443          AC F6SQH3.1
#=GS A0A0V0SFV2_9BILA/1-534      AC A0A0V0SFV2.1
#=GS A0A136J2E6_9PEZI/12-291     AC A0A136J2E6.1
#=GS I1RSW7_GIBZE/18-527         AC I1RSW7.1
#=GS K2NSK7_TRYCR/3-489          AC K2NSK7.1
#=GS R0H6J8_9BRAS/7-282          AC R0H6J8.1
#=GS A0A0L0MZX6_9HYPO/10-293     AC A0A0L0MZX6.1
#=GS M3YT49_MUSPF/267-455        AC M3YT49.1
#=GS F0UMR6_AJEC8/8-292          AC F0UMR6.1
#=GS A2G7G8_TRIVA/2-285          AC A2G7G8.1
#=GS K3VUN5_FUSPC/12-521         AC K3VUN5.1
#=GS A0A0P7VF00_9TELE/286-470    AC A0A0P7VF00.1
#=GS L5K9Q0_PTEAL/535-772        AC L5K9Q0.1
#=GS A0A091F2H4_CORBR/1-252      AC A0A091F2H4.1
#=GS F6V418_CANLF/291-480        AC F6V418.1
#=GS G0MVB5_CAEBE/1-531          AC G0MVB5.1
#=GS V5G3B1_BYSSN/10-516         AC V5G3B1.1
#=GS N6T715_DENPD/38-203         AC N6T715.1
#=GS A0A0P7Y997_9TELE/1-241      AC A0A0P7Y997.1
#=GS H3EX74_PRIPA/1-218          AC H3EX74.1
#=GS A0A0M3HMQ0_ASCLU/293-471    AC A0A0M3HMQ0.1
#=GS S2JDT1_MUCC1/7-418          AC S2JDT1.1
#=GS Q4Q9X7_LEIMA/4-277          AC Q4Q9X7.1
#=GS A0A0R3SWM1_HYMDI/326-480    AC A0A0R3SWM1.1
#=GS F7BEN1_XENTR/11-431         AC F7BEN1.1
#=GS Q22CC8_TETTS/258-483        AC Q22CC8.2
#=GS T1HA65_RHOPR/293-430        AC T1HA65.1
#=GS Q5CYA0_CRYPI/1-571          AC Q5CYA0.1
#=GS A0A093GKK2_PICPB/1-543      AC A0A093GKK2.1
#=GS A0A093IDC9_FULGA/1-485      AC A0A093IDC9.1
#=GS A0A0L8I8R2_OCTBM/228-527    AC A0A0L8I8R2.1
#=GS A0A094KE23_ANTCR/1-182      AC A0A094KE23.1
#=GS M4A9N0_XIPMA/18-253         AC M4A9N0.1
#=GS A0A091TME5_PHALP/1-321      AC A0A091TME5.1
#=GS A0A087YCR1_POEFO/261-452    AC A0A087YCR1.2
#=GS A0A0V0VXZ7_9BILA/17-309     AC A0A0V0VXZ7.1
#=GS M4CAV7_BRARP/7-282          AC M4CAV7.1
#=GS R0GP85_9BRAS/13-420         AC R0GP85.1
#=GS A0A094LEQ8_9AVES/1-302      AC A0A094LEQ8.1
#=GS A0A096NXX0_PAPAN/19-283     AC A0A096NXX0.1
#=GS V4Z3T5_TOXGV/4-286          AC V4Z3T5.1
#=GS A0A0E0A4E9_9ORYZ/264-490    AC A0A0E0A4E9.1
#=GS E1ZGP1_CHLVA/2-498          AC E1ZGP1.1
#=GS R1C231_EMIHU/390-756        AC R1C231.1
#=GS R0G8U5_9BRAS/1-500          AC R0G8U5.1
#=GS A0A0B2PEI2_GLYSO/110-221    AC A0A0B2PEI2.1
#=GS L5K3Z4_PTEAL/1-410          AC L5K3Z4.1
#=GS J9EHG3_9SPIT/1-393          AC J9EHG3.1
#=GS V6U8T1_GIAIN/7-473          AC V6U8T1.1
#=GS I1E565_AMPQE/2-125          AC I1E565.1
#=GS A0A150VJ23_9PEZI/9-285      AC A0A150VJ23.1
#=GS V5HT36_BYSSN/9-448          AC V5HT36.1
#=GS F2CR18_HORVD/7-285          AC F2CR18.1
#=GS W9YJK0_9EURO/6-512          AC W9YJK0.1
#=GS A0A061IYH2_TRYRA/3-287      AC A0A061IYH2.1
#=GS A0A096MP01_PAPAN/1-549      AC A0A096MP01.1
#=GS A2EHB0_TRIVA/3-484          AC A2EHB0.1
#=GS I3KCK7_ORENI/1-550          AC I3KCK7.1
#=GS A0A0B7N6Y6_9FUNG/8-299      AC A0A0B7N6Y6.1
#=GS A0A0B2X0Y8_9HYPO/12-521     AC A0A0B2X0Y8.1
#=GS A0A0T6AWJ7_9SCAR/1-281      AC A0A0T6AWJ7.1
#=GS LMBD1_ARATH/7-281           AC Q9SR93.2
#=GS A0A0F4Z5U8_TALEM/40-573     AC A0A0F4Z5U8.1
#=GS A0A093FP10_GAVST/1-460      AC A0A093FP10.1
#=GS M7B2F5_CHEMY/384-451        AC M7B2F5.1
#=GS A0A183CML1_GLOPA/291-666    AC A0A183CML1.1
#=GS A0A139AZL4_GONPR/5-527      AC A0A139AZL4.1
#=GS LMBD1_ORYSJ/7-296           AC Q658I5.1
#=GS A0A0V0UEA2_9BILA/262-491    AC A0A0V0UEA2.1
#=GS R4GKI0_CHICK/21-274         AC R4GKI0.1
#=GS A0A0V1N2Y1_9BILA/9-538      AC A0A0V1N2Y1.1
#=GS LMBR1_CHICK/250-449         AC Q7ZUA6.1
#=GS H0ZYW4_TAEGU/1-171          AC H0ZYW4.1
#=GS M7U7V2_BOTF1/11-520         AC M7U7V2.1
#=GS R0GKZ9_9BRAS/1-500          AC R0GKZ9.1
#=GS X6NGI6_RETFI/270-549        AC X6NGI6.1
#=GS LMBD1_DICDI/7-285           AC Q54KD1.1
#=GS A0A151GSK6_9HYPO/12-521     AC A0A151GSK6.1
#=GS A0A151T908_CAJCA/277-489    AC A0A151T908.1
#=GS LMD2A_DICDI/1-541           AC Q54Q92.1
#=GS A0A0D2IFD9_9EURO/6-511      AC A0A0D2IFD9.1
#=GS F7EIN7_MACMU/267-455        AC F7EIN7.1
#=GS G3UPB7_MELGA/1-203          AC G3UPB7.1
#=GS Q22RN8_TETTS/64-551         AC Q22RN8.2
#=GS A4HE60_LEIBR/297-457        AC A4HE60.1
#=GS J3MAX0_ORYBR/264-490        AC J3MAX0.1
#=GS H3GLP4_PHYRM/264-492        AC H3GLP4.1
#=GS A0A094FRG7_9PEZI/8-290      AC A0A094FRG7.1
#=GS A0A139IEW0_9PEZI/9-290      AC A0A139IEW0.1
#=GS G2X7L1_VERDV/12-520         AC G2X7L1.1
#=GS A0A0G2JVJ7_RAT/21-258       AC A0A0G2JVJ7.1
#=GS A0A0S4JTI8_BODSA/40-331     AC A0A0S4JTI8.1
#=GS A0A067EN93_CITSI/1-214      AC A0A067EN93.1
#=GS F1N242_BOVIN/1-549          AC F1N242.2
#=GS L8GZR6_ACACA/37-241         AC L8GZR6.1
#=GS A0A0V0QSH1_PSEPJ/1-573      AC A0A0V0QSH1.1
#=GS A0A0L1IKP6_ASPNO/10-515     AC A0A0L1IKP6.1
#=GS G3WZL9_SARHA/7-270          AC G3WZL9.1
#=GS A0A0V0UDM6_9BILA/278-474    AC A0A0V0UDM6.1
#=GS Q8NDP7_HUMAN/105-284        AC Q8NDP7.1
#=GS E3Q4D9_COLGM/11-300         AC E3Q4D9.1
#=GS A0A0R3TYF5_HYMNN/1-211      AC A0A0R3TYF5.1
#=GS F0U8X0_AJEC8/185-691        AC F0U8X0.1
#=GS A0A091TCS2_9AVES/1-132      AC A0A091TCS2.1
#=GS A0A194YI35_SORBI/1-499      AC A0A194YI35.1
#=GS A0A099ZXA2_TINGU/236-430    AC A0A099ZXA2.1
#=GS F7EIN7_MACMU/21-259         AC F7EIN7.1
#=GS V4SUI2_9ROSI/268-490        AC V4SUI2.1
#=GS A0A091N2M6_9PASS/246-434    AC A0A091N2M6.1
#=GS A0A0V1H4V7_9BILA/9-537      AC A0A0V1H4V7.1
#=GS E3QCK2_COLGM/12-519         AC E3QCK2.1
#=GS D3B509_POLPA/446-522        AC D3B509.1
#=GS H2TMI7_TAKRU/265-450        AC H2TMI7.1
#=GS G0S5B5_CHATD/9-515          AC G0S5B5.1
#=GS A0A0E0A4F0_9ORYZ/7-228      AC A0A0E0A4F0.1
#=GS A0A176WAR0_MARPO/7-286      AC A0A176WAR0.1
#=GS C5DVN0_ZYGRC/1-483          AC C5DVN0.1
#=GS F7HAZ6_MACMU/21-259         AC F7HAZ6.1
#=GS M0YVF4_HORVD/7-287          AC M0YVF4.1
#=GS L8Y929_TUPCH/400-599        AC L8Y929.1
#=GS H2Z9D4_CIOSA/33-290         AC H2Z9D4.1
#=GS V8P5A7_OPHHA/61-377         AC V8P5A7.1
#=GS A0A096P831_OSTTA/1-513      AC A0A096P831.1
#=GS A0A0G2DQ71_9PEZI/22-533     AC A0A0G2DQ71.1
#=GS Q4DTX8_TRYCC/5-245          AC Q4DTX8.1
#=GS A0A0R4IWA8_DANRE/1-550      AC A0A0R4IWA8.1
#=GS A0A059ALN0_EUCGR/1-495      AC A0A059ALN0.1
#=GS A0A0F0I3K3_ASPPU/10-515     AC A0A0F0I3K3.1
#=GS M5WAH9_PRUPE/260-488        AC M5WAH9.1
#=GS N1RHX6_FUSC4/12-523         AC N1RHX6.1
#=GS F4X5V0_ACREC/17-275         AC F4X5V0.1
#=GS F6ST68_CALJA/14-283         AC F6ST68.1
#=GS E4XQV6_OIKDI/1-526          AC E4XQV6.1
#=GS D3BQG9_POLPA/913-1117       AC D3BQG9.1
#=GS A0A0E0A4F0_9ORYZ/223-457    AC A0A0E0A4F0.1
#=GS A0A0P5ECB0_9CRUS/1-549      AC A0A0P5ECB0.1
#=GS S9TV07_9TRYP/268-464        AC S9TV07.1
#=GS A0A0G4IH94_PLABS/15-469     AC A0A0G4IH94.1
#=GS A0A162A512_DAUCA/7-286      AC A0A162A512.1
#=GS A0A091KT54_COLST/1-245      AC A0A091KT54.1
#=GS G4N3S8_MAGO7/20-536         AC G4N3S8.1
#=GS LMBD2_CHICK/1-543           AC Q5F3F5.1
#=GS A0A0E9NN26_9ASCO/267-552    AC A0A0E9NN26.1
#=GS A0A0E0A6W0_9ORYZ/1-498      AC A0A0E0A6W0.1
#=GS F6VVU8_MACMU/1-549          AC F6VVU8.1
#=GS S9WZN8_CAMFR/1-213          AC S9WZN8.1
#=GS R1DNV9_EMIHU/1-318          AC R1DNV9.1
#=GS A0A0L8GNJ0_OCTBM/12-271     AC A0A0L8GNJ0.1
#=GS A0A087VA70_BALRE/1-543      AC A0A087VA70.1
#=GS Q57XX2_TRYB2/5-296          AC Q57XX2.1
#=GS A0A0G4J3K4_PLABS/4-273      AC A0A0G4J3K4.1
#=GS A0A0R3PJV0_ANGCS/1-159      AC A0A0R3PJV0.1
#=GS G0R5W2_ICHMG/14-473         AC G0R5W2.1
#=GS H0YHZ2_HUMAN/1-151          AC H0YHZ2.1
#=GS A0A022QFE1_ERYGU/7-282      AC A0A022QFE1.1
#=GS M3VU39_FELCA/266-455        AC M3VU39.1
#=GS B4LW16_DROVI/1-553          AC B4LW16.1
#=GS G5A2L2_PHYSP/260-492        AC G5A2L2.1
#=GS A0A0D2S5E0_GOSRA/34-140     AC A0A0D2S5E0.1
#=GS A0A091KG61_9GRUI/235-430    AC A0A091KG61.1
#=GS A0A093C3S7_9AVES/1-258      AC A0A093C3S7.1
#=GS A0A0L1KZN7_9EUGL/1-297      AC A0A0L1KZN7.1
#=GS H2LTX9_ORYLA/18-274         AC H2LTX9.1
#=GS C7YNK4_NECH7/12-521         AC C7YNK4.1
#=GS A0A176WAR0_MARPO/250-496    AC A0A176WAR0.1
#=GS F7C6Z2_XENTR/19-270         AC F7C6Z2.1
#=GS G8JPW9_ERECY/1-502          AC G8JPW9.1
#=GS D4AQ78_ARTBC/8-306          AC D4AQ78.1
#=GS E2R581_CANLF/1-549          AC E2R581.2
#=GS A4HI06_LEIBR/4-492          AC A4HI06.1
#=GS G3T4T8_LOXAF/267-455        AC G3T4T8.1
#=GS G7P2J7_MACFA/1-471          AC G7P2J7.1
#=GS S9V5B0_9TRYP/5-484          AC S9V5B0.1
#=GS N4UPY0_COLOR/10-300         AC N4UPY0.1
#=GS Q2HA47_CHAGB/12-521         AC Q2HA47.1
#=GS B4JIK8_DROGR/23-505         AC B4JIK8.1
#=GS K1QP66_CRAGI/12-127         AC K1QP66.1
#=GS LMBD1_RAT/11-290            AC Q6AZ61.1
#=GS A0E1B4_PARTE/4-272          AC A0E1B4.1
#=GS A0DXE9_PARTE/1-519          AC A0DXE9.1
#=GS K7F3C0_PELSI/11-290         AC K7F3C0.1
#=GS A0A167AN60_9PEZI/11-302     AC A0A167AN60.1
#=GS YNC2_CAEEL/67-698           AC P34535.1
#=GS M7TXA2_BOTF1/8-288          AC M7TXA2.1
#=GS A0A0U1M9G4_9EURO/8-292      AC A0A0U1M9G4.1
#=GS A0A0D2DNQ3_9EURO/6-508      AC A0A0D2DNQ3.1
#=GS A0A087XM79_POEFO/261-457    AC A0A087XM79.2
#=GS LMBD2_CAEBR/1-531           AC Q61ZW5.1
#=GS A0A091QA61_LEPDC/1-543      AC A0A091QA61.1
#=GS A0A151PD97_ALLMI/12-433     AC A0A151PD97.1
#=GS A0A067BC72_SAPPC/4-320      AC A0A067BC72.1
#=GS A0A091NVF8_HALAL/1-251      AC A0A091NVF8.1
#=GS A0A059LCM3_9CHLO/1-118      AC A0A059LCM3.1
#=GS G1NWN0_MYOLU/16-296         AC G1NWN0.1
#=GS A0A0N4U1H1_DRAME/273-447    AC A0A0N4U1H1.1
#=GS W9CUD9_9HELO/8-452          AC W9CUD9.1
#=GS V4AC99_LOTGI/20-267         AC V4AC99.1
#=GS A9T3A3_PHYPA/7-283          AC A9T3A3.1
#=GS M3YEA5_MUSPF/1-158          AC M3YEA5.1
#=GS A0A0E0PSX7_ORYRU/152-420    AC A0A0E0PSX7.1
#=GS A0A0V0R074_PSEPJ/297-394    AC A0A0V0R074.1
#=GS I3MC97_ICTTR/21-257         AC I3MC97.1
#=GS LMBD1_AJECN/8-293           AC A6QTW5.1
#=GS LMBD1_PHANO/9-286           AC Q0UUE1.1
#=GS B4LWE0_DROVI/21-501         AC B4LWE0.2
#=GS F7G846_MACMU/14-291         AC F7G846.1
#=GS K4B2C1_SOLLC/1-498          AC K4B2C1.1
#=GS D7FY43_ECTSI/14-551         AC D7FY43.1
#=GS A0A0N5D119_THECL/229-758    AC A0A0N5D119.1
#=GS A0A088ALU8_APIME/1-536      AC A0A088ALU8.1
#=GS H3GLU2_PHYRM/1-543          AC H3GLU2.1
#=GS T1J750_STRMM/10-557         AC T1J750.1
#=GS A0A0L0HJ03_SPIPN/20-328     AC A0A0L0HJ03.1
#=GS F6Z2E9_HORSE/1-262          AC F6Z2E9.1
#=GS D8RS75_SELML/1-498          AC D8RS75.1
#=GS F9WXY9_ZYMTI/20-530         AC F9WXY9.1
#=GS A0A0G4J512_PLABS/269-480    AC A0A0G4J512.1
#=GS A0A100ILT8_ASPNG/8-287      AC A0A100ILT8.1
#=GS A0A0A0KIU1_CUCSA/1-498      AC A0A0A0KIU1.1
#=GS A0A091UP90_NIPNI/1-251      AC A0A091UP90.1
#=GS B3S194_TRIAD/15-290         AC B3S194.1
#=GS W2PZ14_PHYPN/6-293          AC W2PZ14.1
#=GS A0A0D2IV39_9EURO/22-303     AC A0A0D2IV39.1
#=GS A0A096UAJ7_MAIZE/1-199      AC A0A096UAJ7.1
#=GS J3KBY4_COCIM/15-520         AC J3KBY4.2
#=GS S3BZJ3_OPHP1/10-301         AC S3BZJ3.1
#=GS A0A024WJM5_PLAFA/4-239      AC A0A024WJM5.1
#=GS F0XPR6_GROCL/16-518         AC F0XPR6.1
#=GS A0A016WZD7_9BILA/96-558     AC A0A016WZD7.1
#=GS D8RQN1_SELML/278-493        AC D8RQN1.1
#=GS W6LED7_9TRYP/3-492          AC W6LED7.1
#=GS J3PJE1_GAGT3/23-538         AC J3PJE1.1
#=GS Y3610_DICDI/4-301           AC Q54BI3.1
#=GS T0S7T6_9STRA/98-358         AC T0S7T6.1
#=GS G7P2Z4_MACFA/14-291         AC G7P2Z4.1
#=GS A0A0D3CLT1_BRAOL/7-282      AC A0A0D3CLT1.1
#=GS A0A0L0DN76_THETB/241-409    AC A0A0L0DN76.1
#=GS A0A0N4XJJ4_NIPBR/1-92       AC A0A0N4XJJ4.1
#=GS A0A077ZWI9_STYLE/2-119      AC A0A077ZWI9.1
#=GS A0A016WZU3_9BILA/96-652     AC A0A016WZU3.1
#=GS R7VWW5_COLLI/1-543          AC R7VWW5.1
#=GS A0A077ZPH8_STYLE/96-379     AC A0A077ZPH8.1
#=GS A0A067D8Q6_SAPPC/10-270     AC A0A067D8Q6.1
#=GS U6MVB0_9EIME/28-366         AC U6MVB0.1
#=GS C5DC09_LACTC/1-501          AC C5DC09.1
#=GS J9BKW3_WUCBA/19-262         AC J9BKW3.1
#=GS X1XPX7_ACYPI/1-34           AC X1XPX7.1
#=GS A0CGJ5_PARTE/1-478          AC A0CGJ5.1
#=GS I1MYP4_SOYBN/1-498          AC I1MYP4.1
#=GS A0A183BTL8_GLOPA/494-954    AC A0A183BTL8.1
#=GS A0A096MCD8_POEFO/274-486    AC A0A096MCD8.1
#=GS A0A091Q8G8_LEPDC/1-253      AC A0A091Q8G8.1
#=GS M0SVX3_MUSAM/1-498          AC M0SVX3.1
#=GS A0A022RPH2_ERYGU/262-488    AC A0A022RPH2.1
#=GS A0A091KG61_9GRUI/1-254      AC A0A091KG61.1
#=GS G2YRC7_BOTF4/11-453         AC G2YRC7.1
#=GS A0A091S6U8_NESNO/1-367      AC A0A091S6U8.1
#=GS D3BQK5_POLPA/5-321          AC D3BQK5.1
#=GS T1J7X6_STRMM/17-325         AC T1J7X6.1
#=GS A0A091VMQ6_NIPNI/1-543      AC A0A091VMQ6.1
#=GS A0A078JT65_BRANA/7-199      AC A0A078JT65.1
#=GS B1N4V5_ENTHI/1-185          AC B1N4V5.1
#=GS W4ZD29_STRPU/1-168          AC W4ZD29.1
#=GS H6C332_EXODN/6-514          AC H6C332.1
#=GS W6KT99_9TRYP/5-278          AC W6KT99.1
#=GS A0A0A1TC22_9HYPO/10-291     AC A0A0A1TC22.1
#=GS K0RI08_THAOC/5-68           AC K0RI08.1
#=GS A0A094L1G2_9AVES/4-200      AC A0A094L1G2.1
#=GS A0A072U057_MEDTR/7-290      AC A0A072U057.1
#=GS A0A044UVD0_ONCVO/274-443    AC A0A044UVD0.1
#=GS G3JQY4_CORMM/11-299         AC G3JQY4.1
#=GS T1GAC9_MEGSC/1-119          AC T1GAC9.1
#=GS A0A0H5C8U1_CYBJA/1-491      AC A0A0H5C8U1.1
#=GS A7RTZ5_NEMVE/1-542          AC A7RTZ5.1
#=GS W9SI78_9ROSA/1-497          AC W9SI78.1
#=GS W5GIV1_WHEAT/1-95           AC W5GIV1.1
#=GS A0A0N4TKE5_BRUPA/19-267     AC A0A0N4TKE5.1
#=GS G3S2Q4_GORGO/235-430        AC G3S2Q4.1
#=GS I1Q0P9_ORYGL/1-498          AC I1Q0P9.1
#=GS F7I499_CALJA/267-457        AC F7I499.1
#=GS B2VRI6_PYRTR/7-520          AC B2VRI6.1
#=GS A0A0J8RJ27_COCIT/15-519     AC A0A0J8RJ27.1
#=GS A0A0V1N722_9BILA/17-282     AC A0A0V1N722.1
#=GS A0A0V1I6V6_9BILA/17-282     AC A0A0V1I6V6.1
#=GS G2QED7_MYCTT/12-521         AC G2QED7.1
#=GS D7MTA3_ARALL/1-500          AC D7MTA3.1
#=GS A0A0L7LGM7_9NEOP/1-465      AC A0A0L7LGM7.1
#=GS A0A0F7V9N0_9EURO/8-440      AC A0A0F7V9N0.1
#=GS A0A094E7B9_9PEZI/7-280      AC A0A094E7B9.1
#=GS A4I1F8_LEIIN/4-288          AC A4I1F8.1
#=GS LMBD1_SELML/204-321         AC D8TFB0.1
#=GS W6KJK5_9TRYP/4-492          AC W6KJK5.1
#=GS LMBD3_SELML/1-238           AC D8TFA8.2
#=GS A0A0V0QTL2_PSEPJ/1-378      AC A0A0V0QTL2.1
#=GS A0A0W8BVT9_PHYNI/6-293      AC A0A0W8BVT9.1
#=GS H0V0J6_CAVPO/1-259          AC H0V0J6.1
#=GS A0A0G4FP53_VITBC/635-765    AC A0A0G4FP53.1
#=GS I3JTT0_ORENI/16-433         AC I3JTT0.1
#=GS A0A117NM53_9EURO/9-288      AC A0A117NM53.1
#=GS F4KHW8_ARATH/1-500          AC F4KHW8.1
#=GS A0A091UFK3_PHORB/1-543      AC A0A091UFK3.1
#=GS A0A165JE23_9PEZI/9-290      AC A0A165JE23.1
#=GS I1P4G5_ORYGL/1-498          AC I1P4G5.1
#=GS A0A0D2B5Y5_9EURO/21-299     AC A0A0D2B5Y5.1
#=GS A0A059IYG4_9EURO/8-443      AC A0A059IYG4.1
#=GS A0A016TBB9_9BILA/1-98       AC A0A016TBB9.1
#=GS A0A178BF18_9PLEO/9-291      AC A0A178BF18.1
#=GS W1PIK5_AMBTC/7-282          AC W1PIK5.1
#=GS W5PAW8_SHEEP/234-428        AC W5PAW8.1
#=GS LMBR1_MOUSE/261-450         AC Q9JIT0.1
#=GS A0A067F3N6_CITSI/1-390      AC A0A067F3N6.1
#=GS LMBD1_SELML/1-51            AC D8TFB0.1
#=GS U3JHA7_FICAL/1-543          AC U3JHA7.1
#=GS E2A7S2_CAMFO/1-535          AC E2A7S2.1
#=GS H9J596_BOMMO/1-539          AC H9J596.1
#=GS G5C8R7_HETGA/232-299        AC G5C8R7.1
#=GS A0A0D1Z2Q5_9EURO/18-525     AC A0A0D1Z2Q5.1
#=GS A0A086T142_ACRC1/11-294     AC A0A086T142.1
#=GS H2XUT2_CIOIN/304-433        AC H2XUT2.1
#=GS H9GMJ5_ANOCA/242-431        AC H9GMJ5.1
#=GS A5K824_PLAVS/1-435          AC A5K824.1
#=GS A0A0N5BUF0_STREA/1-534      AC A0A0N5BUF0.1
#=GS LMBD1_ASPFU/8-284           AC Q4WCL2.1
#=GS H2UV39_TAKRU/13-429         AC H2UV39.1
#=GS A0A094BLB5_9PEZI/9-517      AC A0A094BLB5.1
#=GS E7F4M0_DANRE/17-270         AC E7F4M0.1
#=GS I3JTS9_ORENI/14-431         AC I3JTS9.1
#=GS A0A067JWQ9_JATCU/7-282      AC A0A067JWQ9.1
#=GS A0A091W197_NIPNI/1-449      AC A0A091W197.1
#=GS A0A0B2WF85_9HYPO/11-292     AC A0A0B2WF85.1
#=GS A0A024WBX3_PLAFA/1-125      AC A0A024WBX3.1
#=GS A0A0E0PSX6_ORYRU/7-228      AC A0A0E0PSX6.1
#=GS A0A0V0R3F9_PSEPJ/466-896    AC A0A0V0R3F9.1
#=GS F2SFI0_TRIRC/6-520          AC F2SFI0.1
#=GS J9HVG5_9SPIT/39-550         AC J9HVG5.1
#=GS A0A0D9WLA7_9ORYZ/7-175      AC A0A0D9WLA7.1
#=GS A0A0B2SPY1_GLYSO/1-355      AC A0A0B2SPY1.1
#=GS D7TRM2_VITVI/1-495          AC D7TRM2.1
#=GS N1QEL4_SPHMS/9-287          AC N1QEL4.1
#=GS A0A0N1HRR8_LEPSE/248-458    AC A0A0N1HRR8.1
#=GS A0A085NEY7_9BILA/17-481     AC A0A085NEY7.1
#=GS A0A0U1LR19_9EURO/20-525     AC A0A0U1LR19.1
#=GS A0A0D2MSU8_9CHLO/339-473    AC A0A0D2MSU8.1
#=GS K3X740_PYTUL/1-538          AC K3X740.1
#=GS K7V7L5_MAIZE/7-490          AC K7V7L5.1
#=GS F4P0N2_BATDJ/1-492          AC F4P0N2.1
#=GS A0A0K0J7M7_BRUMA/1-540      AC A0A0K0J7M7.2
#=GS G1N7P1_MELGA/1-251          AC G1N7P1.2
#=GS E1Z6S9_CHLVA/268-503        AC E1Z6S9.1
#=GS W5QC73_SHEEP/285-473        AC W5QC73.1
#=GS A0A0L0NLT9_9HYPO/12-521     AC A0A0L0NLT9.1
#=GS A0A151WH03_9HYME/79-613     AC A0A151WH03.1
#=GS A0A0C9M583_9FUNG/5-342      AC A0A0C9M583.1
#=GS A0A183AW17_9TREM/24-497     AC A0A183AW17.1
#=GS A0A0F7ZZ77_9HYPO/11-296     AC A0A0F7ZZ77.1
#=GS G0RD09_HYPJQ/12-521         AC G0RD09.1
#=GS V4AC99_LOTGI/272-477        AC V4AC99.1
#=GS A0A010QUR7_9PEZI/12-517     AC A0A010QUR7.1
#=GS A0A0K9PIC2_ZOSMR/278-490    AC A0A0K9PIC2.1
#=GS A0A0L0RWX6_ALLMA/11-289     AC A0A0L0RWX6.1
#=GS A0A0J8F8U1_BETVU/7-280      AC A0A0J8F8U1.1
#=GS W4H1U7_9STRA/257-506        AC W4H1U7.1
#=GS M4CAV7_BRARP/274-489        AC M4CAV7.1
#=GS G5C8R7_HETGA/2-223          AC G5C8R7.1
#=GS I1KKE6_SOYBN/263-489        AC I1KKE6.1
#=GS A0A0M8P7R0_9EURO/12-516     AC A0A0M8P7R0.1
#=GS A0A168JWH6_CORDF/10-457     AC A0A168JWH6.1
#=GS A0A0D9R1H0_CHLSB/21-258     AC A0A0D9R1H0.1
#=GS A0A0D9R1H0_CHLSB/267-455    AC A0A0D9R1H0.1
#=GS A0A0C2CUN6_9BILA/156-681    AC A0A0C2CUN6.1
#=GS A0A0B2S729_GLYSO/267-495    AC A0A0B2S729.1
#=GS W5GNP9_WHEAT/1-390          AC W5GNP9.1
#=GS K7FYU6_PELSI/1-548          AC K7FYU6.1
#=GS A0A0D2XE33_FUSO4/1-356      AC A0A0D2XE33.1
#=GS A0A177DQS1_ALTAL/9-286      AC A0A177DQS1.1
#=GS X6NMA8_RETFI/1-242          AC X6NMA8.1
#=GS A0A0W7VZE4_9HYPO/10-302     AC A0A0W7VZE4.1
#=GS G1L3R5_AILME/237-430        AC G1L3R5.1
#=GS A0A091F2H4_CORBR/240-429    AC A0A091F2H4.1
#=GS A0A0S6XL22_9FUNG/7-513      AC A0A0S6XL22.1
#=GS A0A0C2G469_9BILA/1-74       AC A0A0C2G469.1
#=GS D2VRG6_NAEGR/67-585         AC D2VRG6.1
#=GS Q0CTG4_ASPTN/10-515         AC Q0CTG4.1
#=GS H3DGN7_TETNG/16-297         AC H3DGN7.1
#=GS LMBRL_PONAB/21-256          AC Q5RBY7.1
#=GS A0A0K9NNK0_ZOSMR/7-281      AC A0A0K9NNK0.1
#=GS A0A0B2PEI2_GLYSO/7-99       AC A0A0B2PEI2.1
#=GS A0A0L8FPT0_OCTBM/323-471    AC A0A0L8FPT0.1
#=GS A0A061E140_THECC/1-491      AC A0A061E140.1
#=GS A0A096PXS1_MAIZE/205-432    AC A0A096PXS1.1
#=GS V9EN96_PHYPR/1-543          AC V9EN96.1
#=GS A0A0V1CDH3_TRIBR/1-534      AC A0A0V1CDH3.1
#=GS A0A0P7VF00_9TELE/1-276      AC A0A0P7VF00.1
#=GS K2R4W6_MACPH/23-534         AC K2R4W6.1
#=GS W3WR49_9PEZI/15-524         AC W3WR49.1
#=GS A4HM51_LEIBR/5-238          AC A4HM51.1
#=GS A0A176W935_MARPO/1-519      AC A0A176W935.1
#=GS F7E281_XENTR/11-426         AC F7E281.1
#=GS W4ZK09_STRPU/1-230          AC W4ZK09.1
#=GS A0A0R3RIX3_9BILA/19-267     AC A0A0R3RIX3.1
#=GS N1JIT4_BLUG1/8-450          AC N1JIT4.1
#=GS I1FMC9_AMPQE/752-1154       AC I1FMC9.1
#=GS A9URS1_MONBE/159-610        AC A9URS1.1
#=GS F7C7Y6_CALJA/25-262         AC F7C7Y6.1
#=GS W5HIS2_WHEAT/182-408        AC W5HIS2.1
#=GS G1MYC8_MELGA/1-543          AC G1MYC8.1
#=GS A0A0J9XXP1_BRUMA/1-531      AC A0A0J9XXP1.1
#=GS A0A094HZ94_9PEZI/9-517      AC A0A094HZ94.1
#=GS I1MYP5_SOYBN/1-464          AC I1MYP5.1
#=GS F7CGT0_ORNAN/1-155          AC F7CGT0.2
#=GS A0A0G2JFU9_MOUSE/135-313    AC A0A0G2JFU9.1
#=GS R1EZC7_BOTPV/9-450          AC R1EZC7.1
#=GS W1NHY3_AMBTC/1-497          AC W1NHY3.1
#=GS A0A061ES69_THECC/264-490    AC A0A061ES69.1
#=GS D7TH73_VITVI/265-489        AC D7TH73.1
#=GS A0A091IJI7_9AVES/2-207      AC A0A091IJI7.1
#=GS A0A022QFE1_ERYGU/263-489    AC A0A022QFE1.1
#=GS A0A0N5ALM3_9BILA/1-543      AC A0A0N5ALM3.1
#=GS A0A072U057_MEDTR/280-489    AC A0A072U057.1
#=GS A0A067JWQ9_JATCU/258-489    AC A0A067JWQ9.1
#=GS N1Q3H6_DOTSN/14-518         AC N1Q3H6.1
#=GS W7ASW7_PLAVN/4-426          AC W7ASW7.1
#=GS A0A067K0V0_JATCU/1-496      AC A0A067K0V0.1
#=GS D8S065_SELML/8-109          AC D8S065.1
#=GS E9H8R7_DAPPU/258-458        AC E9H8R7.1
#=GS F6Y2U7_CIOIN/1-553          AC F6Y2U7.2
#=GS A0A0A1UQ94_9HYPO/10-286     AC A0A0A1UQ94.1
#=GS E2B7S6_HARSA/17-488         AC E2B7S6.1
#=GS B9HCW4_POPTR/261-489        AC B9HCW4.1
#=GS A0A091M4U0_CARIC/1-359      AC A0A091M4U0.1
#=GS S9V4V8_9TRYP/5-484          AC S9V4V8.1
#=GS LMBD1_BOVIN/16-298          AC Q3SYY9.1
#=GS B4N8W2_DROWI/1-552          AC B4N8W2.1
#=GS C6KT24_PLAF7/1-125          AC C6KT24.1
#=GS J9IM23_9SPIT/319-430        AC J9IM23.1
#=GS L5LZ65_MYODS/1-549          AC L5LZ65.1
#=GS A0A0B0P9A9_GOSAR/1-351      AC A0A0B0P9A9.1
#=GS A0A183GX93_HELBK/3-83       AC A0A183GX93.1
#=GS T1K5N2_TETUR/24-284         AC T1K5N2.1
#=GS A0A0B2RR26_GLYSO/7-94       AC A0A0B2RR26.1
#=GS A0A087QVC9_APTFO/3-421      AC A0A087QVC9.1
#=GS B3M061_DROAN/2-542          AC B3M061.1
#=GS F6PHL3_CALJA/17-190         AC F6PHL3.1
#=GS H2QZM6_PANTR/19-491         AC H2QZM6.1
#=GS A0A0Q3T0U7_AMAAE/266-457    AC A0A0Q3T0U7.1
#=GS I0YK80_COCSC/97-542         AC I0YK80.1
#=GS F4PUU1_DICFS/5-325          AC F4PUU1.1
#=GS E4ZXE4_LEPMJ/9-305          AC E4ZXE4.1
#=GS A0A0A2VYJ7_BEABA/12-521     AC A0A0A2VYJ7.1
#=GS H3DED4_TETNG/1-551          AC H3DED4.1
#=GS F2PKR0_TRIEC/1-235          AC F2PKR0.1
#=GS F6WVI3_CALJA/19-283         AC F6WVI3.1
#=GS J9F8D8_9SPIT/2-498          AC J9F8D8.1
#=GS L5K3Z4_PTEAL/407-444        AC L5K3Z4.1
#=GS A0A0R3WCZ0_TAEAS/1-234      AC A0A0R3WCZ0.1
#=GS U3IQ77_ANAPL/232-437        AC U3IQ77.1
#=GS A0A078A7Y9_STYLE/110-411    AC A0A078A7Y9.1
#=GS A0A091GAL7_9AVES/14-421     AC A0A091GAL7.1
#=GS A0A091QDL6_MERNU/2-161      AC A0A091QDL6.1
#=GS A0A178ED94_9PLEO/7-518      AC A0A178ED94.1
#=GS C4QWM7_KOMPG/1-471          AC C4QWM7.1
#=GS LMBRL_PONAB/268-455         AC Q5RBY7.1
#=GS A0A183HQ73_9BILA/1-228      AC A0A183HQ73.1
#=GS E1FXZ4_LOALO/19-268         AC E1FXZ4.2
#=GS A0A024UQP0_9STRA/265-505    AC A0A024UQP0.1
#=GS F1SNB8_PIG/1-549            AC F1SNB8.1
#=GS K7GH80_PELSI/18-279         AC K7GH80.1
#=GS A0A091J168_9AVES/1-258      AC A0A091J168.1
#=GS K4CQ21_SOLLC/7-282          AC K4CQ21.1
#=GS M4E6H1_BRARP/1-518          AC M4E6H1.1
#=GS K0RHA4_THAOC/3-128          AC K0RHA4.1
#=GS B4QTS6_DROSI/22-500         AC B4QTS6.1
#=GS Q4DTX8_TRYCC/247-456        AC Q4DTX8.1
#=GS A0A078H8Z3_BRANA/1-500      AC A0A078H8Z3.1
#=GS M0Z9W0_HORVD/1-419          AC M0Z9W0.1
#=GS A0A0A2KD75_PENIT/9-289      AC A0A0A2KD75.1
#=GS W7TPT9_9STRA/68-576         AC W7TPT9.1
#=GS V5D878_TRYCR/2-455          AC V5D878.1
#=GS G8F4J9_MACFA/1-533          AC G8F4J9.1
#=GS A0A093LLQ5_EURHL/118-310    AC A0A093LLQ5.1
#=GS H3AKE0_LATCH/18-278         AC H3AKE0.2
#=GS W5I709_WHEAT/1-369          AC W5I709.1
#=GS A0A0S7E2Z9_9EURO/12-517     AC A0A0S7E2Z9.1
#=GS H2T8G9_TAKRU/1-543          AC H2T8G9.1
#=GS F2URH8_SALR5/150-434        AC F2URH8.1
#=GS G0QVJ9_ICHMG/5-121          AC G0QVJ9.1
#=GS G0QP01_ICHMG/1-496          AC G0QP01.1
#=GS H2M3A9_ORYLA/23-440         AC H2M3A9.1
#=GS A0A177WUE8_BATDE/9-422      AC A0A177WUE8.1
#=GS LMBD2_SELML/150-264         AC D8S067.1
#=GS A0A091EGZ0_CORBR/240-434    AC A0A091EGZ0.1
#=GS A0A0M9A1I3_9HYME/1-314      AC A0A0M9A1I3.1
#=GS A0A183E2U1_9BILA/6-216      AC A0A183E2U1.1
#=GS D0N4J7_PHYIT/1-545          AC D0N4J7.1
#=GS C5XYA9_SORBI/1-498          AC C5XYA9.1
#=GS A0E1B8_PARTE/4-503          AC A0E1B8.1
#=GS G6D6E7_DANPL/495-686        AC G6D6E7.1
#=GS H3AWA1_LATCH/1-559          AC H3AWA1.2
#=GS LMBRL_HUMAN/267-455         AC Q6UX01.2
#=GS A0A078B366_STYLE/5-121      AC A0A078B366.1
#=GS A0A067CMU7_SAPPC/4-323      AC A0A067CMU7.1
#=GS M3XJN2_LATCH/13-431         AC M3XJN2.1
#=GS A0A0V1DG27_TRIBR/17-309     AC A0A0V1DG27.1
#=GS F7C7Y6_CALJA/235-415        AC F7C7Y6.1
#=GS W6QBF1_PENRF/12-516         AC W6QBF1.1
#=GS S9U8S1_9TRYP/2-277          AC S9U8S1.1
#=GS W6L6P6_9TRYP/245-441        AC W6L6P6.1
#=GS A0A091K932_COLST/1-248      AC A0A091K932.1
#=GS W5N3Z3_LEPOC/18-274         AC W5N3Z3.1
#=GS A0A0W8BVT9_PHYNI/259-492    AC A0A0W8BVT9.1
#=GS A0A0P7XER6_9TELE/4-561      AC A0A0P7XER6.1
#=GS A0A0L9TJX8_PHAAN/1-354      AC A0A0L9TJX8.1
#=GS A0A0R4IR97_DANRE/17-254     AC A0A0R4IR97.1
#=GS G1N0G8_MELGA/1-174          AC G1N0G8.2
#=GS A0A0E0PSX6_ORYRU/222-457    AC A0A0E0PSX6.1
#=GS T0QZ94_9STRA/5-520          AC T0QZ94.1
#=GS W6L6P6_9TRYP/5-282          AC W6L6P6.1
#=GS A0A0N4WBM8_HAEPC/1-528      AC A0A0N4WBM8.1
#=GS A0A0R3WCZ0_TAEAS/272-465    AC A0A0R3WCZ0.1
#=GS A0A0R3QJM9_9BILA/1-543      AC A0A0R3QJM9.1
#=GS E5QYW5_ARTGP/6-241          AC E5QYW5.1
#=GS U3JWP7_FICAL/257-450        AC U3JWP7.1
#=GS W6QID7_PENRF/9-520          AC W6QID7.1
#=GS F0YBA6_AURAN/281-816        AC F0YBA6.1
#=GS A0A0G2HVZ2_9PEZI/11-261     AC A0A0G2HVZ2.1
#=GS K7MGG9_SOYBN/83-309         AC K7MGG9.1
#=GS D0N4S3_PHYIT/283-492        AC D0N4S3.1
#=GS A0A078HHH3_BRANA/48-553     AC A0A078HHH3.1
#=GS W5HH57_WHEAT/71-290         AC W5HH57.1
#=GS A0A0D2L4F9_9CHLO/10-287     AC A0A0D2L4F9.1
#=GS A0A091P0W8_HALAL/1-459      AC A0A091P0W8.1
#=GS A0A136JC50_9PEZI/14-523     AC A0A136JC50.1
#=GS A4S6J9_OSTLU/39-542         AC A4S6J9.1
#=GS A0A0Q3MSK5_AMAAE/253-424    AC A0A0Q3MSK5.1
#=GS G6CRH8_DANPL/1-539          AC G6CRH8.1
#=GS G2RBV0_THITE/16-525         AC G2RBV0.1
#=GS F7HSP7_MACMU/1-188          AC F7HSP7.1
#=GS A0A0V1G3E6_TRIPS/17-298     AC A0A0V1G3E6.1
#=GS A0A0K9NNK0_ZOSMR/261-489    AC A0A0K9NNK0.1
#=GS A0A066XDF3_COLSU/11-457     AC A0A066XDF3.1
#=GS S2KIQ2_MUCC1/8-288          AC S2KIQ2.1
#=GS A0A091FXB4_9AVES/1-248      AC A0A091FXB4.1
#=GS A0A0L0DCG2_THETB/1-533      AC A0A0L0DCG2.1
#=GS A0A094D6H0_9PEZI/9-517      AC A0A094D6H0.1
#=GS G0RTI3_HYPJQ/9-455          AC G0RTI3.1
#=GS J9JWK3_ACYPI/19-483         AC J9JWK3.2
#=GS V4LCH4_EUTSA/97-372         AC V4LCH4.1
#=GS A0A0D3BAG8_BRAOL/274-489    AC A0A0D3BAG8.1
#=GS A0A151T265_CAJCA/1-500      AC A0A151T265.1
#=GS H3DC77_TETNG/18-256         AC H3DC77.1
#=GS A0A183D3K7_9BILA/1-168      AC A0A183D3K7.1
#=GS A0A0D2E493_9EURO/6-508      AC A0A0D2E493.1
#=GS F6XWJ1_CANLF/23-302         AC F6XWJ1.1
#=GS H2UV38_TAKRU/10-422         AC H2UV38.1
#=GS A0A0L8I8R2_OCTBM/1-229      AC A0A0L8I8R2.1
#=GS H2NH57_PONAB/267-455        AC H2NH57.1
#=GS A0A078A7Y9_STYLE/1-114      AC A0A078A7Y9.1
#=GS A0A061HGX8_BLUGR/11-104     AC A0A061HGX8.1
#=GS A0A0V0VXX3_9BILA/17-221     AC A0A0V0VXX3.1
#=GS A0A0D9VLA3_9ORYZ/1-395      AC A0A0D9VLA3.1
#=GS LMBR1_HUMAN/255-450         AC Q8WVP7.1
#=GS Q38BH4_TRYB2/4-287          AC Q38BH4.1
#=GS D8UDB0_VOLCA/14-284         AC D8UDB0.1
#=GS M7B2F5_CHEMY/27-237         AC M7B2F5.1
#=GS J7RXH6_KAZNA/1-496          AC J7RXH6.1
#=GS A0A0Q3T0U7_AMAAE/21-276     AC A0A0Q3T0U7.1
#=GS F6TEM6_XENTR/1-257          AC F6TEM6.1
#=GS A0A0A2VFB5_BEABA/10-301     AC A0A0A2VFB5.1
#=GS A0A0D1WAJ0_9EURO/25-303     AC A0A0D1WAJ0.1
#=GS I1H156_BRADI/264-490        AC I1H156.1
#=GS A0A091NPY5_APAVI/49-244     AC A0A091NPY5.1
#=GS LMBD1_ASPNC/8-283           AC A2R920.1
#=GS A0A0B1P6C3_UNCNE/30-541     AC A0A0B1P6C3.1
#=GS S9VJG4_9TRYP/5-266          AC S9VJG4.1
#=GS M0Z9W1_HORVD/1-390          AC M0Z9W1.1
#=GS A0A0V1I6V6_9BILA/278-474    AC A0A0V1I6V6.1
#=GS A0A0R3RIX3_9BILA/251-443    AC A0A0R3RIX3.1
#=GS S8BTX0_9LAMI/7-489          AC S8BTX0.1
#=GS A0A177CQ27_9PLEO/9-299      AC A0A177CQ27.1
#=GS M2VYM8_GALSU/5-548          AC M2VYM8.1
#=GS S8B9A4_DACHA/4-525          AC S8B9A4.1
#=GS W7HHU3_9PEZI/4-524          AC W7HHU3.1
#=GS A0A0D9WLA6_9ORYZ/266-490    AC A0A0D9WLA6.1
#=GS W5L0L9_ASTMX/258-451        AC W5L0L9.1
#=GS A0A0P4UCC3_ROSNE/12-520     AC A0A0P4UCC3.1
#=GS W7TQL5_9STRA/1-97           AC W7TQL5.1
#=GS A0A0V0UDM6_9BILA/17-309     AC A0A0V0UDM6.1
#=GS A0A026WI55_CERBI/17-490     AC A0A026WI55.1
#=GS M2U9P3_COCH5/7-520          AC M2U9P3.1
#=GS S9W0Y5_SCHCR/1-443          AC S9W0Y5.1
#=GS C6H1L5_AJECH/181-687        AC C6H1L5.1
#=GS I1JLF0_SOYBN/268-488        AC I1JLF0.1
#=GS A0A139I309_9PEZI/13-516     AC A0A139I309.1
#=GS A0A0J7LAI4_LASNI/11-382     AC A0A0J7LAI4.1
#=GS A0A067CMU7_SAPPC/304-521    AC A0A067CMU7.1
#=GS K7HV66_CAEJA/32-168         AC K7HV66.1
#=GS A0A087SCC2_AUXPR/289-428    AC A0A087SCC2.1
#=GS A0A077ZP06_TRITR/17-121     AC A0A077ZP06.1
#=GS A0A0T6B7K0_9SCAR/1-483      AC A0A0T6B7K0.1
#=GS A0A0E0L790_ORYPU/264-490    AC A0A0E0L790.1
#=GS F7VYL4_SORMK/12-525         AC F7VYL4.1
#=GS B6HV90_PENRW/9-289          AC B6HV90.1
#=GS A0A087H828_ARAAL/7-282      AC A0A087H828.1
#=GS A0A091M4R0_CARIC/132-286    AC A0A091M4R0.1
#=GS A0A087SCC2_AUXPR/5-313      AC A0A087SCC2.1
#=GS I1N2X4_SOYBN/263-489        AC I1N2X4.1
#=GS A0A0L0HNW8_SPIPN/283-485    AC A0A0L0HNW8.1
#=GS G1L3R5_AILME/1-262          AC G1L3R5.1
#=GS A0A151S3A3_CAJCA/1-498      AC A0A151S3A3.1
#=GS E1ZL65_CHLVA/1-476          AC E1ZL65.1
#=GS D7M717_ARALL/7-282          AC D7M717.1
#=GS A0A059LE07_9CHLO/8-318      AC A0A059LE07.1
#=GS A0A059LHM2_9CHLO/151-371    AC A0A059LHM2.1
#=GS H2TMI5_TAKRU/18-285         AC H2TMI5.1
#=GS L8G1R0_PSED2/9-517          AC L8G1R0.1
#=GS A0A091L547_CATAU/234-430    AC A0A091L547.1
#=GS A0A0S6XDH7_9FUNG/9-307      AC A0A0S6XDH7.1
#=GS A0A078AXP7_STYLE/1-507      AC A0A078AXP7.1
#=GS H0UZU8_CAVPO/266-454        AC H0UZU8.1
#=GS A0A0A1UE81_ENTIV/1-489      AC A0A0A1UE81.1
#=GS H0WK04_OTOGA/1-350          AC H0WK04.1
#=GS Q4D753_TRYCC/3-489          AC Q4D753.1
#=GS V4KN21_EUTSA/1-500          AC V4KN21.1
#=GS F7FJY9_MONDO/1-548          AC F7FJY9.1
#=GS H0YUW3_TAEGU/1-543          AC H0YUW3.1
#=GS A0A0E0A4E9_9ORYZ/7-283      AC A0A0E0A4E9.1
#=GS A0A151MWX8_ALLMI/1-545      AC A0A151MWX8.1
#=GS A7TG06_VANPO/1-491          AC A7TG06.1
#=GS M7T9P3_EUTLA/11-461         AC M7T9P3.1
#=GS U6K629_9EIME/2-288          AC U6K629.1
#=GS A2G7G8_TRIVA/216-453        AC A2G7G8.1
#=GS W9VRG7_9EURO/11-294         AC W9VRG7.1
#=GS W4Y7X6_STRPU/8-295          AC W4Y7X6.1
#=GS I1PZ58_ORYGL/7-283          AC I1PZ58.1
#=GS G0ME02_CAEBE/63-696         AC G0ME02.1
#=GS G7JCR3_MEDTR/1-498          AC G7JCR3.2
#=GS A0A087WS60_MOUSE/11-157     AC A0A087WS60.1
#=GS K7U5S3_MAIZE/1-307          AC K7U5S3.1
#=GS A0A154PFX1_9HYME/1-536      AC A0A154PFX1.1
#=GS H0V0J6_CAVPO/233-428        AC H0V0J6.1
#=GS U3JWR3_FICAL/10-423         AC U3JWR3.1
#=GS V4LFC8_EUTSA/273-489        AC V4LFC8.1
#=GS A0A0G2EEW7_9EURO/1-385      AC A0A0G2EEW7.1
#=GS H1VA57_COLHI/11-302         AC H1VA57.1
#=GS A0A0V1PNQ7_9BILA/278-474    AC A0A0V1PNQ7.1
#=GS A0A0E0A4F1_9ORYZ/7-172      AC A0A0E0A4F1.1
#=GS A0A0R3TYF5_HYMNN/209-308    AC A0A0R3TYF5.1
#=GS A0A0V0WFX9_9BILA/1-534      AC A0A0V0WFX9.1
#=GS W2TPY9_NECAM/31-511         AC W2TPY9.1
#=GS G7XQX0_ASPKW/8-284          AC G7XQX0.1
#=GS A0A0D3CLT1_BRAOL/255-489    AC A0A0D3CLT1.1
#=GS A0A0Q3X5J7_AMAAE/1-543      AC A0A0Q3X5J7.1
#=GS A0A091E428_FUKDA/2-157      AC A0A091E428.1
#=GS E2A3U5_CAMFO/1-473          AC E2A3U5.1
#=GS A0A074XYN6_AURPU/9-291      AC A0A074XYN6.1
#=GS LMBD1_HUMAN/14-262          AC Q9NUN5.1
#=GS A0A087G633_ARAAL/1-500      AC A0A087G633.1
#=GS M5W2M6_PRUPE/1-496          AC M5W2M6.1
#=GS A0A183BPM6_GLOPA/1-517      AC A0A183BPM6.1
#=GS A0A132A2U0_SARSC/32-498     AC A0A132A2U0.1
#=GS C1MYJ1_MICPC/273-495        AC C1MYJ1.1
#=GS D8S070_SELML/148-313        AC D8S070.1
#=GS J5JKH5_BEAB2/10-302         AC J5JKH5.1
#=GS Q22W34_TETTS/21-575         AC Q22W34.2
#=GS U9TCG2_RHIID/8-283          AC U9TCG2.1
#=GS LMBR1_CHICK/18-279          AC Q7ZUA6.1
#=GS L5MD79_MYODS/267-455        AC L5MD79.1
#=GS G7PHS1_MACFA/21-258         AC G7PHS1.1
#=GS D8QQI2_SELML/7-283          AC D8QQI2.1
#=GS E9GPQ7_DAPPU/17-264         AC E9GPQ7.1
#=GS A0A0D2WGY0_CAPO3/1-631      AC A0A0D2WGY0.1
#=GS A0A0N5CVY7_THECL/21-264     AC A0A0N5CVY7.1
#=GS W7U3J0_9STRA/273-494        AC W7U3J0.1
#=GS A0A091FTV2_9AVES/2-181      AC A0A091FTV2.1
#=GS A0A024TJW4_9STRA/1-538      AC A0A024TJW4.1
#=GS A0A091Q8G8_LEPDC/239-430    AC A0A091Q8G8.1
#=GS T4ZYV6_OPHSC/17-300         AC T4ZYV6.1
#=GS A0A0B0N4J9_GOSAR/6-289      AC A0A0B0N4J9.1
#=GS A0A124BY48_ASPNG/10-515     AC A0A124BY48.1
#=GS A8I062_CHLRE/1-106          AC A8I062.1
#=GS A0A0L0F9L3_9EUKA/175-288    AC A0A0L0F9L3.1
#=GS A0DFW7_PARTE/3-499          AC A0DFW7.1
#=GS A0A0D2AHA1_9EURO/6-511      AC A0A0D2AHA1.1
#=GS J9J2Q7_9SPIT/5-466          AC J9J2Q7.1
#=GS J3NHU8_GAGT3/9-285          AC J3NHU8.1
#=GS A0A091TCS2_9AVES/116-310    AC A0A091TCS2.1
#=GS X6P1E8_RETFI/1-468          AC X6P1E8.1
#=GS A4D9T4_ASPFU/12-517         AC A4D9T4.1
#=GS C1MZX1_MICPC/5-467          AC C1MZX1.1
#=GS A0A0A1MUR6_9FUNG/10-81      AC A0A0A1MUR6.1
#=GS H2XUT2_CIOIN/1-190          AC H2XUT2.1
#=GS A0A074X814_AURPU/8-499      AC A0A074X814.1
#=GS A0A0K9PFH5_ZOSMR/1-498      AC A0A0K9PFH5.1
#=GS D2VJK4_NAEGR/8-276          AC D2VJK4.1
#=GS LMBD2_MOUSE/1-549           AC Q8C561.1
#=GS A0A0E0PSX5_ORYRU/276-490    AC A0A0E0PSX5.1
#=GS A0A0A1MUR6_9FUNG/77-401     AC A0A0A1MUR6.1
#=GS H3DC77_TETNG/252-452        AC H3DC77.1
#=GS K7HV65_CAEJA/1-132          AC K7HV65.1
#=GS W5N502_LEPOC/1-152          AC W5N502.1
#=GS G3TX80_LOXAF/9-166          AC G3TX80.1
#=GS W4YMM4_STRPU/50-476         AC W4YMM4.1
#=GS F1QUZ2_DANRE/33-587         AC F1QUZ2.1
#=GS B8M839_TALSN/163-660        AC B8M839.1
#=GS A0A194PYF0_PAPXU/1-537      AC A0A194PYF0.1
#=GS U7Q497_SPOS1/40-556         AC U7Q497.1
#=GS Y3707_DICDI/5-290           AC Q54QP7.2
#=GS J9BKW3_WUCBA/266-440        AC J9BKW3.1
#=GS A0A068RXG7_9FUNG/8-290      AC A0A068RXG7.1
#=GS A0A087RDI5_APTFO/1-543      AC A0A087RDI5.1
#=GS H2U0U7_TAKRU/18-278         AC H2U0U7.1
#=GS Y3610_DICDI/291-496         AC Q54BI3.1
#=GS D3B9Q3_POLPA/315-483        AC D3B9Q3.1
#=GS W2PZ14_PHYPN/259-492        AC W2PZ14.1
#=GS F6V418_CANLF/46-284         AC F6V418.1
#=GS F7A4I2_MONDO/19-280         AC F7A4I2.1
#=GS G4U7S0_NEUT9/18-467         AC G4U7S0.1
#=GS B7GCP5_PHATC/5-522          AC B7GCP5.1
#=GS A0A094D7U6_9PEZI/28-305     AC A0A094D7U6.1
#=GS W1Q8D1_OGAPD/2-496          AC W1Q8D1.1
#=GS A0A0L0S494_ALLMA/282-478    AC A0A0L0S494.1
#=GS A0A096NXX0_PAPAN/259-450    AC A0A096NXX0.1
#=GS J9EUJ9_WUCBA/97-221         AC J9EUJ9.1
#=GS A0A0V1DF73_TRIBR/17-311     AC A0A0V1DF73.1
#=GS A0A151RQJ3_CAJCA/7-290      AC A0A151RQJ3.1
#=GS A0A061IYH2_TRYRA/273-460    AC A0A061IYH2.1
#=GS H3D5G6_TETNG/266-454        AC H3D5G6.1
#=GS G0QVG7_ICHMG/239-716        AC G0QVG7.1
#=GS V7CR22_PHAVU/1-498          AC V7CR22.1
#=GS A0A194R1W6_PAPMA/1-380      AC A0A194R1W6.1
#=GS A0A125YUG1_TOXGV/7-641      AC A0A125YUG1.1
#=GS A0A091I171_CALAN/236-429    AC A0A091I171.1
#=GS G3P330_GASAC/18-274         AC G3P330.1
#=GS A0A090M6Z7_OSTTA/277-506    AC A0A090M6Z7.1
#=GS A0A0L0H4L2_SPIPN/10-287     AC A0A0L0H4L2.1
#=GS CSPLJ_SELML/4-184           AC D8RQM9.1
#=GS E1BMA6_BOVIN/267-455        AC E1BMA6.1
#=GS A0A194QBV4_PAPXU/18-496     AC A0A194QBV4.1
#=GS A0A158QEG1_HYMDI/3-476      AC A0A158QEG1.1
#=GS A0A162MBI9_9PEZI/28-541     AC A0A162MBI9.1
#=GS R1BPF4_EMIHU/1-292          AC R1BPF4.1
#=GS A0E6M0_PARTE/1-506          AC A0E6M0.1
#=GS G3I6I7_CRIGR/267-455        AC G3I6I7.1
#=GS A0A0E0L791_ORYPU/7-175      AC A0A0E0L791.1
#=GS E3RPZ3_PYRTT/7-520          AC E3RPZ3.1
#=GS A0A075AXE5_9FUNG/7-235      AC A0A075AXE5.1
#=GS A0A0L9ST13_9HYPO/12-512     AC A0A0L9ST13.1
#=GS LMBD2_SELML/5-183           AC D8S067.1
#=GS G0V6K5_NAUCC/1-494          AC G0V6K5.1
#=GS G5AU28_HETGA/266-454        AC G5AU28.1
#=GS A0A0G2JFX9_MOUSE/132-327    AC A0A0G2JFX9.1
#=GS A0A078GRB5_BRANA/7-282      AC A0A078GRB5.1
#=GS E9IFN2_SOLIN/79-613         AC E9IFN2.1
#=GS K9FJG1_PEND2/12-516         AC K9FJG1.1
#=GS A0A093QNU0_9PASS/1-415      AC A0A093QNU0.1
#=GS A0A024T918_9STRA/47-297     AC A0A024T918.1
#=GS A0A078IUQ9_BRANA/1-509      AC A0A078IUQ9.1
#=GS A0A091HEJ6_BUCRH/2-197      AC A0A091HEJ6.1
#=GS A0A077ZU38_STYLE/317-433    AC A0A077ZU38.1
#=GS M2SL05_COCSN/9-286          AC M2SL05.1
#=GS A0A0B2RB90_GLYSO/1-498      AC A0A0B2RB90.1
#=GS A0A137PEB8_CONC2/10-500     AC A0A137PEB8.1
#=GS K7HM30_CAEJA/1-189          AC K7HM30.1
#=GS A8BSX6_GIAIC/4-696          AC A8BSX6.1
#=GS G3UI42_LOXAF/1-549          AC G3UI42.1
#=GS A7RHN0_NEMVE/21-287         AC A7RHN0.1
#=GS W5I732_WHEAT/1-201          AC W5I732.1
#=GS A0A166I6X1_DAUCA/1-355      AC A0A166I6X1.1
#=GS H2YCN3_CIOSA/1-247          AC H2YCN3.1
#=GS W5I732_WHEAT/182-408        AC W5I732.1
#=GS L5L5P9_PTEAL/84-361         AC L5L5P9.1
#=GS G9P4Q7_HYPAI/12-521         AC G9P4Q7.1
#=GS E9ECR0_METAQ/10-294         AC E9ECR0.1
#=GS A0A087G448_ARAAL/261-489    AC A0A087G448.1
#=GS A0A084WRD1_ANOSI/1-531      AC A0A084WRD1.1
#=GS H3EX77_PRIPA/5-181          AC H3EX77.1
#=GS A0A0D2PRN2_GOSRA/28-445     AC A0A0D2PRN2.1
#=GS W4J1K4_PLAFP/34-226         AC W4J1K4.1
#=GS Y3707_DICDI/291-496         AC Q54QP7.2
#=GS A0BSN5_PARTE/1-480          AC A0BSN5.1
#=GS G3I7S0_CRIGR/4-125          AC G3I7S0.1
#=GS A0A0P4TZG2_ROSNE/11-293     AC A0A0P4TZG2.1
#=GS D3BQG9_POLPA/669-907        AC D3BQG9.1
#=GS M4ELR2_BRARP/255-489        AC M4ELR2.1
#=GS W9R6J3_9ROSA/7-477          AC W9R6J3.1
#=GS W2YY79_PHYPR/259-492        AC W2YY79.1
#=GS A0A0V0XFE2_TRIPS/9-542      AC A0A0V0XFE2.1
#=GS G3P315_GASAC/279-477        AC G3P315.1
#=GS A0A0R4IDU5_DANRE/247-451    AC A0A0R4IDU5.1
#=GS A0A0L7RCA1_9HYME/9-476      AC A0A0L7RCA1.1
#=GS M4EST8_BRARP/1-500          AC M4EST8.1
#=GS A0A0L0FV53_9EUKA/1-106      AC A0A0L0FV53.1
#=GS G1NM64_MELGA/17-430         AC G1NM64.1
#=GS A0A0G4FP53_VITBC/5-345      AC A0A0G4FP53.1
#=GS A0A093JC92_EURHL/1-197      AC A0A093JC92.1
#=GS M7B8G2_CHEMY/378-416        AC M7B8G2.1
#=GS K1PRK7_CRAGI/30-430         AC K1PRK7.1
#=GS H3D5G6_TETNG/18-288         AC H3D5G6.1
#=GS C1G5H2_PARBD/8-293          AC C1G5H2.1
#=GS A0A077ZWI9_STYLE/112-475    AC A0A077ZWI9.1
#=GS D0N4S3_PHYIT/6-296          AC D0N4S3.1
#=GS E5SQ67_TRISP/1-534          AC E5SQ67.1
#=GS U6PCU6_HAECO/1-528          AC U6PCU6.1
#=GS G1LJZ5_AILME/21-258         AC G1LJZ5.1
#=GS F7AR89_HORSE/21-258         AC F7AR89.1
#=GS I3JF56_ORENI/18-288         AC I3JF56.1
#=GS A0A0P7BPF3_9HYPO/12-521     AC A0A0P7BPF3.1
#=GS B3RQ62_TRIAD/1-261          AC B3RQ62.1
#=GS A0DVS5_PARTE/4-448          AC A0DVS5.1
#=GS Q9FKQ8_ARATH/1-500          AC Q9FKQ8.1
#=GS A0A0G4PLN4_PENCA/12-516     AC A0A0G4PLN4.1
#=GS A0A0R3NFC4_DROPS/21-496     AC A0A0R3NFC4.1
#=GS A0A093PTM3_9PASS/1-252      AC A0A093PTM3.1
#=GS A0A0B4KGZ8_DROME/22-500     AC A0A0B4KGZ8.1
#=GS A0A0S4IQ17_BODSA/5-295      AC A0A0S4IQ17.1
#=GS D8S070_SELML/1-148          AC D8S070.1
#=GS T5AL92_OPHSC/1-163          AC T5AL92.1
#=GS A0A0C3H642_9PEZI/8-300      AC A0A0C3H642.1
#=GS D8QQI2_SELML/246-492        AC D8QQI2.1
#=GS A0A0L7LEV7_9NEOP/18-161     AC A0A0L7LEV7.1
#=GS L5MD79_MYODS/21-259         AC L5MD79.1
#=GS A0A072U4N2_MEDTR/1-498      AC A0A072U4N2.1
#=GS R0I313_9BRAS/271-489        AC R0I313.1
#=GS A0A091FXB4_9AVES/234-430    AC A0A091FXB4.1
#=GS A0A162AH92_DAUCA/1-376      AC A0A162AH92.1
#=GS L5LFY6_MYODS/67-468         AC L5LFY6.1
#=GS K7GH80_PELSI/253-449        AC K7GH80.1
#=GS X6MBN3_RETFI/1-389          AC X6MBN3.1
#=GS D2V0X4_NAEGR/58-609         AC D2V0X4.1
#=GS I1LNI1_SOYBN/1-498          AC I1LNI1.1
#=GS A0A0A2JH38_PENEN/12-516     AC A0A0A2JH38.1
#=GS G3I6I7_CRIGR/21-258         AC G3I6I7.1
#=GS S0DWL4_GIBF5/10-294         AC S0DWL4.1
#=GS A0A0D2FIH5_9EURO/11-296     AC A0A0D2FIH5.1
#=GS A0A096M8L7_POEFO/13-297     AC A0A096M8L7.1
#=GS A0A0G4IM46_PLABS/57-338     AC A0A0G4IM46.1
#=GS A0A0M8ZSU9_9HYME/42-404     AC A0A0M8ZSU9.1
#=GS H2LTX9_ORYLA/256-452        AC H2LTX9.1
#=GS B8MHN3_TALSN/8-446          AC B8MHN3.1
#=GS A0A101MQS1_9EURO/12-516     AC A0A101MQS1.1
#=GS A0A0B2RDE2_GLYSO/57-211     AC A0A0B2RDE2.1
#=GS W1PIK5_AMBTC/271-489        AC W1PIK5.1
#=GS G3T4T8_LOXAF/21-258         AC G3T4T8.1
#=GS N1PJW2_DOTSN/9-304          AC N1PJW2.1
#=GS A0A0A2V1Z5_PARBA/20-443     AC A0A0A2V1Z5.1
#=GS V4LFC8_EUTSA/7-283          AC V4LFC8.1
#=GS F6TRU8_XENTR/1-566          AC F6TRU8.1
#=GS K3YQB5_SETIT/1-498          AC K3YQB5.1
#=GS A0A0V0UDT9_9BILA/256-430    AC A0A0V0UDT9.1
#=GS F7FD35_MONDO/16-262         AC F7FD35.1
#=GS F1RTT5_PIG/17-296           AC F1RTT5.1
#=GS A0A0L9U4H6_PHAAN/7-293      AC A0A0L9U4H6.1
#=GS A0A135LQA3_PENPA/9-289      AC A0A135LQA3.1
#=GS G1PS18_MYOLU/232-428        AC G1PS18.1
#=GS A0A087WPS2_MOUSE/11-137     AC A0A087WPS2.1
#=GS L8Y929_TUPCH/618-806        AC L8Y929.1
#=GS W5PMV4_SHEEP/1-549          AC W5PMV4.1
#=GS B7Q1Z6_IXOSC/17-276         AC B7Q1Z6.1
#=GS A0A093LLQ5_EURHL/1-135      AC A0A093LLQ5.1
#=GS C4M8R3_ENTHI/1-142          AC C4M8R3.1
#=GS A0A087XM79_POEFO/18-256     AC A0A087XM79.2
#=GS H2PFC4_PONAB/1-549          AC H2PFC4.1
#=GS W5HH57_WHEAT/1-83           AC W5HH57.1
#=GS A0A178ANN9_9PLEO/7-519      AC A0A178ANN9.1
#=GS G3NIH5_GASAC/259-449        AC G3NIH5.1
#=GS M2N898_BAUCO/8-300          AC M2N898.1
#=GS J0M799_LOALO/1-540          AC J0M799.1
#=GS A0A074X1T2_9PEZI/8-501      AC A0A074X1T2.1
#=GS M3VU39_FELCA/21-259         AC M3VU39.1
#=GS W5JHZ1_ANODA/324-475        AC W5JHZ1.1
#=GS A0A0B0N6I9_GOSAR/23-202     AC A0A0B0N6I9.1
#=GS L8GJ93_ACACA/4-280          AC L8GJ93.1
#=GS I1EIQ5_AMPQE/35-253         AC I1EIQ5.1
#=GS Q584V8_TRYB2/2-489          AC Q584V8.1
#=GS A0A158RDN3_HYDTA/1-457      AC A0A158RDN3.1
#=GS H2UV37_TAKRU/16-428         AC H2UV37.1
#=GS H9GER8_ANOCA/11-519         AC H9GER8.2
#=GS F2CR18_HORVD/264-492        AC F2CR18.1
#=GS S9YQI3_CAMFR/286-555        AC S9YQI3.1
#=GS CSPLK_SELML/6-165           AC D8S072.1
#=GS R0KTT4_ANAPL/1-253          AC R0KTT4.1
#=GS A0A093Z7Q4_9PEZI/9-517      AC A0A093Z7Q4.1
#=GS T1HA65_RHOPR/34-281         AC T1HA65.1
#=GS F2PH44_TRIEC/8-443          AC F2PH44.1
#=GS G3NXX2_GASAC/1-551          AC G3NXX2.1
#=GS M3YT49_MUSPF/21-259         AC M3YT49.1
#=GS A0A078CG22_BRANA/7-282      AC A0A078CG22.1
#=GS M4AGX1_XIPMA/1-110          AC M4AGX1.1
#=GS A0A183TQ58_SCHSO/1-149      AC A0A183TQ58.1
#=GS A0A087SD16_AUXPR/247-451    AC A0A087SD16.1
#=GS A0A093G9S7_PICPB/236-430    AC A0A093G9S7.1
#=GS E4UXR9_ARTGP/8-295          AC E4UXR9.1
#=GS H9IZ11_BOMMO/21-314         AC H9IZ11.1
#=GS G1M126_AILME/1-549          AC G1M126.1
#=GS A0A0M8MYV5_9HYPO/10-290     AC A0A0M8MYV5.1
#=GS W7LZU1_GIBM7/12-523         AC W7LZU1.1
#=GS C0H5F8_PLAF7/4-281          AC C0H5F8.1
#=GS A0A059D7B6_EUCGR/263-427    AC A0A059D7B6.1
#=GS LILI_DROME/22-500           AC Q9VC35.1
#=GS B0WAG8_CULQU/1-531          AC B0WAG8.1
#=GS A0A024VH35_PLAFA/1-125      AC A0A024VH35.1
#=GS V9ESJ5_PHYPR/6-293          AC V9ESJ5.1
#=GS A0A093EJZ4_9AVES/1-543      AC A0A093EJZ4.1
#=GS A0A0A1TGB1_9HYPO/11-520     AC A0A0A1TGB1.1
#=GS A0A0V1DEN1_TRIBR/17-238     AC A0A0V1DEN1.1
#=GS G3S3E0_GORGO/1-491          AC G3S3E0.1
#=GS I1H156_BRADI/7-283          AC I1H156.1
#=GS A0A0N4VW26_HAEPC/52-255     AC A0A0N4VW26.1
#=GS A0A0E0L790_ORYPU/7-287      AC A0A0E0L790.1
#=GS W7J6K3_PLAFA/1-184          AC W7J6K3.1
#=GS A0A078JBH3_BRANA/255-489    AC A0A078JBH3.1
#=GS A0A162A512_DAUCA/272-490    AC A0A162A512.1
#=GS V4MIX9_EUTSA/6-420          AC V4MIX9.1
#=GS A0A099ZXA2_TINGU/1-249      AC A0A099ZXA2.1
#=GS G3SNN3_LOXAF/13-281         AC G3SNN3.1
#=GS A0A139ADX1_GONPR/8-286      AC A0A139ADX1.1
#=GS U1GQ66_ENDPU/31-312         AC U1GQ66.1
#=GS F6WVI3_CALJA/256-450        AC F6WVI3.1
#=GS A0A0L7LF21_9NEOP/40-228     AC A0A0L7LF21.1
#=GS A0A0B2P8L7_GLYSO/263-489    AC A0A0B2P8L7.1
#=GS F4X5V0_ACREC/295-490        AC F4X5V0.1
#=GS A0A0V0VXZ7_9BILA/278-474    AC A0A0V0VXZ7.1
#=GS A0A094F217_9PEZI/38-320     AC A0A094F217.1
#=GS K9FX96_PEND2/9-287          AC K9FX96.1
#=GS A0A0L0DN76_THETB/5-283      AC A0A0L0DN76.1
#=GS A0A0D2TK67_GOSRA/1-501      AC A0A0D2TK67.1
#=GS G3IKM4_CRIGR/1-410          AC G3IKM4.1
#=GS H2NH57_PONAB/21-258         AC H2NH57.1
#=GS M3XFR2_FELCA/133-327        AC M3XFR2.1
#=GS D2V349_NAEGR/15-285         AC D2V349.1
#=GS U1MHK2_ASCSU/293-471        AC U1MHK2.1
#=GS A0A0C3HCE5_9PEZI/10-519     AC A0A0C3HCE5.1
#=GS A0A044UVD0_ONCVO/19-265     AC A0A044UVD0.1
#=GS R8BVA2_TOGMI/10-294         AC R8BVA2.1
#=GS A0A093YHP6_9PEZI/28-310     AC A0A093YHP6.1
#=GS A0A091GDE9_9AVES/1-543      AC A0A091GDE9.1
#=GS W5K3G8_ASTMX/18-262         AC W5K3G8.1
#=GS A0A0V0QDW8_PSEPJ/4-306      AC A0A0V0QDW8.1
#=GS C3ZD62_BRAFL/1-296          AC C3ZD62.1
#=GS W9WGM3_9EURO/6-511          AC W9WGM3.1
#=GS A0A0G4J5U9_PLABS/5-289      AC A0A0G4J5U9.1
#=GS G3TJH4_LOXAF/1-262          AC G3TJH4.1
#=GS G3TJH4_LOXAF/233-428        AC G3TJH4.1
#=GS A4IAR3_LEIIN/5-238          AC A4IAR3.1
#=GS L8H6Q8_ACACA/1-499          AC L8H6Q8.1
#=GS W9YIP2_9EURO/11-297         AC W9YIP2.1
#=GS B8NYP2_ASPFN/8-302          AC B8NYP2.1
#=GS A0A0C9LTR0_9FUNG/1957-2377  AC A0A0C9LTR0.1
#=GS A0A0G4EK02_VITBC/3-485      AC A0A0G4EK02.1
#=GS D4AMW8_ARTBC/1-399          AC D4AMW8.1
#=GS A0A024WTF0_PLAFA/1-125      AC A0A024WTF0.1
#=GS F6YTE9_XENTR/28-287         AC F6YTE9.1
#=GS A0A091RM43_9GRUI/1-370      AC A0A091RM43.1
#=GS A0A0D1YBW0_9EURO/6-508      AC A0A0D1YBW0.1
#=GS G3TX80_LOXAF/139-333        AC G3TX80.1
#=GS E9H8R7_DAPPU/17-276         AC E9H8R7.1
#=GS S3CLC2_OPHP1/35-548         AC S3CLC2.1
#=GS A0A022RPH2_ERYGU/7-281      AC A0A022RPH2.1
#=GS W4YYE7_STRPU/10-260         AC W4YYE7.1
#=GS F1N364_BOVIN/16-298         AC F1N364.1
#=GS M3XFR2_FELCA/1-160          AC M3XFR2.1
#=GS A0A0L9VTD1_PHAAN/7-294      AC A0A0L9VTD1.1
#=GS A0A091UBE3_PHALP/1-302      AC A0A091UBE3.1
#=GS C5FDI2_ARTOC/6-517          AC C5FDI2.1
#=GS A0A085NMZ6_9BILA/1-532      AC A0A085NMZ6.1
#=GS A0C9K3_PARTE/4-284          AC A0C9K3.1
#=GS G1LJZ5_AILME/265-454        AC G1LJZ5.1
#=GS M0TC77_MUSAM/7-287          AC M0TC77.1
#=GS A0A0V0SAW2_9BILA/300-494    AC A0A0V0SAW2.1
#=GS A0A194R1W6_PAPMA/370-498    AC A0A194R1W6.1
#=GS V8PDT8_OPHHA/177-373        AC V8PDT8.1
#=GS V6TPQ5_GIAIN/5-683          AC V6TPQ5.1
#=GS A0A078GRB5_BRANA/255-489    AC A0A078GRB5.1
#=GS A0A0V0UDG4_9BILA/17-321     AC A0A0V0UDG4.1
#=GS T1GL44_MEGSC/8-98           AC T1GL44.1
#=GS A9THA1_PHYPA/1-498          AC A9THA1.1
#=GS H2Z9D4_CIOSA/388-528        AC H2Z9D4.1
#=GS F6TEM6_XENTR/238-425        AC F6TEM6.1
#=GS A0A067RPE4_ZOONE/1-467      AC A0A067RPE4.1
#=GS D6X3S1_TRICA/21-489         AC D6X3S1.2
#=GS H3C250_TETNG/15-290         AC H3C250.1
#=GS M1V9R7_CYAM1/7-685          AC M1V9R7.1
#=GS A0A093ENI5_TYTAL/1-253      AC A0A093ENI5.1
#=GS LMBD1_CHICK/11-425          AC Q5ZI05.1
#=GS A0A0D8Y4R4_DICVI/230-429    AC A0A0D8Y4R4.1
#=GS A0A061HHU8_BLUGR/7-424      AC A0A061HHU8.1
#=GS W5MLV2_LEPOC/261-456        AC W5MLV2.1
#=GS G1S839_NOMLE/21-258         AC G1S839.1
#=GS A0A074WTL6_9PEZI/9-288      AC A0A074WTL6.1
#=GS A0A0L0F9E7_9EUKA/1-183      AC A0A0L0F9E7.1
#=GS A0A091U0T0_PHORB/10-345     AC A0A091U0T0.1
#=GS A0A0D2ZQ42_BRAOL/66-571     AC A0A0D2ZQ42.1
#=GS C3Z9N3_BRAFL/21-302         AC C3Z9N3.1
#=GS A0A0E0A4F1_9ORYZ/152-420    AC A0A0E0A4F1.1
#=GS A0A093XMZ5_9PEZI/9-517      AC A0A093XMZ5.1
#=GS B7PTH3_IXOSC/2-130          AC B7PTH3.1
#=GS A0A162TZ88_PHYB8/8-244      AC A0A162TZ88.1
#=GS I7LVW9_TETTS/45-592         AC I7LVW9.2
#=GS A0A0K0E8C6_STRER/29-504     AC A0A0K0E8C6.1
#=GS U3JWP7_FICAL/18-270         AC U3JWP7.1
#=GS W5QC73_SHEEP/39-276         AC W5QC73.1
#=GS H9IZ10_BOMMO/1-200          AC H9IZ10.1
#=GS A0A0D2ISY0_9EURO/7-512      AC A0A0D2ISY0.1
#=GS Q178R5_AEDAE/1-531          AC Q178R5.1
#=GS T1EDW8_HELRO/1-606          AC T1EDW8.1
#=GS W5KPQ5_ASTMX/11-429         AC W5KPQ5.1
#=GS A0A0N5C2B5_STREA/35-522     AC A0A0N5C2B5.1
#=GS A0A162S663_9CRUS/261-458    AC A0A162S663.1
#=GS A0A0B1P2P9_UNCNE/10-450     AC A0A0B1P2P9.1
#=GS A0A074YT45_9PEZI/9-288      AC A0A074YT45.1
#=GS A0A0E0PSX5_ORYRU/7-296      AC A0A0E0PSX5.1
#=GS Q86AH0_DICDI/92-715         AC Q86AH0.1
#=GS A2YAR5_ORYSI/194-693        AC A2YAR5.1
#=GS A0A0B2RA34_GLYSO/1-65       AC A0A0B2RA34.1
#=GS M3XAG4_FELCA/1-549          AC M3XAG4.1
#=GS B8B1Y6_ORYSI/276-490        AC B8B1Y6.1
#=GS A0A099Z070_TINGU/1-233      AC A0A099Z070.1
#=GS A0A0N4UJ24_DRAME/1-523      AC A0A0N4UJ24.1
#=GS A0A094GZD3_9PEZI/9-517      AC A0A094GZD3.1
#=GS A0A059D6K8_EUCGR/7-281      AC A0A059D6K8.1
#=GS A0A091SAV5_9GRUI/236-430    AC A0A091SAV5.1
#=GS A0A0B2VSX2_TOXCA/1-203      AC A0A0B2VSX2.1
#=GS A0A0A1U2G5_ENTIV/1-500      AC A0A0A1U2G5.1
#=GS A0A0N4YD02_NIPBR/21-509     AC A0A0N4YD02.1
#=GS W6LC00_9TRYP/252-462        AC W6LC00.1
#=GS G3RWF7_GORGO/21-258         AC G3RWF7.1
#=GS A0A0D2QC92_GOSRA/7-283      AC A0A0D2QC92.1
#=GS A0A096MCD8_POEFO/18-254     AC A0A096MCD8.1
#=GS H2RZ80_TAKRU/1-565          AC H2RZ80.1
#=GS A5K220_PLAVS/3-375          AC A5K220.1
#=GS A0A0D9VLA3_9ORYZ/389-459    AC A0A0D9VLA3.1
#=GS A0A093I445_STRCA/1-258      AC A0A093I445.1
#=GS L9JAB3_TUPCH/36-242         AC L9JAB3.1
#=GS A0A0N4ZXF9_PARTI/35-520     AC A0A0N4ZXF9.1
#=GS H2TMI4_TAKRU/18-289         AC H2TMI4.1
#=GS A0A0R3R4W6_9BILA/1-225      AC A0A0R3R4W6.1
#=GS M3WUU2_FELCA/17-295         AC M3WUU2.1
#=GS A0A165AAY8_DAUCA/7-289      AC A0A165AAY8.1
#=GS C1H239_PARBA/8-184          AC C1H239.1
#=GS A0A0D2G413_9EURO/23-304     AC A0A0D2G413.1
#=GS A0A0L9U4H6_PHAAN/278-489    AC A0A0L9U4H6.1
#=GS I1J7F8_SOYBN/1-208          AC I1J7F8.1
#=GS A0A168L3X6_MUCCL/8-274      AC A0A168L3X6.1
#=GS A0A015JBY3_9GLOM/25-498     AC A0A015JBY3.1
#=GS G5A2L2_PHYSP/6-285          AC G5A2L2.1
#=GS L9L4A9_TUPCH/105-281        AC L9L4A9.1
#=GS W7U3J0_9STRA/6-298          AC W7U3J0.1
#=GS M3YEA5_MUSPF/132-327        AC M3YEA5.1
#=GS A0A183H8N3_9BILA/1-315      AC A0A183H8N3.1
#=GS B9HF82_POPTR/1-308          AC B9HF82.2
#=GS H0WVW0_OTOGA/1-549          AC H0WVW0.1
#=GS A0A0V1PP42_9BILA/295-491    AC A0A0V1PP42.1
#=GS G2X8J5_VERDV/11-296         AC G2X8J5.1
#=GS W7XH58_TETTS/4-284          AC W7XH58.1
#=GS W9Z122_9EURO/6-513          AC W9Z122.1
#=GS A0A0N0VEY7_9TRYP/3-268      AC A0A0N0VEY7.1
#=GS T1KBK3_TETUR/1-589          AC T1KBK3.1
#=GS F1QF10_DANRE/15-303         AC F1QF10.1
#=GS A0A016X015_9BILA/96-652     AC A0A016X015.1
#=GS A0A091NL89_9PASS/1-251      AC A0A091NL89.1
#=GS F0YMP9_AURAN/97-305         AC F0YMP9.1
#=GS A0A162PI18_9PEZI/77-584     AC A0A162PI18.1
#=GS A0A091WSI8_OPIHO/1-543      AC A0A091WSI8.1
#=GS J9IUZ8_9SPIT/319-430        AC J9IUZ8.1
#=GS A0A0W7VMU9_9HYPO/12-521     AC A0A0W7VMU9.1
#=GS W5PQV2_SHEEP/17-301         AC W5PQV2.1
#=GS A0A0S4J660_BODSA/5-62       AC A0A0S4J660.1
#=GS H2QT95_PANTR/14-296         AC H2QT95.1
#=GS F0ZM84_DICPU/129-363        AC F0ZM84.1
#=GS R0KDT8_SETT2/9-288          AC R0KDT8.1
#=GS LMBR1_MOUSE/19-280          AC Q9JIT0.1
#=GS A0A0J8TYI2_COCIT/15-520     AC A0A0J8TYI2.1
#=GS F7VUP2_SORMK/19-459         AC F7VUP2.1
#=GS W1PXU2_AMBTC/7-117          AC W1PXU2.1
#=GS N1JIG2_BLUG1/11-538         AC N1JIG2.1
#=GS A0A094BDQ5_9PEZI/7-283      AC A0A094BDQ5.1
#=GS H2PJI5_PONAB/14-312         AC H2PJI5.1
#=GS LMBD1_ASPCL/9-292           AC A1C3U0.1
#=GS A0A087Y3C3_POEFO/13-434     AC A0A087Y3C3.2
#=GS A2DZN6_TRIVA/1-373          AC A2DZN6.1
#=GS LMBD1_ASPTN/8-281           AC Q0D219.1
#=GS H2PP58_PONAB/255-450        AC H2PP58.2
#=GS A0A0B2W2B7_TOXCA/1-448      AC A0A0B2W2B7.1
#=GS B9IG94_POPTR/7-489          AC B9IG94.1
#=GS A0A152A0M6_9MYCE/4-536      AC A0A152A0M6.1
#=GS A0A0E0PSX7_ORYRU/7-173      AC A0A0E0PSX7.1
#=GS A0A0V0UEA2_9BILA/17-221     AC A0A0V0UEA2.1
#=GS R0H6J8_9BRAS/264-489        AC R0H6J8.1
#=GS V9ESJ5_PHYPR/259-492        AC V9ESJ5.1
#=GS Q38BH4_TRYB2/233-458        AC Q38BH4.1
#=GS A0A0V1G3E6_TRIPS/278-474    AC A0A0V1G3E6.1
#=GS H2U0U9_TAKRU/15-298         AC H2U0U9.1
#=GS W5DPE6_WHEAT/71-290         AC W5DPE6.1
#=GS A0A0K9PHL6_ZOSMR/1-498      AC A0A0K9PHL6.1
#=GS S9YQI3_CAMFR/558-747        AC S9YQI3.1
#=GS K6VEJ7_9APIC/1-227          AC K6VEJ7.1
#=GS D7FRZ6_ECTSI/216-426        AC D7FRZ6.1
#=GS A0A017SRA6_9EURO/10-516     AC A0A017SRA6.1
#=GS A0A0A1UA87_ENTIV/2-293      AC A0A0A1UA87.1
#=GS F6PPP6_XENTR/20-277         AC F6PPP6.1
#=GS Q7RYT2_NEUCR/11-524         AC Q7RYT2.1
#=GS A4I583_LEIIN/3-492          AC A4I583.1
#=GS A0A091T957_PHALP/1-135      AC A0A091T957.1
#=GS A0A0L7K3V7_9NEOP/48-236     AC A0A0L7K3V7.1
#=GS A0A087YCR1_POEFO/18-260     AC A0A087YCR1.2
#=GS A0A0V1DG27_TRIBR/278-474    AC A0A0V1DG27.1
#=GS A0A0A0AD03_CHAVO/1-244      AC A0A0A0AD03.1
#=GS A0A0D2XP30_FUSO4/10-444     AC A0A0D2XP30.1
#=GS A0A0N7KG47_ORYSJ/1-498      AC A0A0N7KG47.1
#=GS B6ABV5_CRYMR/1-545          AC B6ABV5.1
#=GS E9GHZ5_DAPPU/1-549          AC E9GHZ5.1
#=GS A0A0F8CMM0_LARCR/1-555      AC A0A0F8CMM0.1
#=GS A0A0N4TXI4_BRUPA/218-778    AC A0A0N4TXI4.1
#=GS G3PJK1_GASAC/1-547          AC G3PJK1.1
#=GS A0A0N0NJF9_9EURO/6-505      AC A0A0N0NJF9.1
#=GS A0A091Q646_LEPDC/1-324      AC A0A091Q646.1
#=GS A0A0D9R2B5_CHLSB/10-254     AC A0A0D9R2B5.1
#=GS M2M0Y9_BAUCO/8-517          AC M2M0Y9.1
#=GS A0A0Q3LTL4_AMAAE/12-425     AC A0A0Q3LTL4.1
#=GS A7RHN0_NEMVE/282-415        AC A7RHN0.1
#=GS A0A0B4GLQ0_9HYPO/10-288     AC A0A0B4GLQ0.1
#=GS G7XSP7_ASPKW/10-515         AC G7XSP7.1
#=GS A7EPQ3_SCLS1/12-521         AC A7EPQ3.1
#=GS A0A0F8TYT6_9EURO/49-463     AC A0A0F8TYT6.1
#=GS M3YUD5_MUSPF/1-549          AC M3YUD5.1
#=GS H2TMI6_TAKRU/18-287         AC H2TMI6.1
#=GS A0A0D2NSN4_9CHLO/1-488      AC A0A0D2NSN4.1
#=GS A0A0D2T025_GOSRA/258-486    AC A0A0D2T025.1
#=GS J3MAX0_ORYBR/18-290         AC J3MAX0.1
#=GS A0A0N4UWV7_ENTVE/20-220     AC A0A0N4UWV7.1
#=GS A6QRZ3_AJECN/1-300          AC A6QRZ3.1
#=GS W6UTP0_ECHGR/1-582          AC W6UTP0.1
#=GS LMBR1_HUMAN/19-283          AC Q8WVP7.1
#=GS A0A0V1N722_9BILA/278-474    AC A0A0V1N722.1
#=GS W2SAP8_9EURO/6-504          AC W2SAP8.1
#=GS A0A068XK93_HYMMI/1-466      AC A0A068XK93.1
#=GS L5JN34_PTEAL/1-272          AC L5JN34.1
#=GS K7HF71_CAEJA/11-311         AC K7HF71.1
#=GS G5E7N9_MELGA/1-567          AC G5E7N9.1
#=GS A0A0A1V169_9HYPO/12-521     AC A0A0A1V169.1
#=GS G3RZN2_GORGO/1-469          AC G3RZN2.1
#=GS C1G0Y5_PARBD/15-521         AC C1G0Y5.2
#=GS I0Z8K5_COCSC/6-288          AC I0Z8K5.1
#=GS A0CD62_PARTE/3-294          AC A0CD62.1
#=GS K1PUC8_CRAGI/19-101         AC K1PUC8.1
#=GS A0DTG9_PARTE/34-299         AC A0DTG9.1
#=GS A0A094JRF1_9PEZI/7-280      AC A0A094JRF1.1
#=GS A0A068Y377_ECHMU/1-475      AC A0A068Y377.1
#=GS A0A0R4IDU5_DANRE/17-269     AC A0A0R4IDU5.1
#=GS L1JYU1_GUITH/1-742          AC L1JYU1.1
#=GS E5AAE6_LEPMJ/7-515          AC E5AAE6.1
#=GS S9X4V7_9TRYP/5-484          AC S9X4V7.1
#=GS V4RXD8_9ROSI/2-368          AC V4RXD8.1
#=GS B1N587_ENTHI/1-94           AC B1N587.1
#=GS D3B9Q3_POLPA/92-336         AC D3B9Q3.1
#=GS LMBD1_XENTR/11-430          AC Q0VGV9.1
#=GS X6NXG2_RETFI/68-362         AC X6NXG2.1
#=GS F1NWK3_CHICK/11-425         AC F1NWK3.2
#=GS M3ZGL4_XIPMA/1-370          AC M3ZGL4.1
#=GS B3LYA8_DROAN/22-502         AC B3LYA8.1
#=GS A2X9T7_ORYSI/1-498          AC A2X9T7.1
#=GS A0A091NV01_HALAL/1-401      AC A0A091NV01.1
#=GS LMBD1_DANRE/15-303          AC Q5PR61.1
#=GS G3AJ97_SPAPN/1-450          AC G3AJ97.1
#=GS A0A0A0L1B7_CUCSA/254-489    AC A0A0A0L1B7.1
#=GS A0A0R3PJV0_ANGCS/259-387    AC A0A0R3PJV0.1
#=GS A0A0L0HNW8_SPIPN/5-283      AC A0A0L0HNW8.1
#=GS H2U0U8_TAKRU/18-231         AC H2U0U8.1
#=GS F1SHV4_PIG/104-298          AC F1SHV4.2
#=GS F6VRJ9_ORNAN/2-92           AC F6VRJ9.2
#=GS M1C483_SOLTU/7-489          AC M1C483.1
#=GS A0A0D2BYN5_9EURO/1-404      AC A0A0D2BYN5.1
#=GS A0A074Y7U1_9PEZI/8-499      AC A0A074Y7U1.1
#=GS B6H1T5_PENRW/12-516         AC B6H1T5.1
#=GS A0A072PJA8_9EURO/11-452     AC A0A072PJA8.1
#=GS A0A0G2E0X0_9EURO/25-462     AC A0A0G2E0X0.1
#=GS H3BI81_LATCH/301-415        AC H3BI81.1
#=GS W7X5T3_TETTS/268-478        AC W7X5T3.1
#=GS W5JHZ1_ANODA/1-330          AC W5JHZ1.1
#=GS A0A059LEH9_9CHLO/59-222     AC A0A059LEH9.1
#=GS I1KR08_SOYBN/8-455          AC I1KR08.2
#=GS A0A152A5T5_9MYCE/5-282      AC A0A152A5T5.1
#=GS A0A0M9G9Z2_9TRYP/10-230     AC A0A0M9G9Z2.1
#=GS D8MAK8_BLAHO/1-376          AC D8MAK8.1
#=GS A0A094DIQ0_9PEZI/9-517      AC A0A094DIQ0.1
#=GS A0A194R1W6_PAPMA/514-878    AC A0A194R1W6.1
#=GS A0A087GEA9_ARAAL/1-500      AC A0A087GEA9.1
#=GS W7A8S4_9APIC/5-253          AC W7A8S4.1
#=GS G0SCW1_CHATD/12-291         AC G0SCW1.1
#=GS A0A094C8I0_9PEZI/9-517      AC A0A094C8I0.1
#=GS W4YYE7_STRPU/234-429        AC W4YYE7.1
#=GS A0A151GM29_9HYPO/10-292     AC A0A151GM29.1
#=GS J3LH96_ORYBR/1-498          AC J3LH96.1
#=GS C4LUH4_ENTHI/1-483          AC C4LUH4.1
#=GS A0A059J3X4_9EURO/6-518      AC A0A059J3X4.1
#=GS F0ZT63_DICPU/1-518          AC F0ZT63.1
#=GS A0A135S0T7_9PEZI/12-517     AC A0A135S0T7.1
#=GS A0A0B1SCW3_OESDE/1-151      AC A0A0B1SCW3.1
#=GS A0A164KP55_9CRUS/14-306     AC A0A164KP55.1
#=GS A0A067FC00_CITSI/1-363      AC A0A067FC00.1
#=GS G0WI06_NAUDC/59-626         AC G0WI06.1
#=GS E0VEJ2_PEDHC/1-541          AC E0VEJ2.1
#=GS LMBD2_DROPS/1-543           AC Q29BL9.1
#=GS B6Q645_TALMQ/20-526         AC B6Q645.1
#=GS H2TMI5_TAKRU/256-452        AC H2TMI5.1
#=GS A0A154PLC9_9HYME/1-467      AC A0A154PLC9.1
#=GS S9X2V2_CAMFR/10-400         AC S9X2V2.1
#=GS A0A0J8C472_BETVU/1-494      AC A0A0J8C472.1
#=GS A0A0A2LBL6_PENIT/12-516     AC A0A0A2LBL6.1
#=GS D8TFX8_SELML/227-378        AC D8TFX8.1
#=GS B4JEL2_DROGR/1-553          AC B4JEL2.1
#=GS W5J515_ANODA/1-286          AC W5J515.1
#=GS I3JF56_ORENI/262-458        AC I3JF56.1
#=GS J9I4D2_9SPIT/56-459         AC J9I4D2.1
#=GS A0A091EYW9_CORBR/1-419      AC A0A091EYW9.1
#=GS G1T1K4_RABIT/266-454        AC G1T1K4.2
#=GS F0ZKX1_DICPU/35-557         AC F0ZKX1.1
#=GS A0A0D2RYB8_GOSRA/55-290     AC A0A0D2RYB8.1
#=GS A0A152A5T5_9MYCE/255-477    AC A0A152A5T5.1
#=GS C5L569_PERM5/3-158          AC C5L569.1
#=GS B8CB15_THAPS/2-587          AC B8CB15.1
#=GS A0A091N1M3_CARIC/1-543      AC A0A091N1M3.1
#=GS A0A024G716_9STRA/264-493    AC A0A024G716.1
#=GS M0XVI8_HORVD/2-246          AC M0XVI8.1
#=GS A0A024G716_9STRA/6-300      AC A0A024G716.1
#=GS W2YYJ2_PHYPR/30-269         AC W2YYJ2.1
#=GS A0A167R993_PHYB8/12-531     AC A0A167R993.1
#=GS F7HSP4_MACMU/239-430        AC F7HSP4.1
#=GS E7F4M0_DANRE/256-451        AC E7F4M0.1
#=GS A0A151U989_CAJCA/1-498      AC A0A151U989.1
#=GS A0A0J8QQW9_COCIT/8-290      AC A0A0J8QQW9.1
#=GS A9T3A3_PHYPA/248-494        AC A9T3A3.1
#=GS A0A0D3BEU5_BRAOL/1-500      AC A0A0D3BEU5.1
#=GS A0A139A5W5_GONPR/303-899    AC A0A139A5W5.1
#=GS I3LY14_ICTTR/10-189         AC I3LY14.1
#=GS F7EIH1_MACMU/48-254         AC F7EIH1.1
#=GS H3A135_LATCH/13-431         AC H3A135.1
#=GS D8LWX9_BLAHO/3-204          AC D8LWX9.1
#=GS D8RQM8_SELML/2-117          AC D8RQM8.1
#=GS A0A0L0SUU4_ALLMA/5-197      AC A0A0L0SUU4.1
#=GS A0A087SNX6_AUXPR/1-494      AC A0A087SNX6.1
#=GS V6LJ83_9EUKA/8-501          AC V6LJ83.1
#=GS A0A0M8P851_9EURO/9-289      AC A0A0M8P851.1
#=GS F4Q3L8_DICFS/7-286          AC F4Q3L8.1
#=GS A0A091EGZ0_CORBR/1-251      AC A0A091EGZ0.1
#=GS U3JBQ9_FICAL/1-237          AC U3JBQ9.1
#=GS M0XVI3_HORVD/1-210          AC M0XVI3.1
#=GS G2YPM4_BOTF4/8-288          AC G2YPM4.1
#=GS Q7QC62_ANOGA/1-533          AC Q7QC62.2
#=GS G1T1A0_RABIT/1-549          AC G1T1A0.1
#=GS D8LZF9_BLAHO/1-222          AC D8LZF9.1
#=GS H2PP58_PONAB/19-283         AC H2PP58.2
#=GS F7GNC9_MACMU/18-189         AC F7GNC9.1
#=GS LMBD1_EMENI/9-290           AC Q5BDG8.2
#=GS A0A0V0VXX3_9BILA/262-491    AC A0A0V0VXX3.1
#=GS H1W5W2_COLHI/12-508         AC H1W5W2.1
#=GS A0A0K9PIC2_ZOSMR/7-283      AC A0A0K9PIC2.1
#=GS G1TAQ0_RABIT/19-289         AC G1TAQ0.2
#=GS R1EZ49_BOTPV/22-533         AC R1EZ49.1
#=GS A0A0C4DSY7_MAGP6/24-540     AC A0A0C4DSY7.1
#=GS A0A0R3UEC6_9CEST/1-432      AC A0A0R3UEC6.2
#=GS W2RKV9_9EURO/31-328         AC W2RKV9.1
#=GS W5L0L8_ASTMX/18-270         AC W5L0L8.1
#=GS J9JM02_ACYPI/1-531          AC J9JM02.1
#=GS K4CQ21_SOLLC/259-489        AC K4CQ21.1
#=GS H2YCM9_CIOSA/1-70           AC H2YCM9.1
#=GS A0A026W6A3_CERBI/1-535      AC A0A026W6A3.1
#=GS B9T8F4_RICCO/4-419          AC B9T8F4.1
#=GS I7MIP6_TETTS/67-577         AC I7MIP6.2
#=GS A0A0K8L2G2_9EURO/1-227      AC A0A0K8L2G2.1
#=GS V4SG42_9ROSI/1-502          AC V4SG42.1
#=GS A0A0G4PPZ5_PENCA/9-289      AC A0A0G4PPZ5.1
#=GS F1PDI3_CANLF/260-450        AC F1PDI3.2
#=GS W5G7F4_WHEAT/1-390          AC W5G7F4.1
#=GS W5NKC1_LEPOC/14-431         AC W5NKC1.1
#=GS B4HHK5_DROSE/22-500         AC B4HHK5.1
#=GS H2RTB6_TAKRU/1-358          AC H2RTB6.1
#=GS A0A091UCC9_PHORB/237-389    AC A0A091UCC9.1
#=GS A0A0K9R921_SPIOL/7-284      AC A0A0K9R921.1
#=GS H9GMJ5_ANOCA/1-237          AC H9GMJ5.1
#=GS H2M439_ORYLA/61-254         AC H2M439.1
#=GS S9VB43_9TRYP/4-486          AC S9VB43.1
#=GS A0A044QZ47_ONCVO/1-540      AC A0A044QZ47.1
#=GS Q5B5G9_EMENI/10-516         AC Q5B5G9.1
#=GS H3AKE0_LATCH/248-445        AC H3AKE0.2
#=GS W7K1J5_PLAFA/1-125          AC W7K1J5.1
#=GS H3GLP4_PHYRM/6-278          AC H3GLP4.1
#=GS A0A0V0TA56_9BILA/1-534      AC A0A0V0TA56.1
#=GS LMBD1_COCIM/8-292           AC Q1E5A9.1
#=GS G1MA14_AILME/13-284         AC G1MA14.1
#=GS C6HG11_AJECH/8-292          AC C6HG11.1
#=GS A0A093ENI5_TYTAL/235-430    AC A0A093ENI5.1
#=GS A0A067CRQ4_SAPPC/1-480      AC A0A067CRQ4.1
#=GS A0A061DHT9_THECC/1-501      AC A0A061DHT9.1
#=GS A0A183AKW6_9TREM/1-229      AC A0A183AKW6.1
#=GS W5HIS2_WHEAT/1-201          AC W5HIS2.1
#=GS A0A087ZQT2_APIME/17-487     AC A0A087ZQT2.1
#=GS D2VMX3_NAEGR/3-466          AC D2VMX3.1
#=GS N1QCI8_PSEFD/8-511          AC N1QCI8.1
#=GS H0UZU8_CAVPO/21-257         AC H0UZU8.1
#=GS A0A0D1XPB8_9EURO/26-303     AC A0A0D1XPB8.1
#=GS F1P229_CHICK/238-437        AC F1P229.2
#=GS LMBRL_HUMAN/21-258          AC Q6UX01.2
#=GS A0A094KVM8_ANTCR/1-543      AC A0A094KVM8.1
#=GS C5M8D4_CANTT/1-469          AC C5M8D4.1
#=GS K6UDX7_9APIC/1-368          AC K6UDX7.1
#=GS A0A0M0K090_9EUKA/1-594      AC A0A0M0K090.1
#=GS A0A0K8LNR4_9EURO/12-517     AC A0A0K8LNR4.1
#=GS I1G014_AMPQE/274-473        AC I1G014.1
#=GS A0A0C2CPW6_9BILA/80-153     AC A0A0C2CPW6.1
#=GS A0A091E0N6_FUKDA/258-428    AC A0A091E0N6.1
#=GS A0A0V0R074_PSEPJ/55-315     AC A0A0V0R074.1
#=GS A0A094ICI2_9PEZI/9-517      AC A0A094ICI2.1
#=GS H3C250_TETNG/270-470        AC H3C250.1
#=GS J9IUZ8_9SPIT/1-328          AC J9IUZ8.1
#=GS A0A162S663_9CRUS/17-276     AC A0A162S663.1
#=GS A0A0B2PEI2_GLYSO/182-417    AC A0A0B2PEI2.1
#=GS A0A0M0JJY9_9EUKA/260-462    AC A0A0M0JJY9.1
#=GS M3Y2U5_MUSPF/17-296         AC M3Y2U5.1
#=GS S7Q1C5_MYOBR/266-454        AC S7Q1C5.1
#=GS H0VSI2_CAVPO/10-260         AC H0VSI2.1
#=GS Q4CQJ4_TRYCC/5-258          AC Q4CQJ4.1
#=GS E1BMA6_BOVIN/21-258         AC E1BMA6.1
#=GS V4AH51_LOTGI/1-551          AC V4AH51.1
#=GS A0A0B1TCG4_OESDE/1-317      AC A0A0B1TCG4.1
#=GS D5GHQ4_TUBMM/7-295          AC D5GHQ4.1
#=GS G8YLX6_PICSO/1-500          AC G8YLX6.1
#=GS U1NQR3_ASCSU/325-463        AC U1NQR3.1
#=GS Q2UU34_ASPOR/10-515         AC Q2UU34.1
#=GS M4ELR2_BRARP/7-282          AC M4ELR2.1
#=GS A0A0B1SDQ3_OESDE/1-138      AC A0A0B1SDQ3.1
#=GS D8S063_SELML/6-295          AC D8S063.1
#=GS D3AWV5_POLPA/9-269          AC D3AWV5.1
#=GS H2N1Q2_ORYLA/2-52           AC H2N1Q2.1
#=GS A0A091RPA3_NESNO/1-262      AC A0A091RPA3.1
#=GS A0A0E9NN97_9ASCO/267-552    AC A0A0E9NN97.1
#=GS T0S3G9_9STRA/1-480          AC T0S3G9.1
#=GS A0A087SVS0_9ARAC/54-248     AC A0A087SVS0.1
#=GS F6QP61_ORNAN/12-311         AC F6QP61.1
#=GS A0A094IBE4_9PEZI/41-318     AC A0A094IBE4.1
#=GS U7PPJ3_SPOS1/9-288          AC U7PPJ3.1
#=GS H2M442_ORYLA/18-274         AC H2M442.1
#=GS A0A0V0X958_9BILA/278-474    AC A0A0V0X958.1
#=GS A2DVC1_TRIVA/3-485          AC A2DVC1.1
#=GS F7I499_CALJA/21-258         AC F7I499.1
#=GS A0A0P7Y997_9TELE/238-447    AC A0A0P7Y997.1
#=GS C4Y1K6_CLAL4/1-497          AC C4Y1K6.1
#=GS F1MNF0_BOVIN/19-283         AC F1MNF0.2
#=GS A0A0V0SAW2_9BILA/38-305     AC A0A0V0SAW2.1
#=GS F8VZU8_HUMAN/28-141         AC F8VZU8.1
#=GS M4A9N0_XIPMA/259-452        AC M4A9N0.1
#=GS T1GSH4_MEGSC/1-71           AC T1GSH4.1
#=GS F4PEK0_BATDJ/9-423          AC F4PEK0.1
#=GS S7N6H8_MYOBR/1-517          AC S7N6H8.1
#=GS F7C803_CALJA/277-491        AC F7C803.1
#=GS K4C1I0_SOLLC/1-498          AC K4C1I0.1
#=GS A0A0L8I8F5_OCTBM/1-252      AC A0A0L8I8F5.1
#=GS G1KKY1_ANOCA/257-449        AC G1KKY1.1
#=GS A0A0D2FXT2_9EURO/6-511      AC A0A0D2FXT2.1
#=GS A0A0W8CPS3_PHYNI/1-543      AC A0A0W8CPS3.1
#=GS A0A091UP90_NIPNI/240-430    AC A0A091UP90.1
#=GS I1N2X4_SOYBN/7-293          AC I1N2X4.1
#=GS A0A016X1Q1_9BILA/1-92       AC A0A016X1Q1.1
#=GS A0A0M0K4G1_9EUKA/1-282      AC A0A0M0K4G1.1
#=GS A1D422_NEOFI/12-517         AC A1D422.1
#=GS F1SHV3_PIG/7-93             AC F1SHV3.2
#=GS A0A091L547_CATAU/1-254      AC A0A091L547.1
#=GS F1SJ09_PIG/267-455          AC F1SJ09.1
#=GS A0A0B2W2B7_TOXCA/446-787    AC A0A0B2W2B7.1
#=GS A0A094AXV1_9PEZI/8-291      AC A0A094AXV1.1
#=GS W4FRF3_9STRA/1-522          AC W4FRF3.1
#=GS A0A0D3BAG8_BRAOL/7-282      AC A0A0D3BAG8.1
#=GS F1SHV4_PIG/1-128            AC F1SHV4.2
#=GS J9JKY1_ACYPI/1-527          AC J9JKY1.2
#=GS A0A091CWM4_FUKDA/1-400      AC A0A091CWM4.1
#=GS A0A0N4TKE5_BRUPA/266-443    AC A0A0N4TKE5.1
#=GS A0A0B2Q908_GLYSO/12-168     AC A0A0B2Q908.1
#=GS LMBD1_SCLS1/8-284           AC A7F2V9.1
#=GS A0A135L8D1_PENPA/12-516     AC A0A135L8D1.1
#=GS V7ANU4_PHAVU/7-296          AC V7ANU4.1
#=GS M0XVI6_HORVD/1-102          AC M0XVI6.1
#=GS A0A072TUD0_MEDTR/1-368      AC A0A072TUD0.1
#=GS A7TBJ7_NEMVE/1-87           AC A7TBJ7.1
#=GS LMBD1_ASPOR/8-302           AC Q2TZ20.1
#=GS A0A0M3JUL8_ANISI/1-578      AC A0A0M3JUL8.1
#=GS D7TH73_VITVI/7-282          AC D7TH73.1
#=GS A0A091FTV2_9AVES/208-399    AC A0A091FTV2.1
#=GS A0A075AVI8_9FUNG/250-479    AC A0A075AVI8.1
#=GS U3J8Y3_ANAPL/12-428         AC U3J8Y3.1
#=GS E1FXZ4_LOALO/254-444        AC E1FXZ4.2
#=GS D8S063_SELML/273-502        AC D8S063.1
#=GS A0A161WJI1_9PEZI/12-519     AC A0A161WJI1.1
#=GS A0A162VPI4_DIDRA/9-299      AC A0A162VPI4.1
#=GS I3MC97_ICTTR/266-454        AC I3MC97.1
#=GS F1PDI3_CANLF/19-280         AC F1PDI3.2
#=GS A0A0U4ZES5_9EURO/8-446      AC A0A0U4ZES5.1
#=GS A0A0D2FF67_9EURO/11-291     AC A0A0D2FF67.1
#=GS A0A0V0QTL2_PSEPJ/372-460    AC A0A0V0QTL2.1
#=GS T1K5N2_TETUR/268-465        AC T1K5N2.1
#=GS G6D6E7_DANPL/18-457         AC G6D6E7.1
#=GS G3TCT8_LOXAF/1-549          AC G3TCT8.1
#=GS B4GPD4_DROPE/8-143          AC B4GPD4.1
#=GS D8UFC0_VOLCA/1-516          AC D8UFC0.1
#=GS A0A0V1PNT5_9BILA/17-246     AC A0A0V1PNT5.1
#=GS G8ZNA0_TORDC/1-509          AC G8ZNA0.1
#=GS A0A0G2FW92_9PEZI/1-359      AC A0A0G2FW92.1
#=GS A0A151T908_CAJCA/7-294      AC A0A151T908.1
#=GS A0A166WQZ4_9HYPO/12-297     AC A0A166WQZ4.1
#=GS A0A0L1ILA7_ASPNO/7-287      AC A0A0L1ILA7.1
#=GS I2H951_TETBL/1-521          AC I2H951.1
#=GS V4Z3T5_TOXGV/256-506        AC V4Z3T5.1
#=GS X6NGI6_RETFI/20-273         AC X6NGI6.1
#=GS S9VHT0_9TRYP/5-250          AC S9VHT0.1
#=GS A0A194RMG5_PAPMA/18-496     AC A0A194RMG5.1
#=GS A0A151PD13_ALLMI/255-449    AC A0A151PD13.1
#=GS A0A0V0UFA9_9BILA/17-238     AC A0A0V0UFA9.1
#=GS G1T1K4_RABIT/21-258         AC G1T1K4.2
#=GS J3QM78_MOUSE/19-110         AC J3QM78.1
#=GS R7YNT1_CONA1/6-513          AC R7YNT1.1
#=GS U5GEL0_POPTR/1-497          AC U5GEL0.1
#=GS A0A0D1YJP2_9EURO/6-508      AC A0A0D1YJP2.1
#=GS A0A0V1LNN6_9BILA/278-474    AC A0A0V1LNN6.1
#=GS H2M441_ORYLA/266-451        AC H2M441.1
#=GS S7ZGH5_PENO1/12-519         AC S7ZGH5.1
#=GS W5N502_LEPOC/193-565        AC W5N502.1
#=GS A0A0K9RI29_SPIOL/1-487      AC A0A0K9RI29.1
#=GS A0A0L9SM62_9HYPO/11-291     AC A0A0L9SM62.1
#=GS A0A067F0B8_CITSI/1-180      AC A0A067F0B8.1
#=GS A0A091T957_PHALP/114-310    AC A0A091T957.1
#=GS E3RLL0_PYRTT/9-287          AC E3RLL0.1
#=GS A0A075AVI8_9FUNG/4-282      AC A0A075AVI8.1
#=GS A0A0V0SAW7_9BILA/20-258     AC A0A0V0SAW7.1
#=GS W5K7B3_ASTMX/1-73           AC W5K7B3.1
#=GS A0A087H828_ARAAL/261-489    AC A0A087H828.1
#=GS A8XT56_CAEBR/66-691         AC A8XT56.2
#=GS A0A0D2D0S2_9EURO/29-309     AC A0A0D2D0S2.1
#=GS L1JX39_GUITH/1-243          AC L1JX39.1
#=GS N4TNL1_FUSC1/12-523         AC N4TNL1.1
#=GS S7Q1C5_MYOBR/21-258         AC S7Q1C5.1
#=GS C1E8L4_MICCC/6-516          AC C1E8L4.1
#=GS G3NXX4_GASAC/1-378          AC G3NXX4.1
#=GS A0A093IM86_EURHL/1-278      AC A0A093IM86.1
#=GS G3RWF7_GORGO/267-455        AC G3RWF7.1
#=GS E9IEG0_SOLIN/1-470          AC E9IEG0.1
#=GS G1KKY1_ANOCA/18-283         AC G1KKY1.1
#=GS U6LIJ2_9EIME/5-422          AC U6LIJ2.1
#=GS A0A016TBE3_9BILA/18-140     AC A0A016TBE3.1
#=GS H0Y6V6_HUMAN/17-489         AC H0Y6V6.1
#=GS A0A158NMK4_ATTCE/19-429     AC A0A158NMK4.1
#=GS LMD2B_DICDI/35-559          AC Q54TM2.1
#=GS A0C9K3_PARTE/267-479        AC A0C9K3.1
#=GS F6PPP6_XENTR/251-452        AC F6PPP6.1
#=GS F7CGT0_ORNAN/133-329        AC F7CGT0.2
#=GS A0A084G5F3_9PEZI/12-521     AC A0A084G5F3.1
#=GS M3K490_CANMX/1-494          AC M3K490.1
#=GS I1RLT7_GIBZE/11-291         AC I1RLT7.1
#=GS A0A150V682_9PEZI/6-514      AC A0A150V682.1
#=GS H6C8W4_EXODN/28-471         AC H6C8W4.1
#=GS A0A086TI02_ACRC1/12-520     AC A0A086TI02.1
#=GS A0A074Z7V6_9TREM/1-166      AC A0A074Z7V6.1
#=GS LMBD2_ARATH/7-282           AC Q9M028.1
#=GS A0A135SQR5_9PEZI/10-454     AC A0A135SQR5.1
#=GS T1J7X6_STRMM/327-523        AC T1J7X6.1
#=GS G3S2Q4_GORGO/1-266          AC G3S2Q4.1
#=GS L8GZR6_ACACA/252-439        AC L8GZR6.1
#=GS A0A059D690_EUCGR/7-489      AC A0A059D690.1
#=GS A0A091QJR5_MERNU/1-543      AC A0A091QJR5.1
#=GS F4PUU1_DICFS/290-500        AC F4PUU1.1
#=GS A0A091HYI9_BUCRH/1-135      AC A0A091HYI9.1
#=GS A0A0D3GC98_9ORYZ/7-172      AC A0A0D3GC98.1
#=GS A0A0F8X9C9_9EURO/11-517     AC A0A0F8X9C9.1
#=GS A0A0D3GC97_9ORYZ/264-490    AC A0A0D3GC97.1
#=GS A0A0N7L7K3_9STRA/266-492    AC A0A0N7L7K3.1
#=GS A5DQV4_PICGU/1-491          AC A5DQV4.2
#=GS A0A0L1HQF8_9PLEO/7-520      AC A0A0L1HQF8.1
#=GS A0A0D2T025_GOSRA/7-286      AC A0A0D2T025.1
#=GS V8P5A7_OPHHA/399-586        AC V8P5A7.1
#=GS A0A099P2U4_PICKU/1-434      AC A0A099P2U4.1
#=GS K7F4P0_PELSI/139-329        AC K7F4P0.1
#=GS A0A067F041_CITSI/2-258      AC A0A067F041.1
#=GS A0A084QXS7_9HYPO/15-523     AC A0A084QXS7.1
#=GS U9U671_RHIID/25-498         AC U9U671.1
#=GS LMBR1_XENTR/259-449         AC Q5U4X7.1
#=GS K8Z7F1_NANGC/60-234         AC K8Z7F1.1
#=GS B9SQ26_RICCO/262-489        AC B9SQ26.1
#=GS A0A177WD96_BATDE/5-399      AC A0A177WD96.1
#=GS LMBD2_DROME/1-543           AC Q8MRQ4.2
#=GS C1MYJ1_MICPC/7-300          AC C1MYJ1.1
#=GS A0A091RL07_MERNU/1-119      AC A0A091RL07.1
#=GS T1EFV7_HELRO/17-489         AC T1EFV7.1
#=GS C5FXD5_ARTOC/8-444          AC C5FXD5.1
#=GS A0A0S4IQ17_BODSA/268-412    AC A0A0S4IQ17.1
#=GS F6YTE9_XENTR/269-463        AC F6YTE9.1
#=GS A4I1F8_LEIIN/271-459        AC A4I1F8.1
#=GS A0A087SD16_AUXPR/1-293      AC A0A087SD16.1
#=GS W5HIL5_WHEAT/1-369          AC W5HIL5.1
#=GS A0A0J9UEF2_FUSO4/12-523     AC A0A0J9UEF2.1
#=GS A0A091VKD3_NIPNI/1-253      AC A0A091VKD3.1
#=GS A0A061ERE9_THECC/264-490    AC A0A061ERE9.1
#=GS A0A096UAJ8_MAIZE/1-309      AC A0A096UAJ8.1
#=GS J9EGZ1_WUCBA/1-242          AC J9EGZ1.1
#=GS F2UQH2_SALR5/2-532          AC F2UQH2.1
#=GS A0A093I445_STRCA/235-430    AC A0A093I445.1
#=GS A0A0V0UFA9_9BILA/276-508    AC A0A0V0UFA9.1
#=GS J3MCH0_ORYBR/1-498          AC J3MCH0.1
#=GS U6MA57_EIMMA/5-385          AC U6MA57.1
#=GS A0A094I2H9_9PEZI/9-517      AC A0A094I2H9.1
#=GS A0A0H1B791_9EURO/8-445      AC A0A0H1B791.1
#=GS A0A0A1U422_ENTIV/1-300      AC A0A0A1U422.1
#=GS A0DAS1_PARTE/119-599        AC A0DAS1.1
#=GS F0V8P3_NEOCL/4-284          AC F0V8P3.1
#=GS A0A0A0A6A0_CHAVO/1-409      AC A0A0A0A6A0.1
#=GS S8EK07_9LAMI/14-515         AC S8EK07.1
#=GS A0A151MM15_ALLMI/21-113     AC A0A151MM15.1
#=GS A0A0C2CUN6_9BILA/1-158      AC A0A0C2CUN6.1
#=GS A0A091M4R0_CARIC/5-152      AC A0A091M4R0.1
#=GS A0A0G0ANN7_TRIHA/12-521     AC A0A0G0ANN7.1
#=GS I1PZ58_ORYGL/264-490        AC I1PZ58.1
#=GS A0A0D9WLA6_9ORYZ/7-285      AC A0A0D9WLA6.1
#=GS A0A0K0EG52_STRER/1-534      AC A0A0K0EG52.1
#=GS A0A024UQP0_9STRA/2-340      AC A0A024UQP0.1
#=GS A0A0M3J320_ANISI/5-260      AC A0A0M3J320.1
#=GS A0A091K2Z2_COLST/1-544      AC A0A091K2Z2.1
#=GS A0A183T6I0_SCHSO/1-263      AC A0A183T6I0.1
#=GS A0A166I6P2_DAUCA/1-130      AC A0A166I6P2.1
#=GS A0A0F4GY77_9PEZI/20-530     AC A0A0F4GY77.1
#=GS I1K4H0_SOYBN/40-111         AC I1K4H0.1
#=GS A0A0H1BIR8_9EURO/14-520     AC A0A0H1BIR8.1
#=GS T0K7K3_COLGC/11-302         AC T0K7K3.1
#=GS A0A0D3GC98_9ORYZ/152-420    AC A0A0D3GC98.1
#=GS C5GJ09_AJEDR/8-442          AC C5GJ09.1
#=GS YC8B_SCHPO/56-501           AC O94599.1
#=GS A0A0B7NIN9_9FUNG/8-316      AC A0A0B7NIN9.1
#=GS G7J381_MEDTR/1-498          AC G7J381.1
#=GS V7CLR9_PHAVU/1-499          AC V7CLR9.1
#=GS A0A093GCW6_PICPB/1-238      AC A0A093GCW6.1
#=GS F9FVJ9_FUSOF/10-302         AC F9FVJ9.1
#=GS A0A0G4EWQ2_VITBC/15-457     AC A0A0G4EWQ2.1
#=GS M2QZB3_COCSN/7-520          AC M2QZB3.1
#=GS A0A0N4ZBT2_PARTI/1-534      AC A0A0N4ZBT2.1
#=GS L8G4Z0_PSED2/6-285          AC L8G4Z0.1
#=GS A0A0V0X982_9BILA/17-223     AC A0A0V0X982.1
#=GS A0A0F4Z6X1_9PEZI/9-297      AC A0A0F4Z6X1.1
#=GS U6GHR8_EIMAC/4-431          AC U6GHR8.1
#=GS H2RTB5_TAKRU/1-358          AC H2RTB5.1
#=GS B8BZW6_THAPS/5-504          AC B8BZW6.1
#=GS A9UWY4_MONBE/31-573         AC A9UWY4.1
#=GS A0A0V1LNN6_9BILA/17-284     AC A0A0V1LNN6.1
#=GS A0A077ZTY5_STYLE/5-438      AC A0A077ZTY5.1
#=GS A0A091I171_CALAN/1-255      AC A0A091I171.1
#=GS A0A151P8D5_ALLMI/1-148      AC A0A151P8D5.1
#=GS U1MHK2_ASCSU/20-284         AC U1MHK2.1
#=GS A0A0R3R4W6_9BILA/224-394    AC A0A0R3R4W6.1
#=GS R8BMY3_TOGMI/10-523         AC R8BMY3.1
#=GS G9N9Q6_HYPVG/12-521         AC G9N9Q6.1
#=GS S0DUT3_GIBF5/12-523         AC S0DUT3.1
#=GS K3XVJ1_SETIT/1-498          AC K3XVJ1.1
#=GS A0A087R6Z7_APTFO/235-425    AC A0A087R6Z7.1
#=GS A0A0V0ZLK8_9BILA/9-542      AC A0A0V0ZLK8.1
#=GS A0A177CHX3_9PLEO/7-513      AC A0A177CHX3.1
#=GS H2KU72_CLOSI/1-442          AC H2KU72.1
#=GS A4HE60_LEIBR/3-294          AC A4HE60.1
#=GS V7B442_PHAVU/7-489          AC V7B442.1
#=GS W2T8S1_NECAM/49-313         AC W2T8S1.1
#=GS A0A066Y1Q7_COLSU/12-519     AC A0A066Y1Q7.1
#=GS F9FB97_FUSOF/12-523         AC F9FB97.1
#=GS A0A091E0N6_FUKDA/13-258     AC A0A091E0N6.1
#=GS B4HKE2_DROSE/1-543          AC B4HKE2.1
#=GS A0A179TZK7_AJEDR/8-300      AC A0A179TZK7.1
#=GS M7Z4C2_TRIUA/1-498          AC M7Z4C2.1
#=GS M2V1X6_COCH5/9-286          AC M2V1X6.1
#=GS A0A0N4VJ82_ENTVE/1-508      AC A0A0N4VJ82.1
#=GS K2T0A3_MACPH/9-285          AC K2T0A3.1
#=GS A0A151Z805_9MYCE/1-501      AC A0A151Z805.1
#=GS G8BKC2_CANPC/2-496          AC G8BKC2.1
#=GS F0ZJQ2_DICPU/1-281          AC F0ZJQ2.1
#=GS A0CND7_PARTE/32-438         AC A0CND7.1
#=GS A0A0G4J512_PLABS/8-308      AC A0A0G4J512.1
#=GS K3VPU8_FUSPC/11-295         AC K3VPU8.1
#=GS C3YM55_BRAFL/3-554          AC C3YM55.1
#=GS G1XB73_ARTOA/9-287          AC G1XB73.1
#=GS A0A0B2P8L7_GLYSO/7-293      AC A0A0B2P8L7.1
#=GS A0A091EFK9_CORBR/1-543      AC A0A091EFK9.1
#=GS A0A0N1I533_LEPSE/4-242      AC A0A0N1I533.1
#=GS A2YAR5_ORYSI/1-187          AC A2YAR5.1
#=GS A0A0N4UWV7_ENTVE/328-509    AC A0A0N4UWV7.1
#=GS A0A0C4E517_MAGP6/9-452      AC A0A0C4E517.1
#=GS G8C0P7_TETPH/1-506          AC G8C0P7.1
#=GS LMD2B_DANRE/1-555           AC Q6P4P2.1
#=GS A0A0M9EWI6_9HYPO/11-292     AC A0A0M9EWI6.1
#=GS Q6C0H8_YARLI/2-483          AC Q6C0H8.1
#=GS A0A0M3KDV3_ANISI/1-138      AC A0A0M3KDV3.1
#=GS M3ZJT7_XIPMA/18-269         AC M3ZJT7.1
#=GS F7CR58_HORSE/1-548          AC F7CR58.1
#=GS B9HF82_POPTR/305-373        AC B9HF82.2
#=GS W6XTG0_COCCA/9-291          AC W6XTG0.1
#=GS I1JLF0_SOYBN/7-294          AC I1JLF0.1
#=GS A0A091HYI9_BUCRH/117-310    AC A0A091HYI9.1
#=GS A0A139WB21_TRICA/21-489     AC A0A139WB21.1
#=GS A0A0D2S5E0_GOSRA/110-347    AC A0A0D2S5E0.1
#=GS A0A0D2B4F9_9EURO/29-314     AC A0A0D2B4F9.1
#=GS A0A093Q834_PHACA/1-258      AC A0A093Q834.1
#=GS S7N9J0_MYOBR/67-526         AC S7N9J0.1
#=GS M4AR29_XIPMA/1-545          AC M4AR29.1
#=GS A0A096MXF9_PAPAN/267-455    AC A0A096MXF9.1
#=GS A0A183DP83_9BILA/1-119      AC A0A183DP83.1
#=GS A0A0M3HTB6_ASCLU/16-551     AC A0A0M3HTB6.2
#=GS U6KYM7_EIMTE/5-433          AC U6KYM7.1
#=GS LMBD1_ARATH/271-489         AC Q9SR93.2
#=GS A0A090L5N2_STRRB/29-517     AC A0A090L5N2.1
#=GS Q7QII1_ANOGA/21-489         AC Q7QII1.3
#=GS A0A087R6Z7_APTFO/1-252      AC A0A087R6Z7.1
#=GS A0A0G2JF18_MOUSE/1-100      AC A0A0G2JF18.1
#=GS M3ZJT7_XIPMA/254-450        AC M3ZJT7.1
#=GS M8AIM6_TRIUA/7-274          AC M8AIM6.1
#=GS D8RQN1_SELML/6-283          AC D8RQN1.1
#=GS K3X7A7_PYTUL/6-237          AC K3X7A7.1
#=GS C4M4T1_ENTHI/1-493          AC C4M4T1.1
#=GS U3IQ77_ANAPL/1-238          AC U3IQ77.1
#=GS G3WZL9_SARHA/243-442        AC G3WZL9.1
#=GS H3DN30_TETNG/1-556          AC H3DN30.1
#=GS LMBD1_PYRTR/9-443           AC B2WCU2.1
#=GS A0A091N2M6_9PASS/1-239      AC A0A091N2M6.1
#=GS F8VVE2_HUMAN/21-126         AC F8VVE2.8
#=GS L2FL56_COLGN/11-268         AC L2FL56.1
#=GS V5BHG9_TRYCR/5-205          AC V5BHG9.1
#=GS G1QH87_NOMLE/235-428        AC G1QH87.1
#=GS W7X5T3_TETTS/5-284          AC W7X5T3.1
#=GS U4U8Y8_DENPD/1-560          AC U4U8Y8.1
#=GS A0A183IFU2_9BILA/8-104      AC A0A183IFU2.1
#=GS A0A0N4YHF7_NIPBR/89-345     AC A0A0N4YHF7.1
#=GS A0A091IJI7_9AVES/212-403    AC A0A091IJI7.1
#=GS I2JSG8_DEKBR/1-495          AC I2JSG8.1
#=GS V4SUI2_9ROSI/7-285          AC V4SUI2.1
#=GS A0DTG9_PARTE/269-508        AC A0DTG9.1
#=GS H2Q5U8_PANTR/267-455        AC H2Q5U8.1
#=GS M7B8G2_CHEMY/5-382          AC M7B8G2.1
#=GS C9SY77_VERA1/11-303         AC C9SY77.1
#=GS F7C803_CALJA/19-319         AC F7C803.1
#=GS A0A183IFU3_9BILA/14-201     AC A0A183IFU3.1
#=GS F7HSP6_MACMU/1-132          AC F7HSP6.1
#=GS A0A091KT54_COLST/243-434    AC A0A091KT54.1
#=GS A0A158NS38_ATTCE/1-535      AC A0A158NS38.1
#=GS A0A183BTL8_GLOPA/348-496    AC A0A183BTL8.1
#=GS G5A514_PHYSP/1-546          AC G5A514.1
#=GS A0A0N5AL31_9BILA/19-497     AC A0A0N5AL31.1
#=GS A0A061E2A3_THECC/1-496      AC A0A061E2A3.1
#=GS G9PBM0_HYPAI/9-456          AC G9PBM0.1
#=GS X0BS30_FUSOX/10-294         AC X0BS30.1
#=GS A0A177DUB1_ALTAL/7-520      AC A0A177DUB1.1
#=GS A0A058ZCL4_9EUKA/1-399      AC A0A058ZCL4.1
#=GS A0A0L1KZN7_9EUGL/299-460    AC A0A0L1KZN7.1
#=GS G1QIG0_NOMLE/14-424         AC G1QIG0.1
#=GS F6X3W7_ORNAN/3-470          AC F6X3W7.1
#=GS G3RGG6_GORGO/1-470          AC G3RGG6.1
#=GS K1XBW7_MARBU/8-291          AC K1XBW7.1
#=GS A0A0V1DEN1_TRIBR/276-508    AC A0A0V1DEN1.1
#=GS S9VTE1_9TRYP/4-245          AC S9VTE1.1
#=GS A0A0N8JVF7_9TELE/22-282     AC A0A0N8JVF7.1
#=GS A0A087YL83_POEFO/1-545      AC A0A087YL83.2
#=GS A0A091L5F1_9GRUI/2-207      AC A0A091L5F1.1
#=GS A0A0E0L9E2_ORYPU/1-498      AC A0A0E0L9E2.1
#=GS A0A0A0AD03_CHAVO/244-435    AC A0A0A0AD03.1
#=GS H2N1Q1_ORYLA/1-142          AC H2N1Q1.1
#=GS H2U0U7_TAKRU/259-452        AC H2U0U7.1
#=GS A0A091NVF8_HALAL/240-430    AC A0A091NVF8.1
#=GS A0A099Z070_TINGU/252-438    AC A0A099Z070.1
#=GS A0A0L0DL76_THETB/5-278      AC A0A0L0DL76.1
#=GS G3P330_GASAC/254-453        AC G3P330.1
#=GS A0A059LHM2_9CHLO/57-179     AC A0A059LHM2.1
#=GS A0A091VL75_OPIHO/235-430    AC A0A091VL75.1
#=GS W7XA84_TETTS/1-513          AC W7XA84.1
#=GS A0A162RHV5_MUCCL/368-480    AC A0A162RHV5.1
#=GS A0A0A8LBW8_9SACH/1-447      AC A0A0A8LBW8.1
#=GS A0A072PFK8_9EURO/6-505      AC A0A072PFK8.1
#=GS A0A183DP83_9BILA/118-159    AC A0A183DP83.1
#=GS A0A139H7Z9_9PEZI/9-290      AC A0A139H7Z9.1
#=GS R0KR35_SETT2/7-520          AC R0KR35.1
#=GS W5N3Z3_LEPOC/249-449        AC W5N3Z3.1
#=GS A0A087G448_ARAAL/7-282      AC A0A087G448.1
#=GS B8B1Y6_ORYSI/7-296          AC B8B1Y6.1
#=GS W6KQQ3_9TRYP/5-265          AC W6KQQ3.1
#=GS M5WAH9_PRUPE/7-281          AC M5WAH9.1
#=GS C4JZG1_UNCRE/106-490        AC C4JZG1.1
#=GS F1SJ09_PIG/21-258           AC F1SJ09.1
#=GS A0A074WCA4_9PEZI/8-501      AC A0A074WCA4.1
#=GS D3BC73_POLPA/122-430        AC D3BC73.1
#=GS A0A0B0P4C6_GOSAR/7-287      AC A0A0B0P4C6.1
#=GS E9DSP4_METAQ/12-521         AC E9DSP4.1
#=GS C0NU62_AJECG/1-354          AC C0NU62.1
#=GS D3BC73_POLPA/1-97           AC D3BC73.1
#=GS A0A091K932_COLST/233-389    AC A0A091K932.1
#=GS D7L7P3_ARALL/7-281          AC D7L7P3.1
#=GS A0A093Q834_PHACA/234-430    AC A0A093Q834.1
#=GS W6MIP1_9ASCO/70-590         AC W6MIP1.1
#=GS U1NQR3_ASCSU/125-340        AC U1NQR3.1
#=GS A0A165XRC9_DAUCA/1-436      AC A0A165XRC9.1
#=GS B4GP58_DROPE/1-543          AC B4GP58.1
#=GS U4KV42_PYROM/3-486          AC U4KV42.1
#=GS Q6FIX4_CANGA/2-481          AC Q6FIX4.1
#=GS A0A0V1KPB3_9BILA/1-534      AC A0A0V1KPB3.1
#=GS A0A091IGN7_CALAN/13-435     AC A0A091IGN7.1
#=GS F6W863_ORNAN/3-206          AC F6W863.1
#=GS F4PR48_DICFS/115-313        AC F4PR48.1
#=GS K4AJH4_SETIT/107-212        AC K4AJH4.1
#=GS A0A0G4MKM7_9PEZI/79-587     AC A0A0G4MKM7.1
#=GS F0VMQ1_NEOCL/6-716          AC F0VMQ1.1
#=GS D8LZG0_BLAHO/1-105          AC D8LZG0.1
#=GS A0A0U5GKK7_9EURO/10-514     AC A0A0U5GKK7.1
#=GS S9TV07_9TRYP/5-288          AC S9TV07.1
#=GS F7A4I2_MONDO/260-450        AC F7A4I2.1
#=GS Q6CIE0_KLULA/3-493          AC Q6CIE0.1
#=GS W9WI40_9EURO/6-511          AC W9WI40.1
#=GS B4K5I6_DROMO/21-502         AC B4K5I6.1
#=GS LMBD1_CHAGB/12-430          AC Q2HDJ0.1
#=GS A3LSI8_PICST/1-500          AC A3LSI8.2
#=GS A0A0V1LP03_9BILA/201-412    AC A0A0V1LP03.1
#=GS H0ZR81_TAEGU/14-295         AC H0ZR81.1
#=GS A0A137PEB9_CONC2/11-517     AC A0A137PEB9.1
#=GS H0YI83_HUMAN/1-123          AC H0YI83.1
#=GS A0A0G4J5U9_PLABS/248-494    AC A0A0G4J5U9.1
#=GS A0A087VPR6_BALRE/1-417      AC A0A087VPR6.1
#=GS A0A096PXS1_MAIZE/1-225      AC A0A096PXS1.1
#=GS I3N7B2_ICTTR/1-542          AC I3N7B2.1
#=GS B3L8L2_PLAKH/4-442          AC B3L8L2.1
#=GS D3BQK5_POLPA/313-516        AC D3BQK5.1
#=GS A0A0M0JJY9_9EUKA/5-292      AC A0A0M0JJY9.1
#=GS A0A151PD13_ALLMI/18-267     AC A0A151PD13.1
#=GS A0A087UE14_9ARAC/1-56       AC A0A087UE14.1
#=GS A0A158PBH1_ANGCA/28-237     AC A0A158PBH1.1
#=GS A0A0D3GC97_9ORYZ/7-283      AC A0A0D3GC97.1
#=GS A0E1B4_PARTE/229-478        AC A0E1B4.1
#=GS A0A194YI17_SORBI/1-409      AC A0A194YI17.1
#=GS A0A0V0X982_9BILA/280-491    AC A0A0V0X982.1
#=GS A0A061JEU8_TRYRA/3-489      AC A0A061JEU8.1
#=GS N1SA28_FUSC4/10-303         AC N1SA28.1
#=GS F0ZYQ9_DICPU/7-432          AC F0ZYQ9.1
#=GS A0A0K0JHZ4_BRUMA/269-443    AC A0A0K0JHZ4.1
#=GS W1PWU5_AMBTC/24-177         AC W1PWU5.1
#=GS A0A0D9RM74_CHLSB/14-291     AC A0A0D9RM74.1
#=GS A0A0V0UQ55_9BILA/9-542      AC A0A0V0UQ55.1
#=GS U6NZ40_HAECO/58-475         AC U6NZ40.1
#=GS A0A0D9N604_ASPFA/8-302      AC A0A0D9N604.1
#=GS A0A0R3SWM1_HYMDI/19-320     AC A0A0R3SWM1.1
#=GS C9SV87_VERA1/157-539        AC C9SV87.1
#=GS I3L6V2_PIG/29-203           AC I3L6V2.1
#=GS A0A0V1LP03_9BILA/17-135     AC A0A0V1LP03.1
#=GS A0A0F7ZU19_9HYPO/12-521     AC A0A0F7ZU19.1
#=GS A0A091RND4_NESNO/1-444      AC A0A091RND4.1
#=GS A0A091VKD3_NIPNI/244-435    AC A0A091VKD3.1
#=GS A0A0R3TYW7_HYMNN/36-254     AC A0A0R3TYW7.1
#=GS G3RX49_GORGO/16-267         AC G3RX49.1
#=GS A0A091RS23_NESNO/8-209      AC A0A091RS23.1
#=GS I1FMC9_AMPQE/1143-1225      AC I1FMC9.1
#=GS M0TC77_MUSAM/255-490        AC M0TC77.1
#=GS A0A0V1H4N6_9BILA/9-537      AC A0A0V1H4N6.1
#=GS A0A0D9N907_ASPFA/10-515     AC A0A0D9N907.1
#=GS J5JXJ3_BEAB2/1-356          AC J5JXJ3.1
#=GS M8AX40_TRIUA/8-430          AC M8AX40.1
#=GS M0TXG3_MUSAM/7-281          AC M0TXG3.1
#=GS M0YVF2_HORVD/7-130          AC M0YVF2.1
#=GS H2TMI4_TAKRU/261-453        AC H2TMI4.1
#=GS A0A0L0P4U5_9ASCO/1-500      AC A0A0L0P4U5.1
#=GS D5G9G4_TUBMM/5-508          AC D5G9G4.1
#=GS A0A0L0S494_ALLMA/5-308      AC A0A0L0S494.1
#=GS G0QSZ4_ICHMG/1352-1459      AC G0QSZ4.1
#=GS A0A091JSS8_9AVES/1-543      AC A0A091JSS8.1
#=GS D8UDB0_VOLCA/262-498        AC D8UDB0.1
#=GS A0A0V1PNQ7_9BILA/17-309     AC A0A0V1PNQ7.1
#=GS LMBD1_MOUSE/11-295          AC Q8K0B2.1
#=GS A0A0D9QIH0_PLAFR/8-246      AC A0A0D9QIH0.1
#=GS B4IMY0_DROSE/1-90           AC B4IMY0.1
#=GS A0A067ERY6_CITSI/72-290     AC A0A067ERY6.1
#=GS A0A078BA95_STYLE/7-471      AC A0A078BA95.1
#=GS E5SAB2_TRISP/215-386        AC E5SAB2.1
#=GS A0A0N5CVY7_THECL/271-445    AC A0A0N5CVY7.1
#=GS A0A0V1DF73_TRIBR/295-491    AC A0A0V1DF73.1
#=GS H3BI81_LATCH/1-240          AC H3BI81.1
#=GS D7M717_ARALL/261-489        AC D7M717.1
#=GS B4K4Z4_DROMO/1-552          AC B4K4Z4.1
#=GS L5L5P9_PTEAL/335-528        AC L5L5P9.1
#=GS M2YNP6_PSEFD/9-291          AC M2YNP6.1
#=GS H1A3D2_TAEGU/21-256         AC H1A3D2.1
#=GS A0A068S7W4_9FUNG/7-262      AC A0A068S7W4.1
#=GS K7F4P0_PELSI/1-147          AC K7F4P0.1
#=GS F7AR89_HORSE/267-455        AC F7AR89.1
#=GS A0A0G2J0U8_9EURO/15-521     AC A0A0G2J0U8.1
#=GS A0A0B2VSX2_TOXCA/196-379    AC A0A0B2VSX2.1
#=GS G1N7N7_MELGA/1-169          AC G1N7N7.1
#=GS A0A094BVK1_9PEZI/7-285      AC A0A094BVK1.1
#=GS A0A078B838_STYLE/16-521     AC A0A078B838.1
#=GS M8AUD1_TRIUA/8-107          AC M8AUD1.1
#=GS A0A0V1AB61_9BILA/262-491    AC A0A0V1AB61.1
#=GS A0A0V0R074_PSEPJ/1-57       AC A0A0V0R074.1
#=GS K4AJH4_SETIT/7-88           AC K4AJH4.1
#=GS A0A090M6Z7_OSTTA/9-326      AC A0A090M6Z7.1
#=GS K4AJH4_SETIT/185-331        AC K4AJH4.1
#=GS G5AU28_HETGA/21-257         AC G5AU28.1
#=GS A0A0K0JHZ4_BRUMA/19-264     AC A0A0K0JHZ4.1
#=GS I1KKE6_SOYBN/7-295          AC I1KKE6.1
#=GS G0R0T0_ICHMG/1-518          AC G0R0T0.1
#=GS A0A0A1N238_9FUNG/1-308      AC A0A0A1N238.1
#=GS T0KIU9_COLGC/12-520         AC T0KIU9.1
#=GS A0A087UE15_9ARAC/1-368      AC A0A087UE15.1
#=GS A0A0F4G988_9PEZI/9-289      AC A0A0F4G988.1
#=GS W4ISU6_PLAFP/1-125          AC W4ISU6.1
#=GS A0A059D6K8_EUCGR/266-398    AC A0A059D6K8.1
#=GS A0A163GGH0_DIDRA/20-532     AC A0A163GGH0.1
#=GS A0A091DSJ2_FUKDA/21-257     AC A0A091DSJ2.1
#=GS A0A091NM60_APAVI/1-406      AC A0A091NM60.1
#=GS F4Q4S9_DICFS/1-467          AC F4Q4S9.1
#=GS A0A078JBH3_BRANA/7-282      AC A0A078JBH3.1
#=GS H2WBE1_CAEJA/30-393         AC H2WBE1.2
#=GS A0A061EY95_THECC/1-239      AC A0A061EY95.1
#=GS J3QM78_MOUSE/227-422        AC J3QM78.1
#=GS W5K3G8_ASTMX/258-455        AC W5K3G8.1
#=GS A0DTH3_PARTE/4-504          AC A0DTH3.1
#=GS B8NSQ9_ASPFN/6-421          AC B8NSQ9.1
#=GS R1BT11_EMIHU/263-413        AC R1BT11.1
#=GS A0A0N5DQT3_TRIMR/1-532      AC A0A0N5DQT3.1
#=GS A0A0G2JVJ7_RAT/268-455      AC A0A0G2JVJ7.1
#=GS A0A0D9WNC0_9ORYZ/1-498      AC A0A0D9WNC0.1
#=GS C5L8U9_PERM5/3-179          AC C5L8U9.1
#=GS G1X611_ARTOA/4-524          AC G1X611.1
#=GS S8ADD6_DACHA/9-285          AC S8ADD6.1
#=GS J9HY79_9SPIT/325-437        AC J9HY79.1
#=GS A0A178EIZ1_9PLEO/9-288      AC A0A178EIZ1.1
#=GS A0A084W692_ANOSI/21-491     AC A0A084W692.1
#=GS A0A059D7B6_EUCGR/7-281      AC A0A059D7B6.1
#=GS T5AL20_OPHSC/6-327          AC T5AL20.1
#=GS C7YJB3_NECH7/10-445         AC C7YJB3.1
#=GS A0A0V0UDT9_9BILA/17-238     AC A0A0V0UDT9.1
#=GS F7EIH1_MACMU/262-450        AC F7EIH1.1
#=GS A0A0B0P3Y9_GOSAR/1-468      AC A0A0B0P3Y9.1
#=GS E9F123_METRA/12-521         AC E9F123.1
#=GS E9AEI9_LEIMA/5-237          AC E9AEI9.1
#=GS A0A131ZTY3_SARSC/1-587      AC A0A131ZTY3.1
#=GS H2QQR9_PANTR/1-549          AC H2QQR9.1
#=GS A0A0B4HLR9_9HYPO/12-521     AC A0A0B4HLR9.1
#=GS A0A094ELA8_9PEZI/9-517      AC A0A094ELA8.1
#=GS A0A0G2JFU9_MOUSE/1-161      AC A0A0G2JFU9.1
#=GS A0A074SZ96_HAMHA/269-506    AC A0A074SZ96.1
#=GS A0A0D3GEA7_9ORYZ/1-498      AC A0A0D3GEA7.1
#=GS A0A061DHP0_THECC/1-501      AC A0A061DHP0.1
#=GS H9H780_MONDO/266-455        AC H9H780.1
#=GS K7IXZ4_NASVI/318-787        AC K7IXZ4.1
#=GS W5L0L8_ASTMX/255-451        AC W5L0L8.1
#=GS M0SFK9_MUSAM/58-333         AC M0SFK9.1
#=GS A0A0C2FD09_9BILA/1-92       AC A0A0C2FD09.1
#=GS M1VWD1_CLAP2/12-527         AC M1VWD1.1
#=GS W5L0L9_ASTMX/19-269         AC W5L0L9.1
#=GS A0A0B7NP69_9FUNG/26-530     AC A0A0B7NP69.1
#=GS G1N0G8_MELGA/154-347        AC G1N0G8.2
#=GS E2BPT8_HARSA/1-535          AC E2BPT8.1
#=GS A0A151Z608_9MYCE/8-441      AC A0A151Z608.1
#=GS A0A0D9R2B5_CHLSB/231-422    AC A0A0D9R2B5.1
#=GS A0A0V1PNT5_9BILA/284-516    AC A0A0V1PNT5.1
#=GS A0A0L8FP41_OCTBM/1-307      AC A0A0L8FP41.1
#=GS A0A093Y4Y5_9PEZI/28-311     AC A0A093Y4Y5.1
#=GS A0A0C9MDQ1_9FUNG/58-510     AC A0A0C9MDQ1.1
#=GS A0A0L0FUB7_9EUKA/1-220      AC A0A0L0FUB7.1
#=GS H0YR04_TAEGU/18-267         AC H0YR04.1
#=GS D7FRZ6_ECTSI/1-261          AC D7FRZ6.1
#=GS A0A091LLN2_CATAU/1-543      AC A0A091LLN2.1
#=GS B2AVS6_PODAN/15-534         AC B2AVS6.1
#=GS E3LFC1_CAERE/1-547          AC E3LFC1.1
#=GS K3XWG4_SETIT/7-490          AC K3XWG4.1
#=GS A0A0B2RR26_GLYSO/269-488    AC A0A0B2RR26.1
#=GS G5B3E7_HETGA/19-111         AC G5B3E7.1
#=GS A4S681_OSTLU/281-508        AC A4S681.1
#=GS A0A165GG82_9PEZI/15-523     AC A0A165GG82.1
#=GS K0KXM8_WICCF/1-498          AC K0KXM8.1
#=GS G3P315_GASAC/15-295         AC G3P315.1
#=GS A0A091VL75_OPIHO/1-247      AC A0A091VL75.1
#=GS A0A074SYN5_HAMHA/6-463      AC A0A074SYN5.1
#=GS A0A0V0UDG4_9BILA/292-486    AC A0A0V0UDG4.1
#=GS A0A084QKN7_9HYPO/10-288     AC A0A084QKN7.1
#=GS H2RSU8_TAKRU/1-50           AC H2RSU8.1
#=GS LMBD1_NEOFI/7-282           AC A1DB12.1
#=GS A0A099ZC91_TINGU/1-543      AC A0A099ZC91.1
#=GS G2Q1Q1_MYCTT/12-288         AC G2Q1Q1.1
#=GS I1IF06_BRADI/1-498          AC I1IF06.1
#=GS L2G8F9_COLGN/12-520         AC L2G8F9.1
#=GS E9CTW4_COCPS/8-291          AC E9CTW4.1
#=GS G3NIH5_GASAC/18-279         AC G3NIH5.1
#=GS A0A162RHV5_MUCCL/58-373     AC A0A162RHV5.1
#=GS A5E722_LODEL/2-469          AC A5E722.1
#=GS A0A067EZJ2_CITSI/1-83       AC A0A067EZJ2.1
#=GS W9CMI7_9HELO/12-521         AC W9CMI7.1
#=GS A0A091SAV5_9GRUI/1-250      AC A0A091SAV5.1
#=GS A0A0A1U3U6_ENTIV/5-287      AC A0A0A1U3U6.1
#=GS W7K9R9_PLAFO/1-125          AC W7K9R9.1
#=GS W2PXP7_PHYPN/1-543          AC W2PXP7.1
#=GS G3VYX5_SARHA/14-261         AC G3VYX5.1
#=GS B1N5T6_ENTHI/1-217          AC B1N5T6.1
#=GS A0A087SZT8_9ARAC/22-289     AC A0A087SZT8.1
#=GS A0A096MXF9_PAPAN/21-258     AC A0A096MXF9.1
#=GS A0A093G9S7_PICPB/1-252      AC A0A093G9S7.1
#=GS A0A0V1N728_9BILA/297-491    AC A0A0V1N728.1
#=GS A0A183T6I1_SCHSO/56-301     AC A0A183T6I1.1
#=GS A0A0V0UQ11_9BILA/9-559      AC A0A0V0UQ11.1
#=GS A0A0K0CZV9_ANGCA/1-153      AC A0A0K0CZV9.1
#=GS A0A0G2H4D3_9PEZI/9-286      AC A0A0G2H4D3.1
#=GS F0XCH3_GROCL/9-294          AC F0XCH3.1
#=GS B4QWM9_DROSI/1-543          AC B4QWM9.1
#=GS G9MIW2_HYPVG/9-455          AC G9MIW2.1
#=GS A0A0R3PS88_ANGCS/39-253     AC A0A0R3PS88.1
#=GS I1G014_AMPQE/35-292         AC I1G014.1
#=GS G3YE86_ASPNA/10-515         AC G3YE86.1
#=GS A0A152A6U3_9MYCE/55-507     AC A0A152A6U3.1
#=GS G1SF20_RABIT/19-283         AC G1SF20.1
#=GS A0A094GBB1_9PEZI/16-298     AC A0A094GBB1.1
#=GS A0A0S4JAG6_BODSA/2-496      AC A0A0S4JAG6.1
#=GS K1PFL4_CRAGI/151-253        AC K1PFL4.1
#=GS I1GZQ8_BRADI/1-515          AC I1GZQ8.1
#=GS B7PTY4_IXOSC/1-551          AC B7PTY4.1
#=GS F7HSP9_MACMU/1-471          AC F7HSP9.1
#=GS S9VAI4_9TRYP/298-464        AC S9VAI4.1
#=GS YTTA_BACSU/3-202            AC Q795Q5.2
#=GS F9XB54_ZYMTI/9-289          AC F9XB54.1
#=GS G1S1N9_NOMLE/1-549          AC G1S1N9.1
#=GS LMBD2_ARATH/261-489         AC Q9M028.1
#=GS A0A0D2PXR7_GOSRA/1-500      AC A0A0D2PXR7.1
#=GS T1HXA6_RHOPR/1-524          AC T1HXA6.1
#=GS K7EFA9_ORNAN/1-83           AC K7EFA9.1
#=GS A8HPZ9_CHLRE/40-309         AC A8HPZ9.1
#=GS A0A0D2PM70_GOSRA/1-499      AC A0A0D2PM70.1
#=GS F2SIJ5_TRIRC/8-293          AC F2SIJ5.1
#=GS G3Y6Z2_ASPNA/8-283          AC G3Y6Z2.1
#=GS A0A0L0S2C7_ALLMA/10-429     AC A0A0L0S2C7.1
#=GS Q4Q7Q1_LEIMA/4-492          AC Q4Q7Q1.1
#=GS A0A093HZ59_STRCA/1-543      AC A0A093HZ59.1
#=GS Q29C08_DROPS/21-496         AC Q29C08.3
#=GS E5QYW5_ARTGP/323-416        AC E5QYW5.1
#=GS A0A0D2H0U6_9EURO/6-511      AC A0A0D2H0U6.1
#=GS A0A091L5F1_9GRUI/210-403    AC A0A091L5F1.1
#=GS A0A0D9RWU0_CHLSB/1-549      AC A0A0D9RWU0.1
#=GS A0CB69_PARTE/1-519          AC A0CB69.1
#=GS A0A0C2J2B2_THEKT/5-562      AC A0A0C2J2B2.1
#=GS U3IIF8_ANAPL/1-543          AC U3IIF8.1
#=GS A0A061ERE9_THECC/7-283      AC A0A061ERE9.1
#=GS F6SRG2_CALJA/1-549          AC F6SRG2.1
#=GS A0A0N7L7K3_9STRA/6-278      AC A0A0N7L7K3.1
#=GS L1IJC7_GUITH/2-732          AC L1IJC7.1
#=GS G4UPI2_NEUT9/11-524         AC G4UPI2.1
#=GS LMBD1_NEMVE/10-304          AC A7RM45.1
#=GS A0A091NL89_9PASS/234-366    AC A0A091NL89.1
#=GS B6QMF9_TALMQ/8-283          AC B6QMF9.1
#=GS A0A0B0P4G2_GOSAR/1-355      AC A0A0B0P4G2.1
#=GS I1J7F8_SOYBN/177-404        AC I1J7F8.1
#=GS A0DFU0_PARTE/3-294          AC A0DFU0.1
#=GS F0ZJQ2_DICPU/293-498        AC F0ZJQ2.1
#=GS Q4Q9X7_LEIMA/266-458        AC Q4Q9X7.1
#=GS R0I313_9BRAS/7-281          AC R0I313.1
#=GS A0A067BC72_SAPPC/297-472    AC A0A067BC72.1
#=GS A0A0G2K4B6_RAT/154-349      AC A0A0G2K4B6.1
#=GS F1P229_CHICK/6-267          AC F1P229.2
#=GS W5DPE6_WHEAT/1-83           AC W5DPE6.1
#=GS CSPLI_SELML/40-186          AC D8S069.1
#=GS Q8NDP7_HUMAN/1-131          AC Q8NDP7.1
#=GS LMBRL_MOUSE/21-258          AC Q9D1E5.1
#=GS A0A091HCI4_BUCRH/1-543      AC A0A091HCI4.1
#=GS W5NKC4_LEPOC/17-434         AC W5NKC4.1
#=GS F1MNF0_BOVIN/256-449        AC F1MNF0.2
#=GS A0A058Z6B3_9EUKA/8-290      AC A0A058Z6B3.1
#=GS LMBD2_HUMAN/1-549           AC Q68DH5.1
#=GS A0A091HXA0_CALAN/1-543      AC A0A091HXA0.1
#=GS E9D0E8_COCPS/15-520         AC E9D0E8.1
#=GS D8SJB6_SELML/1-489          AC D8SJB6.1
#=GS A0A096NDP1_PAPAN/1-182      AC A0A096NDP1.1
#=GS W4FYA9_9STRA/36-284         AC W4FYA9.1
#=GS A0A015LE47_9GLOM/8-265      AC A0A015LE47.1
#=GS A0A158PBH1_ANGCA/231-394    AC A0A158PBH1.1
#=GS F7AVT2_HORSE/1-269          AC F7AVT2.1
#=GS F4PR48_DICFS/262-485        AC F4PR48.1
#=GS A0A0D2QC92_GOSRA/264-490    AC A0A0D2QC92.1
#=GS A0A0E0PV53_ORYRU/1-498      AC A0A0E0PV53.1
#=GS D8FGD7_ASHGO/1-469          AC D8FGD7.1
#=GS A0A067EZJ2_CITSI/73-272     AC A0A067EZJ2.1
#=GS A0A162KNU9_CORDF/12-521     AC A0A162KNU9.1
#=GS G1S839_NOMLE/267-455        AC G1S839.1
#=GS T1KY36_TETUR/20-219         AC T1KY36.1
#=GS A0A0G2JFX9_MOUSE/1-157      AC A0A0G2JFX9.1
#=GS K7L196_SOYBN/1-122          AC K7L196.1
#=GS W2YXF5_PHYPR/1-543          AC W2YXF5.1
#=GS W6YQK6_COCCA/7-520          AC W6YQK6.1
#=GS G3B3E8_CANTC/2-490          AC G3B3E8.1
#=GS W5LBE5_ASTMX/15-150         AC W5LBE5.1
#=GS V8PDT8_OPHHA/2-201          AC V8PDT8.1
#=GS K2MYD4_TRYCR/5-286          AC K2MYD4.1
#=GS A0A0F4ZC37_9PEZI/5-520      AC A0A0F4ZC37.1
#=GS N4U2D5_FUSC1/10-291         AC N4U2D5.1
#=GS G1PS18_MYOLU/1-259          AC G1PS18.1
#=GS W5HVY9_WHEAT/1-369          AC W5HVY9.1
#=GS A0A0D9WLA7_9ORYZ/150-420    AC A0A0D9WLA7.1
#=GS A0A0K0FC43_9BILA/35-521     AC A0A0K0FC43.1
#=GS A0A0J8F8U1_BETVU/262-488    AC A0A0J8F8U1.1
#=GS A0A0G4MIG1_9PEZI/21-252     AC A0A0G4MIG1.1
#=GS L5K9Q0_PTEAL/847-914        AC L5K9Q0.1
#=GS A0A0Q3MSK5_AMAAE/18-273     AC A0A0Q3MSK5.1
#=GS A0A068XR19_HYMMI/26-246     AC A0A068XR19.2
#=GS A0A087V5A7_BALRE/239-430    AC A0A087V5A7.1
#=GS G3VSI5_SARHA/21-259         AC G3VSI5.1
#=GS E4XVC8_OIKDI/34-327         AC E4XVC8.1
#=GS K7LXY2_SOYBN/6-443          AC K7LXY2.1
#=GS F6Z2E9_HORSE/238-430        AC F6Z2E9.1
#=GS D7L7P3_ARALL/271-489        AC D7L7P3.1
#=GS A0A0K9R921_SPIOL/270-490    AC A0A0K9R921.1
#=GS A0A0V0X958_9BILA/17-284     AC A0A0V0X958.1
#=GS B4NGP5_DROWI/21-501         AC B4NGP5.1
#=GS W3X9A5_9PEZI/19-299         AC W3X9A5.1
#=GS A0A183B3E4_9TREM/1-115      AC A0A183B3E4.1
#=GS A0A0V1LNM6_9BILA/199-395    AC A0A0V1LNM6.1
#=GS A0A168P2D4_MUCCL/7-286      AC A0A168P2D4.1
#=GS A0A0E0NL76_ORYRU/1-498      AC A0A0E0NL76.1
#=GS M7CCU2_CHEMY/10-103         AC M7CCU2.1
#=GS W9WPL0_9EURO/11-300         AC W9WPL0.1
#=GS A0A0V1PP42_9BILA/17-311     AC A0A0V1PP42.1
#=GS B3S4S7_TRIAD/2-538          AC B3S4S7.1
#=GS E3MI86_CAERE/66-695         AC E3MI86.1
#=GS X0IVX2_FUSOX/10-303         AC X0IVX2.1
#=GS K3X7A6_PYTUL/5-219          AC K3X7A6.1
#=GS A0A0B2RR26_GLYSO/112-290    AC A0A0B2RR26.1
#=GS A0A091DSJ2_FUKDA/266-454    AC A0A091DSJ2.1
#=GS H2M441_ORYLA/18-279         AC H2M441.1
#=GS C1EEU0_MICCC/242-471        AC C1EEU0.1
#=GS D2VHA5_NAEGR/54-332         AC D2VHA5.1
#=GS H0WS37_OTOGA/267-455        AC H0WS37.1
#=GS G7PHS1_MACFA/267-455        AC G7PHS1.1
#=GS M1W5S0_CLAP2/9-453          AC M1W5S0.1
#=GS G3J5L0_CORMM/12-521         AC G3J5L0.1
#=GS A0A0L0SHF9_ALLMA/21-526     AC A0A0L0SHF9.1
#=GS A0A183SFT0_SCHSO/20-434     AC A0A183SFT0.1
#=GS F9W5R3_TRYCI/3-488          AC F9W5R3.1
#=GS A0A0V1N728_9BILA/17-223     AC A0A0V1N728.1
#=GS A0A093QGW7_9PASS/1-543      AC A0A093QGW7.1
#=GS A0A0N1HRR8_LEPSE/2-276      AC A0A0N1HRR8.1
#=GS S9U7P2_9TRYP/63-309         AC S9U7P2.1
#=GS F0ZM84_DICPU/368-665        AC F0ZM84.1
#=GS S9UNH5_9TRYP/5-292          AC S9UNH5.1
#=GS C1EEU0_MICCC/9-284          AC C1EEU0.1
A0A067R9M0_ZOONE/1-551                 ......................................................................................mtl---GPLLTDV.VVT.FC.L.A.AC......LLY..KY..GN..W...L...K.HHI..............................................................IVTVAVFIS..W..Y..FSFLI.IF.VLPLDVSS..TVYRQcmqesrleysshvnss.........................................................................................................................................................................gvlfglgiasvgnestNNITp............vQCQEP.W...S...N...V..P..E.....NV.....F...P.................NL...W...RVVY.WTSQ........FLTW..........................LV..LP.......LMQ.S....Y....I.K...........A...GD....F....T....V.R..G.KV.............................KSA...L...IDN...A...IY.YG.S..YL.F.IC.G....ILL.I...YIALK-.............................................................................................................PDLHLD-GQ...KL.KA..IAS..SASNTWGLFLL....VL.LLGYA.LVEV...PRSLWN...............................................................--SSKRGY.VL.N....Y.S.YFKA..A....KLSS..EKCEAE...................................................................................................................................ESVD........DI.LESL...QAV..SVS.VG..PGH...........................................P...LH...RNL.....ETIFQ.......................................................................KVPPELRERMNRrqlp...........................................................................ddtpNDAP...SDK....................................................................................................................................ALIRLH...KQVI...KA...........................................................LQ...TQ....YR...T...E...T.........QWSL...LVDRI....VMLE.................................................................................................................................DVAR.N....Q.V...S.H........D...H....R....YKPT.FE.............PPRP..LW.LRFV............----YS..PTI.E.WY.W.K...CVL...H.....G......Y.T.LK.LAAVA.AGLLSAA..VV.WSEVTFFNK...........................EPVLS.......LFAQFL-..S..L.....A....K.V..NYD.YFTI.....................E.V.LSTM.II.A..YM...C.YC.AYSTVLKIRL....LNL.............YYLAP...HHQTDE..YSL.....IFS...GMMLCRLTP................PMC....L.NF...L..GLIHMDshii.............................................khhiwETHYTQ......V.....M.G...H..M.D...V.....I..S.I..VS-D..GFN.VYF.PM..AMLAFC.VATYFSV-g.......................................................................................................................................................................................................................................................
A0A0A2JD70_PENEN/9-289                 ....................................................................................iwvvy------GAVV.AIL.LA.V.A.SV......FIY..VY..QT..P...R...D.RSP..............................................................SVTLTCIIS..I..T..SLLAT.VL.LLPVDVAL..VSSTT.........................................................................................................................................................................................................SSKLg............qRKDWA.T...Q...D...V..V..D.....RIt..hsL...T.................II...Y...YLLY.SLDA........LLCL..........................LV..IP.......FTY.F....W....Y.E...........E...YD....E....V....A.T..E.EGvq........................tlgQRI...-...WGA...L...KY.TL.S..FV.A.VV.V....ILF.L...VGFFVPlsqgkn................................................................................................dmdldyfRRLLTENHG..eRA.LT..FSL..GLLMTIGLCLY....VL.YTSVG.LALL...PISLIK...............................................................TAPSISSA.TL.R....A.S.--TT..Q....QLDT..N-QERQ...................................................................................................................................RQL-........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------egrcagdpgllsskdrreldtlvreertlirrqrlaeesq................................................................................................................................................................................................................
LMBD1_ORYSJ/276-490                    ......................................................................................qee----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...KS....GK...K...G...R.........KWRK...NVKAL....----.................................................................................................................................----.-....-.-...-.-........G...K....E....LVLL.EDd...........mKALE..EM.YPQGe..........qAEATWA..LTV.L.GY.I.G...KLL...F.....G......A.V.GL.IISIA.WVAHIVI..YL.LI-------...........................DPPLSs.....fLNEIFVK..L..-.....-....D.G..VWG.LLGT.....................-.A.AFAF.FC.F..YL...L.IA.VIAGEMMLGL...kLVF.............ITIHPm.kWGGTLM..NSF.....LFN...VGLILLCSIsviqfcatafayyaqaTAA....Q.EI...F..GHT---......................................................------......-.....-.-...-..-.-...-.....L..Q.S..LRGI..KYL.YKY.NV..FQYGFV.ALAILTLF........................................................................................................................................................................................................................................................
H2Q5U8_PANTR/21-258                    .........................................................................................RECIISTLLF.ATL.YI.L.C.HI......FLT..RF..KK..P...A...E.FTTvdded....................................................atvnkIALELCTFT..L..A..IALGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEVLl...........slPRNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLVF.LFSN........LSLI..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....A....G.S..R.KGv...........................lGRV...-...YET...V...VM.LM.L..LT.L.LV.L....GMV.W...VASAIVdk........................................................................................................nkaNRESLYDFW..eYY.LP..YLY..SCISFLGVLLL....LV.CTPLG.LARM...-FSVTGkll.........................................................vkpRLLEDLEE.QL.Y....C.S.AFEE..A....ALTR..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ricnp...................................................................................................................................................................................................................................................
G0R578_ICHMG/1-122                     .........................................................................................----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.---MSFV..LL.ISEASLYSF...........................KE-IS......iLGNIVKD..F..L.....N....K.Y..NYD.VLKI.....................Q.I.ITLI.PL.L..YM...I.FN.AYYGYFRLKI....SGI.............YGLYS...NHQTDA..PSL.....LFT...CQNFSRIAC................PVC....F.NY...L..EMISVK......................................................DCAFNT......V.....L.G...E..I.-...-.....-..-.-..----..---.---.--..------.--------nlgtcf..................................................................................................................................................................................................................................................
A0A061EY95_THECC/235-334               .....................................................................................avek----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.-VAGAMMLGL...rLVF.............ITIHPm.kWGATLM..NSF.....LFN...VALILLCSIs.............viQFC....S.TA...F..GYYAQ-......................................................ATAAQE......I.....F.G...H..T.-...-.....L..Q.S..LRGI..KYL.YKY.NV..FQIAFV.VLAGLT--fv......................................................................................................................................................................................................................................................
E5SAB2_TRISP/20-199                    .........................................................................vvrkyfvyyclkskmf----------.---.--.-.-.--......---..--..--..-...-...-.--N..............................................................IRFWICIFS..T..A..VSLSA.IL.LVPFSIFS..-----.........................................................................................................................................................................................................NEILl...........lySKNYY.I...Q...W...L..S..S.....SL.....L...K.................SL...W...NSVF.ACSN........LCIF..........................IL..LP.......FAY.F....L....I.E...........S...HG....F....V....S.-..F.RFty........................siwNRV...-...LE-...T...TV.NS.F..FL.V.IL.S....VLL.V...QIVIIFlekency..............................................................................................pytfetcfNMWSFLITA..fTK.LP..VIY..SYISMFGVGL-....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------slaavs..................................................................................................................................................................................................................................................
K0TCE0_THAOC/19-463                    ...............................................................................fdtaicggin----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....M...T.................LF...W...TVIY.WLIP........AWVF..........................LL..IP.......FSI.F....F....Y.E...........A...DD....G....M....L.M..A.GTsvg......................akpnSRI...-...-KE...A...IK.YE.L..FV.I.VI.F....GLI.F...ALTYLFlnetaipvrevtapsfdagpeytitpn.......................................................aeggftssqlalmseedvmllernsanPELQTVALT..vNP.AV..FYA..GLMAWLGWFLF....AL.FGAIG.MAAM...PLDLIL...............................................................AFVYRPR-.HM.D....A.V.EFAE..A....QMS-..------...................................................................................................................................--LR........DR.VNEL...VSV..GEL.IK..IER...........................................-...--...---.....-----.......................................................................------------...................................................................................----...-EE....................................................................................................................................RAQQSA...DQGG...GW...........................................................FN...KE....AR...K...R..aN.........EEKK...TLLQF....----.................................................................................................................................----.-....-.-...-.-........K...Q....A....VFLL.EEd...........aEDFA..NC.TQN-............---YKS..YNP.L.IP.F.G...SLL...L.....G......I.C.AF.VISIF.WVLHIIL..YM.LP---N---...........................SP-VTp.....fLNTYFQW..F..-.....-....D.T..WFP.LFGV.....................-.L.SVAI.FS.F..YL...L.LC.AVKGCFKFGL...rFLF.............FQVHPm.kINKTYM..SSF.....LFN...TGLVLLCAL................PVV....Q.FS...V..SAF-QD......................................................YARYTT......I.....N.Q...V.iN.V...Q.....L..K.Y..LKFF..GW-.---.--..------.--------wwqkkvfeyaflaiilltciyl..................................................................................................................................................................................................................................
I3M0Z9_ICTTR/1-545                     .........................................................................................MSGAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIVGTLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRcrhaaanssp....................................................................................................................................................................................pennstavvtpV--Ps...........qhPCFKP.W...S...Y...I..P..D.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PRLHLE-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSYWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DV.MEEV...RKV..NES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQEKMGRnmddye.......................................................................dfdekrNTYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...H....Q....FVHT.FQs...........pEPEN..RF.IQY-............---FYN..PTV.E.WY.W.E...CLL...R.....P......W.F.YR.ILAVV.LSIFSVI..VV.WSECTFFST...........................TPVLS.......LFAVFI-..Q..L.....A....E.R..TYN.YIYI.....................E.I.ACFL.SI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDssis.............................................hkntqPTAYTS......I.....M.G...S..M.K...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
E0V9N5_PEDHC/17-467                    .........................................................................................RENVIFLILF.IVL.YI.I.S.FT......ILG..QL..GK..K...E...G.EQCsstdsd..................................................dvavynISFWLCSFS..F..S..VSTGA.AL.LLPISIIS..-----.........................................................................................................................................................................................................NEVLl...........lyPNSYY.V...K...W...L..N..S.....SL.....I...Q.................GL...W...NHVF.LFSN........LSLF..........................IL..LP.......FAY.L....F....M.E...........S...EG....F....P....G.S..K.KGl...........................wARA...-...YET...F...TV.LC.L..VA.V.LV.L....GMT.Y...IMSAL-.............................................................................................................--IDGD---...--.--..---..----ISGRQTL....FI.CTPLG.FVRL...-FTVVGqfl.........................................................fkpQFLRDINE.EY.N....L.T.KLEE..D....CIR-..------...................................................................................................................................RRLE........--.--NV...QKN..GKA.YI..SPP...........................................P...--...---.....-----.......................................................................IFPSMFESVTG-...................................................................................----...EDD....................................................................................................................................ILENTP...KKKK...LF...........................................................SL...QN....GA...L...Q...M.........GLKL...MLSKV....----.................................................................................................................................----.-....-.-...-.-........E...K....K....TKLL.D-.............----..--.-VQR............RASLIQ..RNF.V.YP.G.C...MLL...L.....-......-.-.-F.ALTGI.AVLIVVQ..NT.L-ELLIGIK...........................ALPLS.......TRQFSLG..I..S.....S....L.S..KLG.PFGA.....................-.A.IEIV.LI.L..YM...Q.AT.SSVGLYTL--....PFI.............KKFQP..kLNNTPL..SHT.....IAN...CALLLILSSa..............lPLI....S.RI...L..GITNFD......................................................------......L.....M.G...D..F.G...K.....I..V.W..LGNF..KIV.LMY.NV..LFAGAA.TLCLTNKF........................................................................................................................................................................................................................................................
R0KTT4_ANAPL/235-430                   ..........................................................................sstveyqtvelerel----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....-E--.-Kv...........kSKKT..NL.ERRK............KASAWE..RNL.V.YP.A.V...MIL...L.....-......-.-.-L.TETSI.SVLLVAF..NI.LY---LLVDe........................taMPKG-.......SGGPGIG..N..A.....S....L.S..TFG.FVGA.....................-.A.LEII.LI.F..YL...M.VS.SVVGFYSL--....RFF.............ENFTP..rKDDTTM..TKI.....IGN...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAIMT.TLCLVRKF........................................................................................................................................................................................................................................................
G1NYE3_MYOLU/1-572                     .........................................................................................MSGAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIVGTLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRckhaaanssppensnitglyatat.........................................................................................................................................................paprhmrtagpdesaakqdrqrrqK-HPp............hPCFKP.W...S...Y...I..P..D.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PHLHLE-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSYWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ETLE........DV.MEEV...RKV..SES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQEKMGRnmddye.......................................................................dfdekhNTYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...H....Q....FVHT.FQs...........pEPEN..RF.VQY-............---FYS..PAV.E.WY.W.E...CLL...R.....P......W.F.YR.ILAVV.LSVFSVI..VV.WSECTFFST...........................TPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.I.ACFL.SI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDssis.............................................hqntqPTAYTS......I.....M.G...S..M.K...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
H2YCN2_CIOSA/1-468                     .........................................................................................MSAGPLVFEL.FVV.FC.V.A.LF......LLH..HY..GR..I...T...K.QHP..............................................................AVTIATLVA..W..Y..FSLII.IF.ILPLDVSS..TFYRQclhvngqdnvssqtstgiitenvtqtsvpmvstvapsip..........................................................................................................................retthstfipltnqtvvyanqtgksgntynisnndsrgiaV--E.............sICEKP.W...S...Y...V..K..G.....TT.....L...P.................AM...W...HIVY.WTSQ........VLTW..........................LV..LP.......FIQ.S....Y....V.G...........A...GD....F....S....T.L..G.KI.............................KRA...V...IEN...A...VY.YG.S..YL.F.IF.G....CLL.I...YVAAS-.............................................................................................................-KISLD-IQ...QL.KV..LLI..TASNTWGLFLL....VL.LLGYG.LVEV...PRGLWH...............................................................--AADNAR.CM.A....Q.T.YFKL..S....KLST..EKQEAA...................................................................................................................................EDLE........DV.LEEV...KRI..SNV.VR..YNH...........................................P...VR...KYV.....SEIIQ.......................................................................KCPEELRSKMSQgmddyed....................................................................yesndrssNAVP...SKN....................................................................................................................................QLVKLH...RKLI...RA...........................................................VQ...TQ....KR...T...N...V.........QWRI...LMERG....LHLE.................................................................................................................................NVAK.N....D.T...S.M........D...R....Y....WREE.FP............sTAER..NA.VSK-............--FLCT..PST.K.WW.W.F...CKI...Q.....P......F.S.RR.TLAVC.LVLLSIM..VV.WSECTFFNE...........................NPVL-.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------........................................................................................................................................................................................................................................................
H2U0U9_TAKRU/272-471                   ...............................................................................cwvkmnmeam----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.Q...K.E........Y...Q....A....VYHH.LS............sYVLT..EM.RRK-............-ASPWQ..RNL.G.YP.L.A...MLT...L.....-......-.-.-L.ALTVM.CVLMVCI..NV.LE---LLLDe........................aaLPRGM......eVRDPHLG..M..A.....S....F.S..MFG.SLGA.....................-.A.VQVL.LI.L..YL...M.VS.SVVGFYSS--....PFF.............TGILP..rAKDTNL..TQI.....IAN...CMSLLILSSa..............lPVF....S.RI...I..GITRFD......................................................------......L.....L.G...D..F.G...R.....Y..N.W..LGNF..YVV.FLY.NM..MFAGLT.SASLIKT-f.......................................................................................................................................................................................................................................................
J9IM23_9SPIT/1-328                     ........................................................................................m----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................--------G..W..F..LGLSI.FM.IIPLDIYT..-----.........................................................................................................................................................................................................V---..............---KT.N...G...E...V..D..-.....EF.....L...V.................VW...W...YINY.WLVF........GLNW..........................FI..LP.......FLM.E....Y....L.S...........A...AD....F....T....F.K..E.RM.............................MRS...I...RNN...V...PM.LV.V..YL.V.LF.V....VVV.I...ILAVTK.............................................................................................................SGREALQNE...GI.VG..CII..GLSLVFGLLSI....VI.LLGYG.LVKI...PISYFK...............................................................--FSSNAK.KL.M....Y.Y.QQKT..A....EFDS..KYRVKL...................................................................................................................................QKVQ........DM.VNIG...HMI..KVK.H-..EME...........................................P...HR...KVI.....LQDIE.......................................................................IFTQSMEDQNNLriaydprn...................................................................klklpkefKGFI...DYQ....................................................................................................................................RLVRLR...NRFR...YQ...........................................................ST...DL....LR...I...A...S.........FRRE...SIEKA....ILMQ.................................................................................................................................DIID.S....Q.L...R.G........D...R....E....IKSM.FL.............KDRD..NS.QR--............--SKII..KFL.I.YF.W.F...VYL...K.....P......V.G.MI.LMSFI.CLSLSLA..S-.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------li......................................................................................................................................................................................................................................................
Q16UA7_AEDAE/20-487                    .........................................................................................REHIIFLLLF.LLL.YL.G.S.FA......LIG..RF..RR..R...D...R.EDLfstddd..................................................eitvyrISLWLCTFS..L..A..VAVGA.AL.LLPISIAS..-----.........................................................................................................................................................................................................NEVLi...........lyPNSYY.V...K...W...L..N..S.....SL.....I...Q.................GL...W...NHVF.LFSN........LALF..........................VL..LP.......FSY.L....F....T.E...........S...SG....F....S....G.H..K.KGl...........................mARV...-...YET...F...TV.FS.L..LA.F.IV.F....GMT.Y...VISALRdp........................................................................................................ernTFQALFNLG..kYH.LP..FLY..SCVSFLGVLLL....LV.CTPMG.FVRL...-FGVVGqvl.........................................................vkpNLLRDVNE.EF.N....A.F.NLEE..A....TVRR..KLANAN...................................................................................................................................INIE........--.LKSV...TTV..---.--..DSA...........................................Ps.kLC...ADL.....EDLYQ.......................................................................IRPT--------...................................................................................----...NGG....................................................................................................................................AVNEST...----...-K...........................................................LF...ER....LR...E...L...E.........AERK...LLDKQ....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.---R............SSSALQ..RNL.V.YP.V.A...MLL...L.....-......-.-.-L.LLTGI.TVLLVVQ..NT.L-ELLIGIK...........................AVPLS.......TRQFTLG..I..T.....S....L.S..KLG.PLGA.....................-.A.LEVC.II.M..YL...G.VT.SAVGLYTM--....PFM.............RNVRP..qRRKTSL..CQL.....IAN...CALVLILSSa..............lPLL....S.RI...L..GITNFD......................................................------......L.....L.G...D..F.G...Q.....I..E.W..LGNF..MIV.LLY.NV..IFGTAA.TLCLVNKF........................................................................................................................................................................................................................................................
A0A0R3PJV0_ANGCS/152-266               .......................................................................................ll----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..---------VY....AI.IKGYG.FVEL...PRGLWN...............................................................--MGNRDY.LL.R....K.T.YFNI..D....KIFS..DKNEAE...................................................................................................................................EAIK........DA.YREA...RTV..LNI.LK..NEH...........................................G...TR...EKA.....QMIVS.......................................................................RFPEE-------...................................................................................----...---....................................................................................................................................--IRLH...KRAI...SA...........................................................VQ...NH....HR...T...T...A.........QWRW...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------kvimflmf................................................................................................................................................................................................................................................
A0A093T627_PHACA/1-410                 ........................................................................................a----------.--I.LI.F.C.WV......YVR..KY..QS..R...R...E.SEV..............................................................ISTITAIFA..L..A..VALIS.SA.LLPVDIFL..VSYMK.........................................................................................................................................................................................................NQNG.............tFKDWA.D...A...N...V..S..R.....QIe..dtV...L.................YG...Y...YTLY.SIIL........FCVF..........................LW..IP.......FVY.F....Y....Y.E...........E...KD....E....D....D.G..N.TC.............................SQV...-...-KT...A...LK.YT.L..GF.I.TV.C....AVL.L...LIGAFVplgipntkns.........................................................................................tewekvkllfEEFGSS-HG..lTA.LS..FSI..SSLTVIGMLAA....IT.YTAYG.MSAL...PLNLIK...............................................................GTTSAAYE.RL.E....N.T.----..-....----..------...................................................................................................................................EDIE........EV.EQHL...LRI..KSK.CR..DGR...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................PLSSRD...RRNV...QQ...........................................................LE...ER....LR...T...L...R.........RRER...HLESI....----.................................................................................................................................----.-....E.K...S.W........W...T....K....FCEA.--.............----..--.----............-----I..RPL.K.IV.W.G...VFF...I.....-......-.-.--.---IV.ALLFTVS..LF.LSNLDKALHsagfd................sgfiilGTNLT......nPLNMLLP..V..-.....L....Q.T..VFP.-LDY.....................-.I.LITT.IV.M..YF...I.FT.SMAGIRNMGV...wFFW.............IRLYKi.rRGKTRP..QAL.....LFL...CMILLLI--................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vlhtsymiyslap...........................................................................................................................................................................................................................................
A0A0R4IR97_DANRE/256-450               ..........................................................................tsvkydilhlhkeld----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-Sv...........rNQRH..KL.ERRK............KASAWE..KNL.L.YP.I.V...MLI...L.....-......-.-.-L.AGTTI.SVLLVAL..NI.VY---LLVDe........................taMPKGS.......TE-RDIG..N..A.....S....L.S..TFG.VAQA.....................-.V.VEII.LM.F..YL...L.VS.SVVGFYSL--....RIF.............QELTP..rKDDTNM..TTI.....IGC...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAVVT.TLCLVRKF........................................................................................................................................................................................................................................................
J9HY79_9SPIT/1-335                     ........................................................................................m----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................--------G..W..F..LGLSI.FM.LIPLDIYT..-----.........................................................................................................................................................................................................V---..............---KT.N...G...E...V..D..-.....EF.....L...V.................VW...W...YINY.WLVF........GLNW..........................FI..LP.......FLM.E....Y....L.S...........A...AD....F....T....F.K..E.RM.............................MRS...I...RNN...V...PM.LV.V..YL.V.LF.V....VVV.I...ILAVTK.............................................................................................................SGREALQNE...GI.VG..CII..GLSLVFGLLSI....VI.LLGYG.LVKI...PISYFK...............................................................--FSSNAK.KL.M....Y.Y.QQKT..A....EFDS..KYRVKL...................................................................................................................................QKVQ........DM.VNIG...HMI..KVK.H-..EME...........................................P...HR...KVI.....LQDIE.......................................................................IFTQSMEDQNNLriaydprn...................................................................klklpkefKGFI...DYQ....................................................................................................................................RLVRLR...NRFR...YQ...........................................................ST...DL....LR...I...A...S.........FRRE...SIEKA....ILMQ.................................................................................................................................DIID.S....Q.L...R.G........D...R....E....IKSM.FL.............KDRD..NS.QR--............--SKII..KFL.I.YF.W.F...VYL...K.....P......V.G.MI.LMSFI.CLSLSAI..IT.YAELAS---...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------li......................................................................................................................................................................................................................................................
W5H0A5_WHEAT/2-368                     .....................................................................................hraw----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................--------D..gGL.VG..FLM..ACSNTFGLVTG....AF.LLGFG.LSEI...PRNIWK...............................................................--NADWTH.RQ.K....V.L.SHRV..A....KMAV..KLDNAH...................................................................................................................................QEYS........NS.IVVA...QAT..SNQ.MS..KRD...........................................L...LR...PYM.....DIIDR.......................................................................MVAQMLRDDPSFkpsggr.......................................................................lgendmDYDT...DDK....................................................................................................................................TMATLR...RQLR...MA...........................................................HE...EY....YR...C...K...S.........EYMT...YVMEA....LDLE.................................................................................................................................DTIK.N....Y.E...H.R........D...A....N...gWKYV.SSf..........reSRSG..TL.----............--GSLL..DTM.E.FI.W.R...CIL...R.....K......Q.L.QK.ALAVI.LGCMSAA..IL.LAEATLLPG...........................GVDLS.......LFSILVK..S..V.....G....-.-..-KQ.EVLV.....................Q.V.AAFV.PL.M..YM...C.IC.TYYSLFQIGM....LMF.............YSLTP...-RQTSS..VSL.....LMI...CSMVARYAP................PIS....Y.NF...L..NLIRLGg...................................................nvKTTFEK......R.....M.G...N..I.D..dA.....V..P.F..FG-R..RFN.RIY.PL..IMVVYT.LLVASNF-f.......................................................................................................................................................................................................................................................
C3Z9N3_BRAFL/292-485                   .........................................................................islpvkqdlrkrllev----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-Q.............TERK..KL.ERRQ............KASVWQ..RNL.G.YP.L.V...MLL...L.....-......-.-.-L.AMTGI.AVFIVSI..HT.L----GLLFgg.......................aaLPVG-.......VQDIGLG..Q..A.....S....L.S..MFG.VLGA.....................-.S.VEII.LI.L..YL...M.VA.SVVGFYSV--....PLF.............SRIRP..tKANTPM..TMV.....IAN...CLVLLIMSSa..............lPVL....S.RT...I..GITHFD......................................................------......L.....L.G...Y..F.G...R.....F..N.W..LGNF..YIV.LLY.NV..VFAVGT.GLCLVKKF........................................................................................................................................................................................................................................................
A0A077ZU38_STYLE/4-337                 .......................................................................................iw---IVALIEA.ILV.LI.Y.C.TY......LAQ..QY..AA..K...D...R.TPL..............................................................YVKALTVIG..W..F..FGLTI.IM.LVPLDIYT..-----.........................................................................................................................................................................................................V---..............---KV.N...G...E...V..D..-.....DF.....L...V.................VW...W...YVIY.WAVF........LMNW..........................FI..LP.......FLI.E....Y....L.G...........A...AD....F....T....V.K..E.RI.............................MRS...I...RNN...V...PM.LV.V..YL.V.LF.I....IVI.I...ILAVTK.............................................................................................................SGREALENE...GI.VG..CII..GLSLVFGLLSI....VI.LLGYG.LVKI...PISYFK...............................................................-FASNYK-.KL.R....H.Y.QQKA..A....EYEG..QHRAKI...................................................................................................................................QKVQ........DM.INIG...YMI..K-V.KN..ELE...........................................L...YR..kVII.....EDIDSfckqieeigg..................................................lnmqynprnklKMPSDFKGF---...................................................................................---I...DYN....................................................................................................................................KLVRYR...NKFR...QE...........................................................ST...DL....SR...L...T...S.........FRGE...NIEKA....ILTQ.................................................................................................................................DIID.S....K.G...Q.W........A...I....Q....SILL.KQ.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rgnsklqktikl............................................................................................................................................................................................................................................
A0A0R3S0S6_9BILA/1-533                 .........................................................................................MSGSLLVVEV.SAL.FF.L.T.LL......LLN..KY..GS..W...R...R.QHF..............................................................IVSISTFIG..W..F..FSFVI.IF.ILPLDIAI..TFYNRclleetqls.......................................................................................................................................................................................aqkdldignT--Td............sVCKKP.I...G...F...V..P..N.....HA.....L...L.................RL...W...RVVY.WTAQ........LLTW..........................IV..LP.......LMQ.S....Y....S.D...........A...GD....F....S....P.L..G.KL.............................RSA...V...YNN...A...VY.YG.T..YL.A.LF.F....MLM.V...YAAVR-.............................................................................................................-GVVLN-AE...YL.KV..ILI..SASNTWGLFLL....VV.LLGYG.LIEV...PRQFWQ...............................................................--MGNRDY.RL.N....K.T.YFDI..D....KLST..DKNDAE...................................................................................................................................DVVR........EV.YKEA...RSV..LTL.FC..NEH...........................................T...LR...KYA.....QTIVA.......................................................................KFPPELVSQINSqsndg.........................................................................fsfdyGIAP...ASE....................................................................................................................................DFIRLH...KRVI...SA...........................................................IQ...NH....HR...R...Q...A.........QWNA...LILRA....LYLE.................................................................................................................................DVHQ.A....E.I...T.G........-...-....Q....FVRT.--.............--KG..HQ.TNFF............H---CP..ARF.C.FL.W.H...VFY...K.....R......I.L.MK.VLGFF.FYMITGF..IM.WSECTFFII...........................HPRLS.......LAALIV-..H..H.....A....A.H..GHH.YLHI.....................Q.I.YATV.II.S..YL...C.MC.AYYTVFKLRI....YRY.............YHLDP...HHMTDE..NSL.....LFS...AILLCRLTP................PIC....L.NV...L..GMIHLDshits...........................................dadfgvETQFTK......L.....M.G...H..L.D...L.....I..P.V..LA-K..GIN.IYL.PI..LIVLLA.LGTWFKL-g.......................................................................................................................................................................................................................................................
H7C1Y4_HUMAN/1-45                      ........................................................................................g----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................-L...W...NLAS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KE............................gKMS...-...RQN...L...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------v.......................................................................................................................................................................................................................................................
A0A0M9A1I3_9HYME/304-484               ...............................................................................cickyiniit----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...YSF...F.....S......Y.V.QK.IVAIC.TGCLSIA..VV.WSEVTFFNK...........................TPVLS.......LFAQFL-..N..L.....A....K.A..NYD.YFTI.....................E.V.LSML.II.A..YL...C.YC.AYSTVLKIRV....LNL.............YYLAP...HHQTNE..YSL.....IFS...GMMLCRLTP................PMC....L.NF...L..GLVHMDshii.............................................kthilETHYTQ......V.....M.G...H..M.D...V.....I..S.I..IS-D..GFN.VYF.PM..AILAFC.LATYFSLG........................................................................................................................................................................................................................................................
A0A077ZP06_TRITR/223-463               ...................................................................................saellr----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...-K...........................................................LS...HL....TR...E...I...V.........FRKR...ILSRT....WMNT.................................................................................................................................EVSC.A....E.K...I.A........S...T....K....VVSA.AL.............ELYC..II.WDEL............-CGMND..SKL.C.FS.W.I...KYV...T.....A......A.FlLV.VLSSF.SMILVIM..NV.LQLITGLRR...........................LPS-P.......VEEFELG..K..S.....S....L.S..FLG.IWGA.....................-.A.LEII.VI.L..FL...A.FT.SFYGCYTL--....SPM.............LCLRP..kRKETSM..KMM.....TIN...CAIVLLLCSa..............lPVL....A.RV...L..GKLRCPcwpe..............................................clarITNFD-......L.....L.G...E..Y.G...R.....F..K.W..LGNF..AFL.LAY.NG..IFTLAM.GFSFFTS-v.......................................................................................................................................................................................................................................................
A0A0N0RT22_9HYPO/12-533                ........................................................................................g-SIVFSVLAL.LTV.SL.A.V.LL......VLR..HY..LP..L...R...T.TPA..............................................................FYLTPIFFA..L..W..LPCIL.VL.LVPIDLAS..SAV--.........................................................................................................................................................................................................---T.............dDLASR.G...I...W...L..P..Q.....RV.....V...L.................VS...W...RFTY.WLTF........FLTW..........................FI..LP.......ILA.E....Y....S.D...........T...GY....R....E....P.R..D.RL.............................LYS...L...RAN...G...QY.WA.I..VL.S.LG.A....TGL.V...YVFVA-.............................................................................................................YEFSLT---...AL.RA..LVM..ALSYCWGLMFA....IY.LMGHG.LVAV...PRNLLR...............................................................--GVSISG.RL.R....R.L.QTKA..P....RAYE..KMEDSM...................................................................................................................................ADLE........EV.EFQV...FEL..GRR.KG.aGSA...........................................M..aFR...DWI.....EDLQDmanvpesrphphppsa.......................................ssaaaaayrdgaaegrVIPSVI------...................................................................................----...TEK....................................................................................................................................YLAELT...RKLV...RA...........................................................RH...AK....SR...F...V...T.........EWAH...LVQEA....ADTQ.................................................................................................................................RILD.S....A.A...S.R........R...L....Q....LGDI.--.............SPHA..GF.WDR-............-LTVLD..PYT.R.YL.Y.H...YYA...V.....P......C.L.RV.AFGAC.LALASAC..IV.WSEIVRLP-...........................FPKLS.......VIRLSVI..H..H.....W....V.G..DKA.QVGFa...................gQ.A.ISAF.WI.S..YM...C.VA.ALSSISEVKV....WRG.............RALVR...-RNTGY..EAA.....FWY...AGQVAKLSV................PLS....Y.NF...L..TFLTGEv...................................................yqKTTFYR......F.....L.G...Q..Y.V...D.....V..T.P..LG-R..LFD.DVF.PF..FLVVPV.LAALFGLY........................................................................................................................................................................................................................................................
A0A0K0CZV9_ANGCA/150-361               ........................................................................................a----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....-I.IKGYG.FVEF...PRGLWN...............................................................--MGNRDY.LL.S....K.T.YFNI..D....KIFS..DKNETE...................................................................................................................................EALK........DA.YREA...RTV..LNV.LK..NEH...........................................G...TR...EKA.....QMIIS.......................................................................RFPEEVIEELFParsaief....................................................................sslnasdiRSVN...SDT....................................................................................................................................YLIRLH...KRVI...SA...........................................................VQ...NH....HR...T...T...A.........QWRS...LINKA....LYLE.................................................................................................................................NIAQ.A....E.I...S.G........H...L....E....RSS-.--.............----..--.----............--SFVP..ENV.R.YF.W.L...VLA...Q.....R......P.L.CK.LVSVV.LMCMTVF..IV.ISECTFFIV...........................NPTLT.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------pagiy...................................................................................................................................................................................................................................................
A0A091UCC9_PHORB/1-248                 .......................................................................................fq----ICFLLF.AVL.YI.V.S.YF......IIT..RY..KR..K...A...D.EQEdeda......................................................ivnrISLFLSTFT..L..A..VSAGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........sfPQNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLAS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KGi...........................rARI...-...LET...L...VM.LI.L..LA.L.LI.L....GIV.W...VASALIdn........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDLDE.QM.Y....I.I.TLEE..E....AIQ-..------...................................................................................................................................RRLN........GV.SSTV...EYQ..T--.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------velere..................................................................................................................................................................................................................................................
A0A0K0CZV9_ANGCA/358-452               ......................................................................................agi----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....--Y.............YHLDP...NRHTDA..NSL.....LFS...AKLLCRLTP................PVC....L.NF...L..GMIHLDshitm...........................................akgfgvETQFTR......L.....M.G...H..L.D...V.....I..P.I..LA-T..GIN.VYL.PI..CILVFC.AATYFRI-g.......................................................................................................................................................................................................................................................
H0YR04_TAEGU/257-439                   ............................................................................veyqtvelerele----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-Kv...........rSKKT..NL.ERRK............KASAWE..RNL.V.YP.A.V...MIL...L.....-......-.-.-L.TETSF.SVLLVAF..NI.LY---LLVDe........................taMPKGS.......-GGPGIG..N..A.....S....L.S..TFG.FVGA.....................-.A.LEII.LI.F..YL...M.VS.SVVGFYSL--....RFF.............ENFTP...KDDTTM..TKI.....IGN...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......-.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAIM-.--------t.......................................................................................................................................................................................................................................................
A0A0V1AAZ9_9BILA/17-294                .........................................................................................RENVVATLLF.IIL.YA.C.S.YI......LVG..KF..RL..N...P...E.KDElftged.................................................sdaivfrISFWICIFS..T..A..VSLSA.IL.LVPFSIFS..-----.........................................................................................................................................................................................................NEILl...........lySKNYY.I...Q...W...L..S..S.....SL.....L...K.................SL...W...NSVF.ACSN........LCIF..........................IL..LP.......FAY.F....L....I.E...........S...HG....F....V....S.-..F.RFty........................siwNRV...-...L-E...T...TV.NS.S..LL.V.IL.S....VLL.V...QIVIIFlekench..............................................................................................pytfetcfNMWSFLITA..sTK.LP..VIY..SYISMFGVGLS....LA.CTPLG.FGRI...-FAVFNvli.........................................................peaRIRNKIIN.DL.Q....L.L.SAEE..M....HLVK..KAKTA-...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vsilkhtpfveeemnviwlsclrnla..............................................................................................................................................................................................................................
A0A0V1LNM6_9BILA/17-123                .........................................................................................RENVVATLLF.IIL.YA.C.S.YI......LVG..KF..RL..N...P...E.KDElftged.................................................sdaivfrISFWICIFS..T..A..VSLSA.IL.LVPFSIFS..-----.........................................................................................................................................................................................................NEILl...........lySKNYY.I...Q...W...L..S..S.....SL.....L...K.................TC...F...NMWS.FLIT........AS--..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------t.......................................................................................................................................................................................................................................................
N1QLJ2_SPHMS/19-516                    ........................................................................................g-SNIFAGTAL.LVV.AL.A.C.IL......AIR..HY..LP..L...R...H.TPQ..............................................................WLLLPVFLA..L..F..LPCSI.VL.LVPIDCAE..T----.........................................................................................................................................................................................................----..............-HTST.A...L...W...L..P..E.....RA.....T...L.................VA...W...RIAY.WLTF........VLTW..........................FI..LP.......LLG.E....Y....C.D...........S...GF....R....D....T.R..Q.RM.............................VDS...V...RSN...L...RY.QI.I..VL.S.TG.L....LGL.V...YFIFE-.............................................................................................................NGFHVA---...SI.KG..LLM..ALAYTWGLILA....IG.LMGHG.LVAM...PRRLFR...............................................................--NAKVTS.RL.R....F.L.HTQA..P....KIKD..KLDDAE...................................................................................................................................EVLE........RL.ECTV...AQL..GKH.KS..GAS...........................................R..eQQ...EWI.....DELASvpdarsgv......................................................aatmqatnaSIPAVITDR---...................................................................................----...---....................................................................................................................................YLADLT...RKVK...RA...........................................................RH...RK....AR...F...V...D.........EWNH...LVQRA....CDTQ.................................................................................................................................AIVD.S....A.T...T.K........E...L....K....FASG.--.............----..GS.GK--............SLVLLT..PTM.R.YH.L.H...MNV...V.....P......A.L.RI.ALAAV.LALASVL..IV.WSEIIKAF-...........................APQLS.......VIGLTVV..H..H.....P....H.S..KSG.WTVNi..................ggQ.L.MAAL.WL.L..YM...D.AS.ALYAITDVKI....WGN.............RALVK...-RQTYA..ESA.....CWY...SMQVAKLTV................PLS....Y.NF...V..TMLPPTv...................................................feKTMFFQ......F.....L.G...K..L.L...D.....I..T.P..LG-Q..GFS.RFF.PC..FLLLPV.LATFFNVY........................................................................................................................................................................................................................................................
K7J9S1_NASVI/482-883                   .......................................................sikqklhwedktapaddevqlsdwkdnmknmiss----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................-----TPSN..pKI.KA..IAS..SASNTWGLFLL....VL.LLGYA.LVEV...PRGLWN...............................................................--SSKPGY.TL.N....Y.S.YFKA..A....KLSI..EKYEAE...................................................................................................................................ETVD........DV.LESL...QAA..NLA.IN..PGH...........................................P...FH...RYL.....ETIFQ.......................................................................KVPAELKDKMNRrqlp...........................................................................edtpLDVP...SEK....................................................................................................................................ALIRLH...RNTM...KS...........................................................LQ...TL....QR...T...E...T.........QWGI...LVDDI....FDLE.................................................................................................................................DISR.N....Q.T...S.H........D...R....R....FKPT.FP.............VQRP..LI.LRI-............---LYN..PSI.E.WY.W.K...CLI...K.....S......H.V.QK.AAAVL.AATLSIA..VV.WSEVTFFNK...........................SPVLS.......LFAAFV-..N..S.....A....K.V..KYD.YFTI.....................E.V.LSTL.VI.A..YL...C.YC.AYSTVLKIRV....LNL.............YYLAP...HHQTNE..YSL.....IFS...GMMLCRLTP................PMC....L.NF...L..SLIHMDshii.............................................ktqvmETQYTQ......V.....M.G...H..M.D...V.....I..K.I..VS-D..GFN.IYF.PM..GILAFC.LATYFSLG........................................................................................................................................................................................................................................................
A0A183DP83_9BILA/151-451               ................................................................................qearsvltl----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.LR..NEN...........................................I...LR...EHA.....QTIVA.......................................................................KFPPELVSQITStsmgsfpa..................................................................assitpgneGLVA...NVS....................................................................................................................................YLIRLH...KRVI...NA...........................................................IQ...NH....HR...T...Q...A.........HWQA...LIRRA....LYLE.................................................................................................................................DVHQ.A....E.L...T.G........Q...-....-....FKRT.--.............----..KG.MQNG............-LLRCP..YQF.Q.YF.W.H...VIC...K.....K......T.L.LK.ILGLL.FYVMTGF..VM.WSECTFFII...........................HPRLS.......LAAQFV-..H..L.....A....A.H..GYH.YLYI.....................Q.I.CATA.II.S..YL...C.VC.AYYTVFKLRI....YRY.............YRLDP...HHITDE..NSL.....LFS...AILLCRLTP................PIC....L.NV...L..GMIHLDshits...........................................dtkfgvETQFTK......L.....M.G...H..L.D...V.....I..P.I..LA-R..GIN.IYL.PI..LIVLLA.LGTWLRL-g.......................................................................................................................................................................................................................................................
G8YPA2_PICSO/1-500                     .............................................................................mwvlpllwysva----------.---.LA.I.S.IT......GIR..YQ..ID..I...F...K.FPL..............................................................YFSVPLILA..V..F..IPLSI.IY.LLPLDYVS..-----.........................................................................................................................................................................................................-HNF..............KDSLN.L...L...R...L..P..D.....KV.....I...L.................YI...W...KSNY.WITF........ILTW..........................LV..LP.......LLQ.E....F....Y.K...........S...GH....Q....S....S.L..L.KV.............................KDA...F...KKN...L...KF.QF.I..IL.G.VS.V....LGM.I...YLMLE-.............................................................................................................VGLSLG---...HV.KL..MII..ALSHIYSLILA....LW.LMAHG.LISI...PRNLWR...............................................................--KGSLVS.NL.N....S.Y.YLQV..P....KIVD..ILEDTK...................................................................................................................................ITFK........ED.VLEI...IVL..KKS.FT..SNSa........................................edF..gFR...DWI.....LTLYE.......................................................................KIPEDIKASVENslmed........................................................................esntisREAL...TLP....................................................................................................................................RMTKLT...SRFN...QN...........................................................LY...KF....QA...Y...Q...S.........AYDA...LVSKI....IALE.................................................................................................................................DVVN.S....D.Y...S.E........S...N....G....QRGT.--.............--NF..RF.NP--............SRSYLS..PQM.R.YY.L.E...HHI...K.....P......I.Y.NR.VAAVL.LSVLSFV..IL.ES---EFFH...........................STGIS.......VINIIVY..S..N.....R....F.V..SHG.FGKL.....................-.L.VCCL.VF.L..YM...L.FA.SLNSLTHLKV....FGM.............YHLVP...-RHSDP..ISA.....CFY...TTYVARLTI................PLS....Y.NF...I..TLFISR......................................................ESIFEK......W.....F.G...E..S.I...H.....L..T.G..LF-N..LMN.NWL.PR..FVLLPV.FLTLFHVY........................................................................................................................................................................................................................................................
A0A151WQ01_9HYME/17-490                .........................................................................................RENIIYLLLF.LLL.YI.S.S.YA......LIA..RF..RR..R...D...R.EDYlsvded..................................................eatvyrISLWLCTVA..L..A..ISVGA.TL.LLPVSIAS..-----.........................................................................................................................................................................................................NEVLi...........lyPNSYY.V...K...W...L..N..S.....SL.....I...Q.................GL...W...NHVF.LFSN........LSLF..........................VF..LP.......FAY.L....F....T.E...........S...EG....F....E....G.H..K.KGv...........................mARV...-...YET...V...TV.LC.L..LG.T.LV.L....GMT.Y...VLSALLdy........................................................................................................qnsSLHTLLNLW..sYY.LP..FLY..SCVSFVGVVML....LL.CTPVG.FVRL...-FDVVGsfl.........................................................vkpQFLKNLDD.EF.F....A.Y.RLEE..N....CIR-..------...................................................................................................................................RRLQ........--.--HV...KAT..GKS.YV..SPV...........................................P...MS...PAM.....NCVLSshedd.............................................................epllcISPD--------...................................................................................----...---....................................................................................................................................LLCLRN...GALQ...KG...........................................................LS...QR....LH...D...I...Q.........KRRQ...LLDQQ....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.---R............RTWWVR..RTL.L.YP.V.A...MMA...L.....-......-.-.-L.ILSTA.TALLAVQ..NT.V-ELLIGIK...........................ALPLS.......TRQFTLG..I..S.....S....L.S..KLG.PIGA.....................-.A.IEVA.VI.L..YL...A.VT.SAIGLYTL--....PGV.............RMVQP..rFRSTPL..THL.....IAN...CALLLVLSSa..............lPLL....S.RI...L..GMTNFD......................................................------......L.....L.G...D..F.G...R.....I..E.W..LGNF..KLV.LLY.NL..IFATAA.ISCLTTKF........................................................................................................................................................................................................................................................
V7ANU4_PHAVU/279-488                   .................................................................................askgrkfr----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................---K.N....V.K...S.V........E...K....E....LLQL.EEd...........vKLLE..EM.YPQGe..........kAETTWA..LTV.L.GY.L.A...KLV...L.....G......V.L.GL.IVSVA.WVAHIII..YL.LV-------...........................DPPLSp.....fLNVVFIK..L..-.....-....D.D..IWG.LLGT.....................-.A.AFAF.FC.F..YL...L.LA.VIAGAMVVGL...rLVF.............ITIHPm.kWGATLM..NSF.....LFN...VGLILLSSMsviqfcstafayyaqaTAA....Q.EI...F..GHT---......................................................------......-.....-.-...-..-.-...-.....F..E.S..LRGI..KYL.YKY.NV..FQIAFV.ALAGLT--fv......................................................................................................................................................................................................................................................
F8W054_HUMAN/21-112                    .........................................................................................RECIISTLLF.ATL.YI.L.C.HI......FLT..RF..KK..P...A...E.FTTvdded....................................................atvnkIALELCTFT..L..A..IALGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEVLl...........slPRNYY.I...Q...W...L..N..G.....SL.....I...H.................V-...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------c.......................................................................................................................................................................................................................................................
Q4CQJ4_TRYCC/273-430                   ...........................................................rnetylleaqqeqliwaytkaggspfiiyg----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...RLL...L.....G......I.M.SL.CISIL.WILHIFI..YN.T-------F...........................HKNLF.......LNQILI-..-..S.....I....N.N..IFE.LFGI.....................-.I.IYGI.FI.F..YL...I.WI.SFEGQVRLGM...rLIF.............FQIYPl.kPHDTTL..NAL.....LFN...ISISLLISP................AI-....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------iefasrsfqeygprttinalmniy................................................................................................................................................................................................................................
H2RV14_TAKRU/1-126                     .........................................................................................MSGAALGIEI.VVV.FF.L.A.LF......LLH..RY..GD..F...K...K.QQR..............................................................MVLFGTLLA..W..Y..LCFLI.VF.ILPLDVST..TIYKQckidqeqepvctlt.............................................................................................................................................................................plptnhttsnatptK-SVp............tPCYKP.W...S...Y...I..P..D.....GI.....M...P.................VF...W...RVVY.WTSQ........CLTW..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------........................................................................................................................................................................................................................................................
A0A087X605_POEFO/1-563                 .........................................................................................MSGAALGLEI.VLV.FF.L.A.LF......LLH..RY..GD..F...R...K.QQR..............................................................MVLFGTLLA..W..Y..LCFLI.VF.ILPLDVST..TIYRQciedheehltvstvsptn.....................................................................................................................................................................rtgssgpnppnvsmaptrR--Pi...........psPCHRP.W...S...Y...I..P..E.....GI.....M...P.................VF...W...RVVY.WTSQ........CLTW..........................LL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....SLL.I...YVAVH-.............................................................................................................PDWPLSHLSw.yEL.QT..IGI..TAANTWGLFLL....VL.LLGYG.LVEI...PRSYWN...............................................................--ASRHGH.LL.M....K.T.YFKA..S....KLMT..EKADAE...................................................................................................................................ENLE........DV.MEEV...RKV..SES.IK..YNH...........................................P...LR...KCI.....DTILR.......................................................................KCPVDYQEKMGRnmddye.......................................................................dfddkqNSYP...TEK....................................................................................................................................SLVKLH...KQVI...YA...........................................................VQ...RH....NR...T...R...V.........QWQI...LLQQA....VHLE.................................................................................................................................DVAK.N....E.T...S.L........S...H....Q....FVHS.FQs...........aEPPG..RF.SR--............--YVYT..PTV.E.WY.W.E...CLL...K.....R......W.F.YR.LVSVV.LTLFSVA..VV.WSECTFFST...........................RPVLS.......LFAVFI-..Q..L.....A....E.S..DYN.YLYI.....................E.M.ACFI.TI.F..FL...C.TC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....QFS...GMLFCRLTP................PLC....L.NF...L..GLIHMDsais.............................................hrqklPTAYTS......I.....M.G...S..M.R...V.....L..S.F..IA-N..GFY.IYY.PM..LIVILC.IATYFSLG........................................................................................................................................................................................................................................................
A0A0D2BDN3_9EURO/27-468                ......................................................................................liw---VVYAIAV.AIL.LS.I.A.SL......FVY..LY..QT..H...R...E.RSV..............................................................LVTIVCIFT..I..T..CLLAT.VL.LLPVDVAL..VSSTTsskq................................................................................................................................................................................................grrkdW---..............ANQGK.V...D...N...I..T..Y.....T-.....L...R.................IV...Y...YLLY.SLDA........LLCL..........................IV..VP.......FTY.F....W....Y.E...........E...YD....E....V....A.Q..E.EGsq........................tfgSRF...-...WAA...F...KY.TL.I..FI.F.LC.V....ALF.V...V--GFFvpvardrgg...........................................................................................ahfdldffkNLLSEN-HG..eRA.LT..FAL..GLLITIGVLMY....CF.YTAAG.LALL...PLTLIK...............................................................--SAPGIS.AP.A....L.S.ETTA..S....----..------...................................................................................................................................-QLE........SN.LERQ...RQL..EGR.AQ..GNP...........................................-...--...---.....-----.......................................................................------------...................................................................................----...--E....................................................................................................................................GLSSKD...QREL...DA...........................................................LV...RE....ER...T...L...R.........RHQR...LAAEA....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-A............gEDRN..IF.WKI-............--WIKI..EAV.F.RP.I.K...LIL...G.....-......-.I.LL.VVIVL.LIFASML..IT.GIDKAKNSIckrh...................cgylLARIN.......IFQPINW..I..-.....L....V.K..SAK.VFPI.....................D.YiIFLF.LV.M..LF...F.SA.SIIGIATIGIrvlwITI.............FRIRK...-AHTSP..QAL.....LIA...TVMLTLMTL................AIN....Y.SI...A..MM----......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vapqyatfg...............................................................................................................................................................................................................................................
A0A0L0SKK9_ALLMA/21-523                ..................................................................................geaiivg---------W.VVV.AL.I.S.AG......LLR..SL..LD..R...R...D.AAW..............................................................YSMLAVFIG..W..T..GPFSI.LY.FLPLDLSS..TKFRAc......................................................................................................................................................................................................laQQAVd............lPCAPP.L...L...Y...I..A..Y.....TT.....Q...L.................SI...W...QAIY.WTLF........FLTW..........................FT..IP.......ILQ.S....A....T.D...........S...GG....F....T....A.A..Q.AF.............................RKA...I...RYN...A...WY.YS.V..LG.I.VG.A....VLL.T...VLAVW-.............................................................................................................RGLDFA---...SL.KG..FLM..AISNAYGLLLV....VL.FMSYG.LVDI...PRELWH...............................................................--AADVRR.SL.S....M.L.EYRA..P....RYKE..QLESAV...................................................................................................................................RDLQ........EV.QKSI...LAL..DPL.VP..VSN...........................................P...VR...KYV.....DRMLI.......................................................................QCPAELRNAPAPsggftswf...................................................................rsgpaappPDQI...TLK....................................................................................................................................SLQQLH...RSLK...QA...........................................................IL...AR....NR...C...Q...Y.........QWHH...LIERA....HFFQ.................................................................................................................................DIID.N....S.D...N.S........D...R....R....FHVL.--.............----..--.GRF-............-RASWR..QRL.E.WV.W.Y...VHG...R.....G......T.L.LR.LFALV.AGLLSIA..LL.WSEVTMNM-...........................--GLS.......VFELVQ-..-..-.....-....-.R..AKS.YAAT.....................E.L.VALV.TL.A..YL...A.AC.TFGPLLSIRV....FSI.............YQLAP...GQHTNV..KSL.....LFF...AAYMTRLCF................PLS....W.NM...L..NLTQS-......................................................EAVFSR......V.....M.G...S..V.N...L.....V..P.L..LG-D..SFN.DWV.PI..SLVVLC.GITVLNI-q.......................................................................................................................................................................................................................................................
G2RES6_THITE/12-446                    ...................................................................................iwvsyg-------VAV.ALV.LF.V.A.II......TTI..TW..QT..P...H...E.RSI..............................................................AVTAVSIFS..L..T..ALLAT.VL.LLPVDIAL..VSSTAsah..................................................................................................................................................................................................lgakK---..............--DWA.T...P...A...R..V..E.....GIl..qtL...K.................IV...Y...YTLY.TLDA........LLCL..........................IV..LP.......FTY.F....W....Y.Eeyd.....eveE...EE....D....R....T.S..S.RG.............................ARL...-...WRA...L...KY.TL.G..FV.F.LV.V....VLF.L...IGFFVPaagkassg.............................................................................................rhldldyfKRLLVANNG..eKA.LT..FGV..GLLMTLGTLLY....VL.YTGSG.LALL...PVSFIK...............................................................SAPSISAP.QL.S....A.T.---T..A....SALE..RNRELQ...................................................................................................................................RQLE........--.----...---..-MR.N-..--A...........................................-...--...---.....-----.......................................................................GRP---------...................................................................................----...--E....................................................................................................................................GMSQKD...RREL...DA...........................................................LL...RE....ER...T...L...V.........RRER...LAAEA....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-R............gEGRG..RI.YRV-............--WTKL..EAV.F.RP.L.K...-LL...G.....G......L.F.LL.LLAIL.VWVSMLI..TG.IDKAANSLCkqhcg.................yilghLNVFQ......pINWIFV-..-..Q.....S....A.K..AFP.V-DY.....................-.I.LMAL.LV.L..VF...F.SS.SITGLASIGI...rFLW.............VRVFQi.kKGRTPP..QAL.....LIA...TVLLALI--................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ilainyavamlv............................................................................................................................................................................................................................................
W7LQM3_GIBM7/9-296                     ..................................................................................tsliwva-----YAVAV.VLC.FA.A.A.II......TTF..TW..QT..P...R...E.RSV..............................................................VVSIVAIVS..L..T..SLLAT.VL.LLPVDIAL..VSATA.........................................................................................................................................................................................................SATL..............GAKKD.WatpE...R...I..D..S.....ILy...tL...K.................VV...Y...YSLY.SFDA........LLCL..........................IV..IP.......FAY.F....W....HeE...........Y...DE....I....E....V.E..E.EG.............................RTL...-...SSR...F...LA.AA.K..YT.L.FF.V....AFV.V...VLFLLGffvpaagds..........................................................................................seshwdldyfKKLVAQNHG..eKA.LT..FAL..GLLLTMGTLLY....VV.YTGAG.LALL...PISFIKaapsisapql...........................................hqttasqleqNRERQRQI.EM.R....N.A.----..-....----..-----Grqegm.........................................................................................................................srkdqRELD........AL.VREE...QTL..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vrrerlaaeaqge...........................................................................................................................................................................................................................................
A0A0N1HHB2_9EURO/11-302                ......................................................................................liw---VVYAIAV.ALL.LA.I.A.SL......FVY..LY..QT..H...R...D.RSA..............................................................GVTTVCIFT..I..T..CLLAT.VL.LLPVDVAL..VSSTTs......................................................................................................................................................................................................skN-GLrk..........dwATQDK.V...D...Q...I..T..Y.....-T.....L...E.................IV...Y...YLLY.SLDA........VLCL..........................LV..VP.......FTY.F....W....Y.E...........E...YD....E....V....A.A..E.EGsq........................tlgSRF...-...WGA...F...KY.TA.V..FV.F.LC.V....ALF.L...VGFFIPvakhreg..............................................................................................ahfdldffKRLLAENHG..eRA.LT..FAL..GLLITIGVLIY....CF.YTAAG.LALL...PLTLIKsapsisap...............................................alnesttaQLESNLE-.RQ.R....Q.L.EGRA..Q....GSNG..LSAKDQ...................................................................................................................................RELD........AL.VREE...RTL..RRH.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------qrmaeentgegqnffwk.......................................................................................................................................................................................................................................
K1WGC1_MARBU/10-520                    ........................................................................................g-SLIFTVTAL.LVI.SL.G.V.LL......LLR..HY..LP..L...R...T.TPA..............................................................YLLVPIFFA..L..S..LPASI.IL.LVPIDLAS..SARNQ.........................................................................................................................................................................................................D---..............AGGSR.G...I...W...L..P..D.....RA.....L...L.................VG...W...RISY.WLTF........ALTW..........................FI..LP.......VLA.E....Y....A.D...........A...GY....R....D....P.K..G.RL.............................LYS...L...RAN...A...QY.QA.L..VL.G.AG.I....IGM.I...YVFVS-.............................................................................................................YQASLN---...SL.KG..TVM..VLAYVWGLMLA....IY.LMGHG.LVAL...PRRLFR...............................................................--NASISG.RL.R....R.I.QANA..A....KVHE..KMEDAI...................................................................................................................................RLLE........DC.EAQV...AAL..AQR.KT..GSA...........................................S..kFK...DWI.....EELADnsh.................................................................lpeSRPHTLTRRMSEpq..............................................................................vnvP--Hv.iTER....................................................................................................................................YLAELS...RQLD...RA...........................................................RH...SR....AR...Y...L...D.........EWDG...LLRDA....VETQ.................................................................................................................................AILD.S....A.G...S.K........K...I....E....IGQA.--.............SPDA..RF.LERF............--TILT..PYT.R.YL.Y.L...YFL...L.....P......Y.M.RI.ALGVF.LSMASFC..IV.WSEVIKSV-...........................NPLLS.......IIAVTVV..H..H.....P....T.S..ERG.QIGFa...................gQ.V.IAAC.WI.L..YM...C.MA.ALTSLTEVKV....WRG.............RALVK...-RNTHG..ESA.....MWY...SMQVAKLSV................PLA....F.NF...L..TFLAPDi...................................................ysETVFYQ......F.....L.G...K..L.I...K.....L..T.Q..LG-E..RFD.WLF.PT..FILIPV.CATLFEFY........................................................................................................................................................................................................................................................
E1Z6S9_CHLVA/4-293                     .......................................................................................fl--IIITVVVA.ILV.LL.V.S.LY......LVV..HF..QH..P...E...D.KNQa............................................................wLPKLVVLLG..F..S..VAFWT.IL.LFPLDVAN..-----.........................................................................................................................................................................................................QQAC..............ELDIP.L...S...S...C..S..T.....MP.....M...K.................EL...W...YAMY.IANM........AITF..........................IA..VP.......FCI.F....Y....Y.E...........A...DS....D....W....S.-..-.-V............................fRRS...-...-LS...G...AL.WA.A..GT.V.FV.M....AIL.I...GIPYAFagnaqytvqgarsgllpisylsnaedsftnc..............................................iglfsyydqdsgqpklnstlvslgyncdtlinQLSEVWTIR..vSI.IV..YAM..AIVATLGWVLF....MV.FGGIG.LVAL...PIDWIR...............................................................EFIARPKA.TI.T....R.S.Q---..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------yidrardlarrakdilaladalkreere............................................................................................................................................................................................................................
G3VS13_SARHA/1-546                     .........................................................................................MSGAALGLEI.VFV.FF.L.A.LL......ILH..RY..GD..F...K...K.QHR..............................................................LVIVATLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRckqaansspse...................................................................................................................................................................................nnnitgsysaaA--Pvt.........gkhPCFKP.W...S...Y...I..P..D.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PNLHLE-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSHWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DI.MEQI...IKV..IES.IK..SP-...........................................-...LE...LCV.....DRLLS.......................................................................ECPTEYQEKMGRnmddye.......................................................................dfdekhNTYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWRI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FQp...........qEPEN..RF.IQY-............---FYS..PTI.E.WY.W.E...CLL...R.....P......W.F.YR.ILAVV.LAIFSVI..VV.WSECTFFST...........................KPVLS.......LFAVFI-..Q..L.....A....E.R..TYN.YIYI.....................E.I.ACFL.SI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDstis.............................................hqdtqPTAYTS......I.....M.G...S..M.K...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
G1SF20_RABIT/256-450                   ......................................................................ssveynimelelelenvkt----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............-LKT..KL.ERRK............KASAWE..RNL.V.YP.A.V...MVL...L.....-......-.-.-L.IETSI.SVLLVAC..NI.LC----LLVde.......................taMPKG-.......TRGPGIG..S..A.....S....L.S..TFG.FVGA.....................-.A.LEII.LI.F..YL...M.VS.SVVGFYSLRF....FGN.............F--TP..kKDDTTM..TKI.....IGN...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAIVT.TLCLVRKF........................................................................................................................................................................................................................................................
H0WS37_OTOGA/21-258                    .........................................................................................RECIISTLLF.ATL.YI.L.C.HI......FLT..HF..KK..P...A...E.FITvdded....................................................atvnkIALELCTFT..L..A..VALGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEVLl...........slPRNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLVF.LFSN........LSVI..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....A....G.S..R.KGv...........................lGRV...-...YET...V...VM.LM.L..LT.L.LV.L....GMV.W...VASAIVdn........................................................................................................nkaSRESLYDFW..eYY.LP..YLY..SCISFLGVLLL....LV.CTPLG.LARM...-FSVTGkll.........................................................vkpRLLEDLEE.QL.Y....C.S.AFEE..A....ALTR..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ricnp...................................................................................................................................................................................................................................................
U1NQR3_ASCSU/16-128                    ......................................................................................qlt---LVMFVEW.TFV.FF.V.T.LF......LLH..KF..GS..I...R...K.QHI..............................................................IVIVSTFIG..W..F..SSFTI.IT.ILPEDIAV..ALYKRcllekt.............................................................................................................................................................................................gwtdatN--Lt...........tkECGVK.D...N...F...V..S..D.....HV.....L...L.................ST...W...RVMY.WTAQ........LLTW..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ehv.....................................................................................................................................................................................................................................................
H2ASV5_KAZAF/1-485                     .....................................................................................mfwl-----VLFGC.VFT.VC.T.S.VL......TTD..RY..FS..F...K...M.HKNt...........................................................fpFVLLILTLN..M..M..LLLGT.DF.LLPFDVFQ..AS--Avgsng..............................................................................................................................................................................................htnkplNETT.............vQELSH.L...R...K...R..S..N.....NVr...fF...E.................II...W...PLIY.WLQF........AFCW..........................FL..IP.......VGI.S....Y....I.S...........L...KYalprD....D....R.R..E.RF.............................IKS...I...LQN...V...KF.YS.L..CL.L.GI.I....IGS.L...YLIMS-.............................................................................................................TGHNLL---...EF.KS..LII..TLSHLYSLSYT....LI.LLSTG.LIIL...PRDLIN...............................................................--SVKVPS.AI.S....N.N.KLFVvlS....KTND..DVNDSQ...................................................................................................................................LNLV........--.-DNA...DLIlsSNE.LN..NGD...........................................-...--...VTF.....NQLLN.......................................................................ECKIEIESKLDD...................................................................................L---...KIS....................................................................................................................................TANRVS...TELP...KP...........................................................IT...NL....RK...L...N...S.........TYNK...FINHY....----.................................................................................................................................----.-....-.-...-.-........Y...N....Y....IYYQ.--.............NHSN..SI.IHTL............-----A..QTQ.S.NS.I.N...-NL...K.....K......I.A.VF.IIGLI.ATILSFL..II.ICE--ILPK...........................KMNF-.......LDKWLF-..-..-.....-....H.N..GDN.YYNF.....................-.L.IIFT.IL.S..YN...T.IS.SLYAMSKFK-....FNN.............FHLIS...NGNSNP..SNV.....FYY...SLYSSRLLF................PLC....F.NL...I..TLLPNNq....................................................kRSTFQI......I.....L.F...D.rL.N...V.....I..P.-..LV-K..FLN.NYL.PM..IFMVLI.PLS-----yr......................................................................................................................................................................................................................................................
LMBD3_SELML/233-382                    ................................................................................glqreergg----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....-K...K...G...R.........MFRK...NVKKV....----.................................................................................................................................----.-....-.-...-.-........Q...Q....E....LVFL.EDd...........vEALN..EA.FPQG............EK---T..LTV.L.FY.L.A...KLV...F.....G......I.V.GL.ALSII.WLLHIIV..FM.LV-------...........................NPPAFp.....fLNQVFIQ..L..-.....-....D.T..VGG.LLGT.....................-.T.TFAI.FC.Y..YL...V.MS.VISGKMHLGM...rLLF.............LSIHPm.kYQGTL-..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------dpmwhenv................................................................................................................................................................................................................................................
K7UL18_MAIZE/1-497                     ......................................................................................mwv----FYLISL.PLT.LG.M.V.VV......TLR..YF..AG..-...P...A.VPR..............................................................YVVATVGYA..W..F..CSLSI.II.LVPADIWQ..TLTAS.........................................................................................................................................................................................................----..............-----.-...-...-...-..A..K.....GG.....I...G.................FF...W...SWSY.WSTF........ILTW..........................AV..VP.......TIQ.G....Y....E.D...........A...GD....F....T....V.K..E.RL.............................KTS...I...HMN...L...LF.YS.I..VG.A.IG.L....IGV.I...LLLIM-.............................................................................................................H--RAW--D..gGI.VG..FAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PRNIWK...............................................................--NAYWSH.RQ.K....V.L.SHRV..A....KMAV..KLDNAH...................................................................................................................................QEYS........NA.IVVA...QAT..SNQ.MS..KRD...........................................I...LR...PYM.....DIIDN.......................................................................MLSQMLREDPSFkpsggr.......................................................................fgendmDYDT...DDK....................................................................................................................................SMATLR...RQLR...RA...........................................................HE...EY....YR...G...K...S.........EYMT...CVMEA....LKLE.................................................................................................................................DTIK.N....Y.E...R.R........D...AsgwkY....VSS-.FR............dRRSG..TL.GPI-............-----L..DTI.E.FI.W.Q...CIL...R.....K......Q.L.QK.AFAVI.LGCMSAA..IL.LAEATLLP-...........................SVDLS.......LFSILIK..V..V.....G....-.-..-KQ.EVLV.....................Q.V.AAFV.PL.M..YM...F.IC.TYYSLFKIGM....LMF.............YSLTP...-RQTSS..VSL.....LMI...CSMVARYAP................PIS....Y.NF...L..NLIRLGg...................................................naKTTFEK......R.....M.G...N..I.D..dA.....V..P.F..FG-R..GFN.KIY.PL..IMVVYT.LLVASNF-f.......................................................................................................................................................................................................................................................
S7Z799_PENO1/8-289                     ......................................................................................liw---IVYAVVI.AAL.LA.I.A.SI......FIY..IY..QT..P...R...D.RSP..............................................................SVTITCIIA..I..T..CLLAT.VL.LLPVDVAL..VSSTT.........................................................................................................................................................................................................SSQLgrr........kdwASQDA.V...D...R...I..T..Y.....SL.....-...T.................VV...Y...YALY.SADA........LLCL..........................LV..LP.......FTY.F....W....Y.E...........E...YD....E....V....A.A..E.AGeq........................tlgSRL...-...WGA...F...KY.TL.F..FI.A.IV.V....ILF.L...V----Gffvpvskd............................................................................................kdnmdldyfKRLLTENHG..eRA.LT..FAL..GLLITLGICLY....VL.YTSAG.LALF...PVSLIKtapavsspm.............................................lqattaqqlE-------.--.-....-.-.----..-....-VNQ..E-----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rqrqlegrcggnpdllsskdrreldtltreertlirrqrlveeaq...........................................................................................................................................................................................................
A0A067ERY6_CITSI/1-83                  ........................................................................................m----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................--------R..tTF.PE..YVV..ALATIVGSVLF....SI.FGGVG.IACL...PLGLIFsfirrpka...............................................vitrsqyiKEATELGK.KA.R....E.L.KKAA..D....TLHQ..E-----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ersgsk..................................................................................................................................................................................................................................................
I0Z9H7_COCSC/123-436                   ............................................................................slagnddrvgrag----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....---E..KLEDAV...................................................................................................................................VEMT........RV.ATVV...EAT..SQP.MP..RRD...........................................P...LR...KYM.....DIIYReaeegsp.........................................................ikpgqalR----------Dergrvnl....................................................................ddltdtdlD--Yg.cDEK....................................................................................................................................SLASLR...RRLK...RA...........................................................IN...TY....DG...L...L...A.........EYVD...AVKLA....MELD.................................................................................................................................IIIK.C....K.T...A.G........D...Y....S....LASS.TD.............--SA..TP.V---............---SGF..TKT.W.RM.Y.S...CTA...K.....P......W.V.TR.VLACV.LGAVSFL..IV.WSEATIASG..........................tNPDLS.......PFSHMVN..G..G.....-....-.A..QSE.AM-T.....................Q.L.LTSL.PL.A..YM...A.TC.CYYSLFKLGM....FSF.............YHVVP...-HATNA..HSL.....LMN...AAQVTRFAA................PLA....Y.NY...L..HVIRMHeyl...............................................gpdkATVFAQ......E.....M.G...T.aI.R...D.....V..P.V..FG-T..NFN.TCF.--..------.--------lnvw....................................................................................................................................................................................................................................................
J9HWH3_9SPIT/1-417                     .........................................................................................----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......-MI.E....Y....F.N...........S...GD....F....T....V.K..E.KL.............................IRA...-...IKN...F...VP.QF.I..LY.I.VF.F....VIA.I...VILACY............................................................................................................eGGRDAL-RQ..qGA.LG..CLI..GLSLIFGFLEL....VI.LLGYG.LVQI...PFSFFR...............................................................--MASNNR.RL.K....V.F.QYKV..T....QYEE..ILNKKA...................................................................................................................................IKCQ........KL.ISVA...NQV..KVK.KD..HEQ...........................................-...YK...VHI.....QETINnfvka............................................................ieeedlK----------Isakpqkq.....................................................................vkleesyQGIL...KYN....................................................................................................................................QLIKLR...KKIK...FQ...........................................................TI...DI....LR...L...L...N.........FKKE...AIQKA....IFQQ.................................................................................................................................DIVD.A....V.S...R.G........D...S....Q....IQSY.YL.............KDRD..PM.SCWD............RT---A..ISF.T.YL.W.Y...TQW...K.....P......F.L.ML.ALALI.FTGLSIL..VL.VAELLYCFG..........................vKNDI-.......LYNLLVA..T..D.....L....D.A..ASN.YIVD.....................N.I.VCLI.PL.I..YL...I.AT.TNYGLFKLRL....SKI.............YALHP...NHHTDP..GCL.....LYS...CLFIMRLSI................PIV....Y.NF...Y..MLSQVE......................................................QAAAFQ......V.....L.A...P..L.S...N.....V..R.F..MG-E..SFNkYVF.PA..LLTLMI.LLTIFNLY........................................................................................................................................................................................................................................................
A0A0V1AAZ9_9BILA/278-474               .....................................................................veeemnviwlsclrnlanly----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............AQRK..LF.QKEL............NSISWL..SVV.I.YP.A.L...FVV...I.....-......-.-.-L.AITAL.SVLSVVW..NV.F----QITIg........................frRLPIA.......IEDFELG..S..S.....S....L.S..FLG.FYGA.....................-.F.IEII.IT.L..YL...M.LA.SLIGFYSL--....PVF.............CRLKP..iRNGTSM..TRL.....IFN...CTSTLVLSSa..............lPVL....A.RV...L..GLTNFD......................................................------......L.....L.G...N..Y.S...Q.....L..N.W..LGNI..YFV.LMY.NL..MFTFAV.ICVSLTL-l.......................................................................................................................................................................................................................................................
I1KSY6_SOYBN/26-525                    ......................................................................................rem---WVFYLIS.LPL.TV.G.M.VL......FTL..RY..YA..A...P...H.VPR..............................................................YVLLTVGYT..W..L..SSLSI.II.LVPADIWT..TISSN.........................................................................................................................................................................................................H---..............-----.-...-...-...-..D..N.....GG.....I...S.................FF...W...SWSY.WSTF........LLTW..........................AV..VP.......LIQ.G....F....E.D...........A...GD....F....T....V.S..E.RL.............................KTS...L...HVN...L...IF.YL.I..VG.S.IG.L....FGF.I...LLIMM-.............................................................................................................HKRW----S..gSL.LG..LAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PKSIWR...............................................................--NADWTT.RQ.K....V.L.SHKI..A....KMAV..RLDDAH...................................................................................................................................QELS........NA.IVVA...QDT..SNQ.MS..RRD...........................................P...LR...CYM.....DVIDD.......................................................................MLTQMFREDPSFkpqggr.......................................................................lgesdiDYDT...DEK....................................................................................................................................SMATLR...RHLR...GA...........................................................TE...EY....YR...Y...K...S.........VYMT...YVLEA....LQLE.................................................................................................................................DKIK.N....Y.E...R.R.......nS...T....G....WKYI.SSf..........rpARTG..KF.---G............---SLC..DTL.E.FF.W.Q...CIL...R.....K......Q.V.QK.GLAVI.LGVMSVT..IL.LAEATLLP-...........................SVDLS.......LFSILIK..S..-.....-....-.V..GTQ.EVLV.....................Q.V.LAFV.PL.M..YM...C.IC.TYYSLFKIGT....LVF.............YSLTP...-RQTSS..VSL.....LMI...CSMIARYAP................PIS....Y.NF...L..NLIRLGs...................................................dkTTIFEQ......R.....M.G...N..I.D...N....aV..P.F..FG-D..KFN.RIY.PL..IMVIYT.LLVASNF-f.......................................................................................................................................................................................................................................................
W9Z916_9EURO/27-307                    ......................................................................................liw---VVYATAI.VLL.LS.A.A.SL......FVY..LY..QT..H...R...D.RSI..............................................................FVTIVCIFT..I..T..SLLAT.VL.LLPVDVAL..VSSTSsskl................................................................................................................................................................................................grrkdW---..............ANQDK.V...D...N...I..T..-.....FT.....L...R.................VV...Y...YFLY.SLDA........ILCL..........................LI..IP.......FTY.F....W....Y.E...........E...YD....E....V....A.Q..E.EGsq........................tfgSRF...-...--W...A...AF.KY.T..MV.F.IF.L....CVA.I...FLVGFFvpvarhre............................................................................................gahfdldffKKLLAENHG..eRA.LT..FAL..GLLITIGIIIY....CF.YTAAG.LALL...PLTLIKtapgisapal...........................................testaaqlesN-------.-L.E....R.Q.RQLE..-....----..-----Graqgnpd.....................................................................................................................glsskdqRELD........AL.VREE...RTL..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rrhqrlaa................................................................................................................................................................................................................................................
A0A0A0ANW3_CHAVO/237-430               ............................................................................mveyqtvelerel----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....-E--.-Kv...........kSKKT..NL.ERRK............KASAWE..RNL.V.YP.A.V...MIL...L.....-......-.-.-L.IETSI.SVLLVAL..NI.LY---LLVDe........................taMPKGS.......-GGPGIG..N..A.....S....L.S..TFG.FVGA.....................-.A.LEII.LI.F..YL...M.VS.SVVGFYSL--....RFF.............ENFTP..rKDDTTM..TKI.....IGN...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAIMT.TLCLVRKF........................................................................................................................................................................................................................................................
S9VAI4_9TRYP/5-279                     .....................................................................................wliv----LIVVIP.IIV.IL.L.A.VY......VLL..FF..QT..T...E...D.ATSd............................................................iVYKVFFVLA..T..V..VGLGS.VL.LLPFDVAN..SPD--.........................................................................................................................................................................................................---P.............tVENKY.S...N...T...L..D..-.....--.....T...A.................LM...W...QIML.WTMA........ALAV..........................VF..CP.......FLM.F....F....Y.E...........G...QD....P....D....K.P..K.IG.............................KQI...-...-AH...G...II.MT.I..II.F.GI.F....AII.T...GVCYWKvgvalvpyedwstyp...............................................................................qnvevngssitynstYTNATLTID..vSF.TT..YCI..GMLCFFGWIFF....LF.YGGVG.MLAW...PIRTLL...............................................................----NFKN.RL.K....R.I.--NA..S....RFTQ..EMAIVL...................................................................................................................................AKAE........AL.LEVA...VNL..QKQ.AR..G--...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------kmsrgtknkiniirnevyf.....................................................................................................................................................................................................................................
A0A093C3S7_9AVES/235-430               ..........................................................................sstmeyqtvelerel----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....-E--.-Kv...........kSKKT..NL.ERRK............KASAWE..RNL.V.YP.A.V...MIL...L.....-......-.-.-L.IETSI.SVLLVAL..NI.LY---LLVDe........................taMPKGS.......-GGPGIG..N..A.....S....L.S..TFG.FVGA.....................-.A.LEII.LI.F..YL...M.VS.SVVGFYSL--....RFF.............ENFTP..rKDDTTM..TKI.....IGN...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NF..LFAIMT.TLCLVRKF........................................................................................................................................................................................................................................................
J3QM78_MOUSE/107-255                   .................................................................................gyagmkgg----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.-I............................rARI...-...LET...L...VM.LL.L..LA.L.LI.L....GMV.W...VASALIds........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpAILEDLDE.QI.Y....M.I.TLEE..E....ALQR..RLHGLS...................................................................................................................................SSVE........--.-YNV...MEL..EQE.L-..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------envkilktklerrk..........................................................................................................................................................................................................................................
U6H622_9EIME/55-345                    .....................................................................avntrpkpggiaarrrraqq----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.--QL..Q....QLQQ..QQQQQQqaaaadpqpgeaaaaaaadatqqqrtaaaarpppppppsas.................................................ppptaaaagagaaaaaaggggaaaaeskgeiihrkcsekhhRKMQ........QM.QQQM...QQQ..QQQ.QQ..MQH...........................................Q...QQ..hKHQ.....QQQHH.......................................................................QEQHQHQQ---Qq................................................................................hhQEQQ...QHH....................................................................................................................................HLQQQQ...QQQH...QQ...........................................................HH...QQ....QQ...E...Q...Q.........QQQQ...QHQQH....----.................................................................................................................................--QH.H....Q.Q...Q.Q........E...Q....H....HHHQ.QQq...........qQQQE..QQ.QE--............-ERRMH..GQY.Q.IL.L.L...MLL...L.....L......M.V.LL.LMVLL.LLMMVLL..VV.VVVMVV---...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vvvmrspytcyaedaaaaaaaaaaat..............................................................................................................................................................................................................................
A0A091J168_9AVES/232-428               ............................................................................vsstveyqtaele----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...R....E....LEKV.-K.............SKKM..NL.ERRK............KASAWE..RNL.V.YP.A.V...MIL...L.....-......-.-.-L.IETSI.SVFLVAL..NI.LY---LLVDe........................taMPKGS.......-GGPGIG..S..A.....S....L.S..TFG.FVGA.....................-.A.LEII.LI.F..YL...M.VS.SVVGFYSL--....RFF.............ENFTP..rKDDTTM..TKI.....IGN...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAIMT.TLCLVRKF........................................................................................................................................................................................................................................................
M0SFK9_MUSAM/310-540                   .................................................................................lgkkarel----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...KKTI...ET...........................................................LH...QE....ERsgsK...G...R.........KWRK...NLKEA....----.................................................................................................................................----.-....-.-...-.-........E...K....E....LFLL.EDd...........mKALE..EM.YPQGe..........qAETVWA..LTV.L.GY.L.A...KFV...L.....G......V.V.GL.IVSVA.WVAHIVI..YL.LI-------...........................NPPLSp.....fLNEVFIK..L..-.....-....D.S..VWG.LLGT.....................-.A.AFAI.FC.F..YL...L.LA.VIAGEMMLGL...kLVF.............FTIHPm.kWGGTLM..NSF.....LFN...VGLILLCSIsviqfcasafayysqaTAA....Q.EI...F..GHT---......................................................------......-.....-.-...-..-.-...-.....L..Q.S..LRGI..KYL.YKY.NV..FQYGFV.GFAVLTLF........................................................................................................................................................................................................................................................
A0A078CG22_BRANA/274-489               .................................................................................rqeekgga----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...K...G...R.........AWRK...NVKAV....----.................................................................................................................................----.-....-.-...-.-........E...K....E....LLQL.EEd...........vNLLE..EA.YPQGe..........kAETAWA..FTV.L.GY.L.A...KFI...L.....G......I.I.GL.IVSIA.WVAHIII..YL.LV-------...........................DPPLSp.....fLNEVFIK..L..-.....-....D.D..VWG.LLGT.....................-.A.AFAF.FC.F..YL...L.LA.VIAGAMMLGL...kLVF.............ITIHPm.kWGATLM..NSF.....LFN...VGLILLCSIsviqfcatafgyyaqaT--....-.--...-..------......................................................--AAQE......I.....F.G...H..T.-...-.....L..Q.S..LRGI..KYL.YKY.NV..FQIGFV.ILAGLT--fl......................................................................................................................................................................................................................................................
H2TMI7_TAKRU/18-259                    .........................................................................................REYIICFLIF.AVL.YI.V.S.YC......IIT..RY..RK..K...S...D.DHEdeda......................................................vvnrISLYLCTFT..L..A..VSGGA.VF.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........sfPKNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLVS.LFSN........LSLF..........................VL..MP.......FAY.F....F....L.E...........S...EG....F....A....G.S..K.KGi...........................kARI...-...LET...F...VM.LF.L..LA.L.LI.L....GIV.W...VASALIdnd......................................................................................................aasmESLYVD-LW..eFY.LP..YLY..SCISLMGGLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDLDE.QI.Y....C.I.HLQE..E....ALQR..RLNES-...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------gcflp...................................................................................................................................................................................................................................................
U6PKA3_HAECO/70-584                    .........................................................................................RQQIICLIIF.ISL.YL.L.S.YW......IIS..LF..KS..K...S...D.NDSlyagde..................................................dyivyrISVWMCSAS..L..A..VSIGS.IA.LLPFSVVS..-----.........................................................................................................................................................................................................SELLq...........ryPDNYY.L...Q...W...M..S..W.....SL.....I...N.................SL...W...NYVF.ALSN........LSLF..........................VL..LP.......FSY.F....F....I.E...........S...QG....F....S....K.N..K.NGi...........................mQRV...-...YET...L...AV.CA.L..LI.V.VI.L....CLV.D...VVLTLVss.........................................................................................................spLQVSLISIT..sVN.LP..LIY..SFVSFAGVMLL....LL.STPIG.FAKM...-FGIVG...............................................................------EM.TM.N....S.I.----..-....SIPD..QDDIIV...................................................................................................................................DRLE........RY.CEAR...KAG..KYG.TN..NNI...........................................-...-H...KNS.....FEAMSpfyspashgysp..............................................vrlrsfrmtpigfN----------Trsdcsekcy.................................................................lfsssiygfA-SE...SNT....................................................................................................................................SSASNG...WSEN...TQ...........................................................IS...SE....ES...R...S...V.........SYGR...AVRPQ....IVAG.................................................................................................................................QILN.P....L.H...Q.K........S...L....R....FC--.--.............----..--.-KH-............----FI..RIV.K.YP.A.I...VIS...L.....-......-.-.-L.ALTGI.SLLMVVI..NS.LK----LVF..........................gFRSLP.......AYAQYME..V..H.....T....R.H..SLG.IVGV.....................-.I.IESI.TI.M..YV...M.ST.SLTGLYSM--....PFV.............RALRP..qRARTSL..TVI.....IIN...CSLVLVLSSa..............lPVL....A.NT...L..GITSFD......................................................------......L.....L.G...A..Y.S...S.....L..K.W..LSNF..KLV.LAY.NV..LFAAAT.IVCVFSQ-i.......................................................................................................................................................................................................................................................
A0A0L1HKF7_9PLEO/9-286                 ......................................................................................iwv----AYAVAI.GLL.FL.V.A.AT......FIY..VY..QK..P...R...D.RAA..............................................................AVTIVCIFT..T..L..SLLAT.VL.LIPVDVAL..VSSTS.........................................................................................................................................................................................................RSSL..............GRKKD.WatpE...K...V..D..S.....ILy...tL...R.................IV...Y...YTLY.SLDA........VLCL..........................LV..IP.......FTY.F....W....Y.E...........E...YD....E....D....A.A..E.HGeq........................tagQRI...-...-GA...A...LK.WT.L..GF.L.VF.V....VAI.F...LVGFFVpfakqakdd...........................................................................................krldldyfkH-LLSENHG..eRA.LS..FAL..GFLITVGTVLY....VL.YTGAG.LALL...PVAMIKsaps.......................................................vsapTLAAN---.--.-....-.-.--TA..S....QLET..NRERQR...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------qlegrnqgreggldsrdrrelealvreertlirrer....................................................................................................................................................................................................................
A0A0D9YYG2_9ORYZ/1-498                 .....................................................................................mwvf-----YLISL.PLT.LG.M.V.TV......TLR..YF..AG..-...P...G.VPR..............................................................YVIATVGYA..W..F..CSLSF.II.LVPADIWT..TLTGR.........................................................................................................................................................................................................----..............-----.-...-...-...-..E..K.....GG.....I...G.................FF...W...SWSY.WSTF........ILTW..........................AV..VP.......TIQ.G....Y....E.D...........A...GD....F....T....V.K..E.RL.............................KTS...I...HMN...L...LF.YS.I..VG.A.IG.L....FGL.I...LLLVM-.............................................................................................................H--RAW--D..gGI.VG..FAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PRNIWK...............................................................--NADWTH.RQ.K....V.L.SHRV..A....KMAV..KLDNAH...................................................................................................................................QEYS........NA.IVVA...QAT..SNQ.MS..KRD...........................................L...LR...PYM.....DIIDK.......................................................................MLAQMLREDPSFkpsggr.......................................................................lgendmDYDT...DDK....................................................................................................................................TMATLR...RQLR...RA...........................................................HE...EY....YR...C...K...S.........EYMT...YVMEA....LELE.................................................................................................................................DTIK.N....Y.E...R.R........D...An.gwK....FVSS.FR............eSRPG..TL.----............--GSLL..DTM.E.FI.W.R...CVL...R.....K......Q.L.QK.GFAIV.LGCMSAA..IL.LAEATLLPS...........................GVDLS.......LFSILVK..S..V.....G....-.-..-KQ.EVLV.....................Q.V.AAFV.PL.M..YM...C.IC.TYYSLFQIGM....LMF.............YSLTP...-RQTSS..VSL.....LMI...CSMVARYAP................PIS....Y.NF...L..NLIRLGg...................................................daKTTFEK......R.....M.G...N..I.D..dA.....V..P.F..FG-R..GFN.RIY.PL..FMVVYT.LLVASNF-f.......................................................................................................................................................................................................................................................
A0A194XVS9_9HELO/8-296                 .....................................................................................fiwv----AYAVAV.ALV.AL.I.A.AI......FTY..TY..QT..P...R...D.RSA..............................................................LVSTITIIT..L..T..SLLAT.VL.LLSVDIAL..VSSTN.........................................................................................................................................................................................................--SVkl..........gaKKDWA.T..pD...T...V..K..N.....ILy...tL...E.................IV...Y...YTLY.SLDA........LLCL..........................LV..VP.......FTY.F....F....Y.E...........E...YD....D....V....E.A..E.EG.............................TQT...F...SQR...F...MG.AL.K..YT.L.IF.V....VLV.V...IIFLVGffvpvawnrng.......................................................................................shhewndfdyfKGLLSENHG..eRA.LT..FAL..GLLICLGTLLY....IL.YTAAG.LALL...PISFIKsapsisapq.............................................lsettasalEQNRERQ-.--.-....-.-.----..-....----..-----Rqlegrnagr.................................................................................................................edgmpakdqRELE........AL.VREE...RT-..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------lvrrerlaaeargd..........................................................................................................................................................................................................................................
A0A151P8D5_ALLMI/143-329               .......................................................................vlrekllvirsrrmalel----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.--RQ............RASPWQ..RNL.G.YP.L.A...MLC...L.....-......-.-.-L.ALTGI.SVLVVCV..HV.L-ELLLYDA..........................aMPRG-.......TQDAPLG..K..V.....S....F.S..IFG.SFGA.....................-.A.LQVI.LI.F..YL...M.VS.SVVGFYSS--....SLF.............MRLLP..qKQDTPM..TKI.....IGN...CVSLLVLSSa..............lPVF....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..D.W..LGNF..YLV.FLY.NV..LFAALA.ALCLVKKF........................................................................................................................................................................................................................................................
A0A0N5E3P7_TRIMR/16-275                .........................................................................................REYIICLLLF.IAL.CV.L.S.YL......LIS..YL..RL..P...I...E.KDGfytnae.................................................sdyavyqTSTWMCTFA..L..A..VSLAA.IL.LIPFSILS..-----.........................................................................................................................................................................................................NELLv...........hyPNSFY.F...R...W...L..N..G.....SL.....L...R.................SL...W...NFVF.AFSN........VCAF..........................LL..LP.......FGY.F....L....L.E...........S...HG....S....N....N.M..-.-Lhsf.......................dvmPRM...A...EAS...L...MC.AF.T..FV.L.TV.L....AGQ.G...LISLLVkrs......................................................................................................dtteSLRSMW-WW..fAD.LP..TVY..SYISFFGMCIL....LT.CTPIG.LGRI...-FTLIDeiv.........................................................ekpKDSTDLLR.KL.D....H.L.TCEI..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vyrkrilsrsrtladgcgaekiaaa...............................................................................................................................................................................................................................
E1BV17_CHICK/1-543                     .........................................................................................MSGAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIIATLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRcklavnssp......................................................................................................................................................................................aesnssfvtlA--Ps...........kqQCFKP.W...S...Y...I..P..N.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PKFNLQ-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSHWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DI.MEEV...RKV..SES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQERMGRnmddye.......................................................................dfderqNSYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FQs...........qEPEN..KI.IQ--............--YFYT..PTV.E.WY.W.E...CLL...R.....P......W.F.YR.VLAVV.LATFSVI..VV.WSECTFFST...........................RPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.M.ACFL.TI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDatis.............................................htdaqPTAYTS......I.....M.G...S..M.K...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
A0A087SCC2_AUXPR/423-600               ...................................................................................frgedp----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............-EYKWV..WMI.M.KY.W.L...KLV...V.....G......I.L.SI.GVTIS.WILQIIL..YI.LI-------...........................SPPVSp.....lLNTAFT-..-..K.....A....D.A..VFP.LFGT.....................-.L.LFAL.WA.F..YL...Q.AA.VIKGNFKFGL...nLLL.............FRVHPm.rRGATFM..SSF.....LFN...IALLLLASTa.............avQFC....S.EA...F..ALYAEN......................................................-SDILN......I.....F.G...-..-.A...Q.....L..T.S..LQGL..SWL.YNN.SI..FIYILL.GMTLLTL-i.......................................................................................................................................................................................................................................................
A0A0G2J9H4_9EURO/8-444                 ......................................................................................liw---IVYAVVV.VIL.IA.V.A.SI......FFY..IY..QT..P...R...E.RSA..............................................................YVTTVCIFT..L..T..ALLAT.VL.LLPVDVAL..VSSTTspke................................................................................................................................................................................................grrkpW---..............ATQDE.V...D...K...I..T..-.....-F....sL...T.................VA...Y...YFLY.SLDA........VLCL..........................LV..VP.......FTY.F....W....H.E...........E...YD....E....V....A.V..E.EGlq........................twgKRF...-...WGA...F...KY.TI.A..FI.L.LA.V....ILF.L...VGF--Fvpvarnrd............................................................................................spsfdldyfRKLLTENHG..eRA.LT..FAL..GLLITVGILVY....VV.YTSAG.LALF...PVAFIK...............................................................SAPSISSP.TL.S....A.N.--TA..S....RLE-..ENIERQ...................................................................................................................................RQLE........--.----...---..-GR.CG..GNP...........................................-...--...---.....-----.......................................................................------------...................................................................................----...--D....................................................................................................................................TLSSKQ...RREL...DS...........................................................LV...RE....ER...T...L...R.........RRQR...LAEEA....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-R.............RERG..SW.LL--............KAWYKV..SAV.F.RP.L.K...LLG...G.....I......L.L.LV.IAMLV.WVSMLLT..SI.DKAMNSVCKqhcg...................yilgKTNIFn.....pVNWAFVE..-..-.....-....-.-..SAK.VFPV.....................DyV.LFIL.LV.L..LF...F.CS.SVVGIATIGI...rFLW.............IRIFQi.rKGHTSP..QAL.....LIA...TVMLTLIAL................ALN....Y.S-...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ismvvapq................................................................................................................................................................................................................................................
A0A0F7TD31_9EURO/12-545                ........................................................................................g-SNIFFAFAL.CSI.SA.L.V.LL......LLR..RF..LT..I...R...A.TPA..............................................................YLLVPIFLA..L..A..LPASV.VL.LVPIDLAS..SARNG.........................................................................................................................................................................................................T---..............--GPK.A...I...W...L..P..D.....RV.....V...L.................VC...W...RIAY.WLIF........MLTWyvhsdppfspvaigarlanafrvvfrAI..LP.......LLG.D....Y....V.D...........S...GY....R....E....P.K..A.RI.............................LYS...L...RSN...A...RY.QL.I..VL.S.CA.L....VGL.I...YISIS-.............................................................................................................IGFDPT---...SI.KG..TVM..ALAYVWGLVLA....IY.LMGHG.LVSI...PRNLFR...............................................................--NANVSG.RL.K....R.I.QAHA..P....KVHD..RLMDAV...................................................................................................................................NELE........SL.NSQV...AQL..QQR.KT..GTA...........................................R..dFQ...EWI.....EDLSEasgsgsgdvr..................................................vpilespetsgSVPSVITER---...................................................................................----...---....................................................................................................................................YLADLT...RRLQ...RA...........................................................RH...MK....AR...F...V...D.........EWDR...VVTLA....ADLQ.................................................................................................................................AIIN.S....T.A...S.K........K...L....E....FGTG.--.............PRRS..SW.LPKV............K--FLN..PYL.R.YQ.L.Y...SNI...I.....P......T.L.RL.IFGAV.FAFASVC..IV.WSELIKSL-...........................APQFS.......AITLTVV..P..N.....W....-.K..DEK.PLGFg...................sQ.V.IASL.WL.L..YM...C.SA.ALVGVSNVKV....WGN.............RALVR...-RNTYG..ESA.....CWY...ASLVARLTV................PIA....Y.NF...L..TFLPKDf...................................................rrTTTFYE......F.....L.G...R..L.I...N.....L..T.H..LG-K..GFD.YIF.PI..FILLPI.CATLFNLY........................................................................................................................................................................................................................................................
L9JSL5_TUPCH/1-330                     .........................................................................................MSGAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIVGTLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNR........................................................................................................................................................................................................cK---..............-HAAA.N...S...S...P..P..D.....NS....nT...T.................--...-...-GLY.ATAA........PVPR..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PRLHLE-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSYWN...............................................................--GAKKGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DV.MECP...TEY..QEK.MG..RNM...........................................D...DY...EDF.....DEKHN.......................................................................T-----------...................................................................................--YP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.V........T...H....Q....FVHT.FQs...........pEPEN..RF.TQYF............----YN..PTV.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------gtrclnllgfqqfm..........................................................................................................................................................................................................................................
A4S681_OSTLU/11-327                    .......................................................................................fl--IVVAIVVT.ALA.LA.C.N.VY......VLV..HF..QH..P...D...D.RNQa............................................................wFPKIVVVTG..L..T..LSVLS.IL.LLPLDVAN..-----.........................................................................................................................................................................................................RAAC..............DEAII.E...S...A...C..R..Y.....TL....pM...E.................DF...W...YATY.LTMF........AYMF..........................VL..VP.......WTL.F....Y....Y.E...........Q...DS....E....A....T.L..G.KKl...........................vSSS...I...WSV...A...TL.FV.L..L-.-.--.-....-MA.M...LLAYYVggeaefelksvksgmalignsalngatsci................................................alpsspttvtnfatytatmsgmdcdaygpnvGTETFT-VR..pTF.IV..YMI..AVASIISWFIF....LV.YAGVG.IVAL...PVDMIKgfmnrpqkvip........................................kseyircatilaR-------.DA.Q....A.I.HQQI..K....NVQK..EQRETG...................................................................................................................................RTKK........-T.KKDL...KEL..QVK.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------lsqleddevelm............................................................................................................................................................................................................................................
B3RQ62_TRIAD/240-427                   ....................................................................................rtele----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...E....E....FKLA.-Q.............KYRM..EL.ERKQ............EASPLQ..RNL.V.YP.F.C...LLI...L.....-......-.-.-L.VLTAI.SMLMVGL..HC.L-ELVLRT-...........................ETVGN.......KPKYTIG..E..V.....S....Y.S..KLG.FIGV.....................-.F.LQML.II.F..YI...M.AA.SLVGLYNI--....FPF.............NQMIP..qKKDSSM..PII.....IAN...CIVLLILSSa..............lPLL....S.KI...L..GITKFD......................................................------......L.....L.G...E..F.G...Q.....F..D.W..LKNV..TLT.FCY.NL..LFEGAT.AFCLVTQ-i.......................................................................................................................................................................................................................................................
LMBRL_MOUSE/268-455                    .............................................................................ellhrqvlalqa----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............-QRV..LL.EKRR............KASAWQ..RNL.G.YP.L.A...MLC...L.....-......-.-.-L.VLTGL.SVLIVAV..HI.L----ELLIde.......................aaMPRG-.......MQDAALG..Q..A.....S....F.S..KLG.SFGA.....................-.I.IQVV.LI.F..YL...M.VS.SVVGFYSS--....PLF.............GSLRP..rWHDTSM..TQI.....IGN...CVCLLVLSSa..............lPVF....S.RT...L..GLTRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.FLY.NA..AFAGLT.TLCLVKT-f.......................................................................................................................................................................................................................................................
G3NRH6_GASAC/13-424                    ......................................................................................gws----IFTCIL.LAI.LA.F.C.WV......YIR..KF..QS..R...Q...E.SEV..............................................................VSTITAICA..L..A..IALIT.SA.LLPVDIFL..VSFMKypn...................................................................................................................................................................................................gtyKEWA..............ANNDT.R...G...Q...I..E..D.....TV.....L...Y.................G-...Y...YTLY.SIIL........FCVF..........................LW..IP.......FVY.F....Y....Y.E...........E...RD....D....D....N.G..N.RC.............................SQV...-...KNA...L...KY.TF.G..FA.V.VC.V....VLL.L...IGAFVPlepppgqns..........................................................................................tqwekvqylfEELGSS-HG..lPA.LS..FSI..SSLTLIGMLAV....IT.YTAYG.MSVL...PLNLIK...............................................................GTRSVVYE.RL.E....N.T.----..-....----..------...................................................................................................................................EDID........DV.EHQI...EKL..KSK.CK..DGR...........................................-...--...---.....-----.......................................................................--PLSSRDR---...................................................................................----...--H....................................................................................................................................NLQELE...GKLQ...VL...........................................................QR...RG....RH...L...E...I.........AERN...CCTKV....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.GRAL............RPLKIL..LGV.F.FI.L.V...ALL...L.....-......I.V.AL.FISNL.DKALHSA..GI.SSGFIIFGT...........................NL--Tn.....pLNELLLA..L..-.....-....Q.P..VFP.-LDY.....................-.I.LITV.IT.M..YF...V.VT.SMAGIRNMGI...wFFW.............MRLYKi.rPKKTRP..QAL.....LFL...CMILLL---................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ivlht...................................................................................................................................................................................................................................................
W4H1U7_9STRA/1-289                     ...................................................................................mmnwfl--VVVVVIMA.VVF.LA.A.N.FY......ILV..YF..QH..P...D...D.KNTa............................................................yMPKVLVVIG..F..L..LAEAC.VL.LLPLDVAN..-----.........................................................................................................................................................................................................NSTA.............iGCTAG.W...N...A...A..C..G.....NL....dM...E.................TL...W...LIVF.MSIA........VFLV..........................VL..LP.......YSI.Y....F....Y.E...........S...DDg.fdD....S....S.A..K.KT.............................HRW...-...-LD...A...LK.LE.I..AT.V.VV.V....GII.V...AITYITsstsdipynvlvynstvgndtihiadav....................................................gglhsftdgaiispnervyamakglnplqTSMR---LD..vSV.PI..YIT..ALVSFVGWFAF....SI.FVGIG.LVAL...PLDLIL...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------afffrpkfipadvyaqqkmlvqirslelmevgkeikssm.................................................................................................................................................................................................................
A0A091NEB0_9PASS/1-543                 .........................................................................................MSGAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIVATLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRcklavnssp......................................................................................................................................................................................aesngsyvtlA--Ps...........kqKCFKP.W...S...Y...I..P..N.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PKFNLQ-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSHWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DI.MEEV...RKV..SES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQERMGRnmddye.......................................................................dfderqNSYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FHs...........qEPEN..KI.IQ--............--YFYT..PTV.E.WY.W.E...CLL...R.....P......W.F.YR.VLAVV.LATFSVI..VV.WSECTFFST...........................RPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.M.ACFL.TI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDatis.............................................hkntqPTAYTS......I.....M.G...S..M.R...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
A0A023B3V7_GRENI/1-254                 ........................................................................mfawwliliiiglngvg----------.---.LV.A.T.LW......FVY..HY..CH..P...D...D.LKYnq..........................................................giLAQVVVIFG..F..Q..IAYLS.FC.LVATDAYN..-----.........................................................................................................................................................................................................E---..............-----.-...-...R...F..E..G.....QF....nM...S.................YC...W...KLVY.LMIV........IYLS..........................IV..LP.......LAV.F....Y....Y.E...........A...DS....D....P....R.I..T.KTsp.........................lvQTL...-...---...-...-K.RG.S..MY.I.VA.V....WGV.I...GLLYLAcrkmtigge...........................................................................................hcldegcsvSVPTSQTVT..lEF.LS..YLI..GLPGFIGWFVF....MF.TGGIG.IASV...PVGLFMkwwhfpk................................................plpvheyeK-------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------mkkvlgeratalrevgeglaahemrkknglrnptar....................................................................................................................................................................................................................
R7YJT6_CONA1/8-291                     ....................................................................................liwvt-----YAVAV.AIL.VA.I.A.SV......FVY..VY..QK..P...R...D.RAA..............................................................SVTIICIFT..V..T..ALLAT.VL.LMPVDIAL..VSSTTlsseg..............................................................................................................................................................................................rkkdwaT---..............PDKID.N...I...V...V..T..-.....--.....L...K.................IV...Y...YTLY.SLDA........VLCL..........................LV..IP.......FTY.F....W....Y.E...........S...YD....D....D....A.A..E.QGtq........................tvgSRL...-...WEA...F...KY.TI.A..FV.F.LC.V....ILF.L...VGFFIPaakntkhs.............................................................................................dhrnldyfKDLLTENRG..eRA.LT..FAL..GLLITVGTIVY....VI.YTGSG.LALL...PVSLIKsapa.......................................................istpALAANTAT.QL.E....Q.N.RERQ..R....QLEG..RN----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------egrqngldsrdrrelealvreertlirrerlaaea.....................................................................................................................................................................................................................
H2M442_ORYLA/253-449                   ...............................................................................mvqtfpnqts----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....K.L...N.K........E...L....-....----.-Di..........irNQRN..KL.ERRK............KASGWE..KNL.L.YP.M.V...MLI...L.....-......-.-.-L.AGTTI.SVIMVAL..NI.LY---LLVDe........................taMPKGS.......TD-RGIG..N..A.....S....L.S..TFG.VAQA.....................-.V.LEII.LM.F..YL...M.VS.SVVGFYSL--....RVF.............EGLTP..rKDDTTM..TTI.....IGC...CVSILVLSSa..............lPVM....S.RT...L..GMTRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAVVT.TLCLVRKF........................................................................................................................................................................................................................................................
A0A183HC75_9BILA/203-377               ............................................................................dpflprkplrgyq----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............---IVL..QSV.K.YV.S.A...MVV...L.....-......-.-.-L.LLTTI.TVLMVLI..NT.LQ----LLF..........................gFRALP.......VYAQYME..V..N.....S....R.H..TLG.IFGA.....................-.V.VEVI.II.W..YI...M.IA.AMIGVYSV--....PLL.............RRIQP..qLRKTSM..TCV.....IAN...CTTVLILSSa..............lPIL....A.RT...L..GITTFD......................................................------......L.....V.G...E..Y.G...S.....L..M.W..LSNF..TLV.WTY.NV..AFAFVT.VSCLLNH-f.......................................................................................................................................................................................................................................................
F7HSP4_MACMU/1-263                     .........................................................................................----ICFLLF.AIL.YV.V.S.YF......IIT..RY..KR..K...S...G.NDEqeded....................................................aivnrISLFLSTFT..L..A..VSAGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........sfPHNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLAS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KGi...........................rARI...-...LET...L...VM.LL.L..LA.L.LI.L....GIV.W...VASALIdn........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDLDE.QI.Y....I.I.TLEE..E....ALQR..RLNGLSssv............................................................................................................................ecniMELE........QE.LENV...KTL..KTK.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------lerrk...................................................................................................................................................................................................................................................
Q6BPU1_DEBHA/1-502                     ...................................................................................mwflpl-------LCY.IFA.LV.L.T.LT......GIQ..YH..IS..I...F...K.YPA..............................................................YLVIPFTLA..V..F..IPLSI.TF.LLPLDYVA..-----.........................................................................................................................................................................................................-HNS..............PSSII.W...F...D...L..P..D.....KV.....I...L.................YL...W...KFNY.WITF........LLTW..........................LI..LP.......LLQ.E....F....F.R...........S...GY....F....N....I.L..S.KF.............................KDA...V...KRN...I...KF.QL.I..IL.G.VS.T....AGL.V...YLILE-.............................................................................................................VGLSLS---...HL.KL..MII..ALSHIYSLVLA....LW.LMAHG.LISI...PRNKWI...............................................................--SGSLLQ.DL.N....H.H.YLKV..P....KLVD..NLEDIK...................................................................................................................................ITFK........ED.VLQV...LVL..TKN.FT..STSg........................................edF..rFR...DWI.....LQLHK.......................................................................KIPLDIKEFMEQqythdd.......................................................................pgntisRDQV...TTH....................................................................................................................................FMTKLT...ANFN...SN...........................................................LN...KL....NS...Y...E...A.........EFNS...VLKKI....VSLE.................................................................................................................................DVLN.C....S.A...N.D........N...L....Q....QRSR.--.............----..LV.YRID...........nHLTLLS..PKN.K.FM.L.E...YYI...R.....P......V.I.NR.LLSIV.LFVSSFI..IL.ES---EFFH...........................STPIS.......LMNILIY..S..T.....G....I.N..NHN.LLQL.....................-.I.VCCI.TF.S..YM...L.FA.SLNSLTRLKI....FNM.............YHLVP...-HNSDP..VSA.....CFY...TTYIARLTI................PLS....Y.NF...I..TLFVSR......................................................NSIFES......W.....F.G...K..S.I...H.....L..T.G..LF-N..SMN.NWI.PR..FVLIPV.LLTVFNVY........................................................................................................................................................................................................................................................
A0A0P7BGK3_9HYPO/11-455                ....................................................................................liwva-----YAVAV.GLC.LI.A.A.VI......TTF..TW..QA..P...R...E.RST..............................................................IVSTVAIVS..L..T..SLLAT.VL.LLPVDIAL..VSATSsashg..............................................................................................................................................................................................akkdwaT---..............PERID.N...I...L...L..T..-.....--.....L...K.................IV...Y...YSLY.SFDA........LLCL..........................IV..IP.......FAY.F...wY....E.E...........S...GE....A....D....I.E..E.--.............................GRS...L...KSR...F...LA.AA.K..YT.L.FF.I....AFV.V...ILFLLGffipvagds..........................................................................................tknhwdldyfKKLLAQNHG..eKA.LT..FAL..GLLLTIGTLLY....VV.YTGAG.LALL...PISLIKsapsisapql...........................................settasqleqNRER----.--.-....-.-.----..-....----..-----Q...................................................................................................................................RQIE........--.LRNA...GR-..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...-QE....................................................................................................................................EISRKD...QREL...DA...........................................................LV...RE....EQ...T...L...V.........RRER...LAAEA....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-Q............gEGRS..RV.YQF-............--WIKL..CVL.F.RP.I.K...MLG...G.....-......I.L.LL.ILSLF.LWVSMLI..TG.IDKAK---Nsvckek...............cgyilgQIHLFq.....pMNFIFV-..-..K.....S....A.K..AFP.-IDY.....................-.I.LMAL.LV.L..FF...F.TS.SISGVAAVGI...rFLW.............VRIFQi.rKGRTAP..QAL.....LIA...TVML-----................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------aliilatnygiammvapqysiygtqtf.............................................................................................................................................................................................................................
H0WL75_OTOGA/16-429                    ......................................................................................gwc----IFGLLL.LAI.LA.F.C.WI......YVR..KY..QS..Q...R...E.SEV..............................................................ISTITAIFS..L..A..IALIT.SA.LLPVDIFL..VSYMK.........................................................................................................................................................................................................NQNG.............tFKDWA.N...A...N...V..S..R.....QIe..dtV...L.................YG...Y...YTLY.SVIL........FCVF..........................LW..IP.......FVY.F....Y....Y.E...........E...KD....D....D....D.T..N.KC.............................TQI...-...KTA...L...KY.TL.G..FA.V.IC.T....LLL.L...VGAF-Vplsvpsdrns.........................................................................................tewekvkflfEELGSS-HG..lAA.LS..FSI..SSLTLIGMLAA....IT.YTAYG.MSAL...PLNLIK...............................................................GTRSAAYE.RL.E....N.T.----..-....----..------...................................................................................................................................EDIE........EV.EQHI...QTI..KSK.SK..DGR...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................PLSARD...KRAL...KQ...........................................................YE...ER....LR...T...L...K.........KRER...HLEFI....----.................................................................................................................................----.-....E.N...S.W........W...T....K....FCGA.--.............----..--.---L............RPLKIM..WGI.F.FI.L.V...ALL...F.....-......V.I.SL.FLSNL.D------..--.-----KALHsagid................sgfiifGANLS......nPLNMLLP..V..-.....L....Q.T..VFP.-LDY.....................-.I.LITI.II.M..YF...I.FT.SMAGIRNIGI...wFFW.............IRLYKi.rRGRTRP..QAL.....LFL...CMILLL---................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ivlhtsym................................................................................................................................................................................................................................................
A0A0J6YRB2_COCIT/8-292                 ......................................................................................liw---IVYAIVV.GIL.SI.V.A.ST......FVY..IY..QT..P...R...D.RSA..............................................................AVTTVCIFT..L..T..ALLAT.VL.LLPVDVAL..VSSTTse....................................................................................................................................................................................................fgrR--Kd............wATDHE.V...E...K...I..T..Y.....SL.....-...T.................VV...Y...YFLY.SLDA........VLCL..........................LI..VP.......FTY.F....W....Y.E...........E...YD....E....V....A.Y..E.DD.............................GRF...T...RKP...F...WG.AF.K..YT.L.VF.I....LLT.I...ILFLVGffvpvakdr..........................................................................................kgahfdldyfKRLLTENHG..eRA.LT..FAL..GLLIVMGIIVY....VI.YSSTG.LAFF...PISFIKsspsis...................................................spmlsaNIESRLEE.NI.E....R.Q.RQLE..G....RCG-..-----Gnpdhl.........................................................................................................................sskdrRELD........SL.VREE...RTL..RRR.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------krlaeasrgq..............................................................................................................................................................................................................................................
V4LCH4_EUTSA/354-579                   ............................................................................relkkaadalhqe----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................-E...RS....GA...K...G...R.........KWRK...NVKAV....----.................................................................................................................................----.-....-.-...-.-........E...K....E....LLQL.EEd...........vNLLE..EM.YPQGe..........kAETAWA..FTV.L.GY.L.A...KFI...L.....G......I.I.GL.IVSVA.WIAHIII..YL.LV-------...........................DPPLSp.....fLNEVFIK..L..-.....-....D.D..VWG.LLGT.....................-.A.AFAF.FC.F..YL...L.LA.VIAGAMMLGL...kLVF.............ITIHPm.kWGATLM..NSF.....LFN...VGLILLCSIsviqfcatafgyyaqaT--....-.--...-..------......................................................--AAQE......I.....F.G...H..T.-...-.....L..Q.S..LRGI..KYL.YKY.NV..FQIGFV.VLAGLT--fl......................................................................................................................................................................................................................................................
A0A091J8R9_9AVES/1-415                 ......................................................................................ifp-------CVF.QAI.LI.F.C.WV......YVR..KY..QS..R...R...E.SEV..............................................................ISTITAIFA..L..A..VALIS.SA.LLPVDIFL..VSYMK.........................................................................................................................................................................................................N--Pn...........gtFKDWA.D...A...N...V..S..R.....QIe..dtV...L.................YG...Y...YTLY.SIIL........FCVF..........................LW..IP.......FVY.F....Y....Y.E...........E...KE....E....D....D.G..N.TC.............................SQV...-...KTA...L...KY.TL.G..FI.T.IC.A....VLL.L...IGAF-Vpldipnkkns.........................................................................................tewekvkllfEEFGSS-HG..lTA.LS..FSI..SSLTVIGMLAA....IT.YTAYG.MSAL...PLNLIK...............................................................GTTSAAYE.RL.E....N.T.----..-....----..------...................................................................................................................................EDIE........EV.EQHL...LRI..KSK.CR..DGR...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................PLSSRD...RRTV...QQ...........................................................LE...ER....LR...T...L...R.........RRER...HLESI....----.................................................................................................................................----.-....E.K...S.W........W...T....K....FCEA.--.............----..--.----............-----I..RPL.K.IV.W.G...VFF...I.....-......-.-.--.---IV.ALLFTVS..LF.LSNLDKALHsagfd................sgfiilGTNLT......nPLNMLLP..V..-.....L....Q.T..VFP.-LDY.....................-.I.LITT.IV.M..YF...I.FT.SMAGIRNMGI...wFFW.............IRLYKi.rRGKTRP..QAL.....LFL...CMILLLI--................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vlhtsymiysl.............................................................................................................................................................................................................................................
LMBRL_DANRE/18-278                     .........................................................................................RETIICVLLF.ICL.YI.L.S.HF......ILT..HF..KK..S...A...E.FVTddied....................................................atvnkIALWLCTFT..L..S..VAVCA.VL.LLPISILS..-----.........................................................................................................................................................................................................NEVLl...........tfPHSYY.M...Q...W...L..N..G.....SL.....I...R.................GL...W...NLVF.LFSN........LSLV..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....A....G.S..K.KGv...........................mARV...-...YET...A...VM.LL.L..LS.L.LV.L....GIV.W...VASALLhh.........................................................................................................ntARESLYDLW..eYY.LP..YLY..SGISLFGVLLL....LL.CTPFG.LSRM...-FSVTGsll.........................................................vkpRLLENLEE.TM.N....C.A.VFEE..A....SLSR..KLKSTN...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------tcwisahlealnkeflsvqskri.................................................................................................................................................................................................................................
G1QH87_NOMLE/1-259                     .........................................................................................----ICFLLF.AIL.YV.V.S.YF......IIR..RY..KR..K...S...D.EQEdeda......................................................ivnrISLFLSTFT..L..A..VSAGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........sfPQNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLAS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KGi...........................rARI...-...LET...L...VM.LL.L..LA.L.LI.L....GIV.W...VASALIdn........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDLDE.QI.Y....I.I.TLEE..E....ALQR..RLNGLSssv............................................................................................................................eyniMELE........QE.LENV...K--..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------tlktkler................................................................................................................................................................................................................................................
A0A194XLB6_9HELO/12-521                ........................................................................................g-SEIFALISL.LVI.SL.G.V.LL......LLR..YY..LP..L...R...S.TPA..............................................................YLTVPIFFA..L..G..LPASI.IL.LVPIDLAS..NARNQ.........................................................................................................................................................................................................----..............DAGSR.G...I...W...L..P..E.....RL.....L...L.................VS...W...RISY.WLTF........GLTW..........................FI..LP.......ILA.E....F....S.D...........S...GY....R....D....P.K..A.KL.............................IYS...L...RAN...A...QY.QA.I..VF.A.AA.I....ATM.I...YIFVS-.............................................................................................................YGVHTE---...SF.KA..TVM..ALAYCWCLVLA....IY.LMGHG.LVMI...PRSLFR...............................................................--NASISG.RL.R....R.I.QVDA..V....KIHD..KMEEAI...................................................................................................................................QTLD........DL.EAQV...AEL..AKR.KT..GSA...........................................T..qFR...DWI.....EELADethlpesrpr..................................................tltrrmsvpevNVPHVI------...................................................................................----...TER....................................................................................................................................YLADLS...RRLT...RA...........................................................RH...SR....AR...Y...L...D.........EWDH...LLQEA....TNVQ.................................................................................................................................AILD.S....A.A...S.K........R...I....E....IGQA.--.............SPNA..PF.MERV............--TLFT..PYT.R.YL.Y.R...YWF...L.....P......Y.L.RI.FLGCF.LSLASFC..IV.WSEVTKSI-...........................NPLFS.......IIALTIV..H..H.....P....T.S..ERG.QIGFa...................gQ.V.IASC.WI.L..YM...C.AA.ALTSLTVVKV....WRG.............RALVR...-RNTHG..ESA.....MWY...AMQVAKLSV................PLS....F.NF...L..TFLSQDi...................................................yiNTVFYD......F.....L.G...K..L.I...N.....L..T.D..VG-A..WFD.WLF.PC..FILVPV.CAAIFNLY........................................................................................................................................................................................................................................................
A0A166PL68_9PEZI/11-300                .....................................................................................liwv----AYAVAV.VLC.LL.A.A.II......TTF..TW..QT..P...R...E.RSA..............................................................IVSIVAIIS..L..T..SLLAT.VL.LLPVDIAL..-ISST.........................................................................................................................................................................................................THASlgv.......kkdwATEQR.V...H...D...I..L..-.....QT.....L...R.................IV...Y...YSLY.SFDA........LLCL..........................LI..IP.......FAY.F....W....H.E...........E...YD....E....I....E.V..E.EGrs.........................fgSRL...-...---...-...VS.AL.K..YT.L.VF.V....ILV.V...ILFLVGffvpaagdh..........................................................................................nganwdldyfKRILVQNNG..qKA.LS..FAL..GLLVTLGVLLY....VI.YTAAG.LALL...PMSFIKsapsisapql...........................................testataleqNRERQRQL.EM.R....N.A.----..-....----..-----Grpegm.........................................................................................................................sskdrRELE........AL.VREE...RTL..TRR.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------erlaaeasgegrsti.........................................................................................................................................................................................................................................
A0A0J7K2J4_LASNI/1-211                 .........................................................................................----IFLLLF.LLL.YI.S.S.YA......LIA..RF..RR..R...D...R.EDYlsvded..................................................eatvyrISLWLCTVA..L..A..VSVGA.TL.LLPVSIAS..-----.........................................................................................................................................................................................................NEVLi...........lyPNSYY.V...K...W...L..N..S.....SL.....I...Q.................GL...W...NHVF.LFSN........LSLF..........................VF..LP.......FAY.L....F....T.E...........S...EG....F....E....G.H..K.KGv...........................mARV...-...YET...V...TV.LC.L..LG.T.LV.L....GMT.Y...VLSSL-.............................................................................................................LDYQNS---...--.--..---..S------LHTL....LI.CTPVG.FVRL...-FGVVGsfl.........................................................vkpQFLKNLDE.EF.F....A.Y.RLEE..D....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ssvqiaa.................................................................................................................................................................................................................................................
C4JZG1_UNCRE/15-115                    ........................................................................................g-SGVFAALAV.VSI.FC.L.V.LL......LLR..HY..LP..L...R...N.TPA..............................................................YLTLPIFLA..L..A..LPASV.IL.LVPIDLTS..STA--.........................................................................................................................................................................................................----..............GNSPS.G...I...W...F..P..A.....RV.....M...L.................VS...W...RITY.WLTF........VLTW..........................FV..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------salleifa................................................................................................................................................................................................................................................
A0A017SHX6_9EURO/8-288                 ......................................................................................liw---IVYAIAI.AIL.IA.V.A.SI......FIY..VY..QT..P...R...D.RSP..............................................................SVTLTCIFA..I..T..TLLAT.VL.LLPVDVAL..VSSTT.........................................................................................................................................................................................................SSALgrr........kdwASQDV.V...D...R...I..T..Y.....S-.....L...T.................IV...Y...YLLY.SLDA........VLCL..........................LV..IP.......FTY.F....F....Y.E...........E...YD....E....V....A.T..E.SG.............................EQT...I...LKR...F...WS.AF.K..YT.I.CF.M....AII.V...ILFLVGffvpvskn............................................................................................kdgqdldyfKKLLTENHG..eRA.LT..FTL..GLLTTIGLCLY....VL.YTSSG.LALL...PISLIK...............................................................TAPSFSNP.NI.K....A.T.--TC..M....QLDS..NRERQR...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------qlegrcggnpdvlsskdrreldtlvreertlirrqrlveea...............................................................................................................................................................................................................
I3K2D5_ORENI/252-452                   .........................................................................ncgstscwvklnmeal----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........K...K....E....YQAV.Q-.............SKRV..AL.EMRR............KASPWQ..RNL.G.YP.L.A...MLV...L.....-......-.-.-L.ALTVM.CVLMVCF..NV.LE---LLLDe........................taMPRG-.......MEDPHLG..M..A.....S....F.S..MFG.SLGA.....................-.A.VQVV.LI.L..YL...M.VS.SVVGFYSS--....PLF.............TGLLP..rAQDTNL..TQI.....IAN...CVSLLILSSa..............lPVF....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....Y..N.W..LGNF..YIV.FLY.NM..LFAGLT.SASLIK--tv......................................................................................................................................................................................................................................................
H2TMI6_TAKRU/262-451                   ...............................................................................pgktlnkeld----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-Nv...........rNQRN..KL.ERRK............KASGWE..KNV.L.YP.M.V...MLI...L.....-......-.-.-L.AGTTI.SVFMVAF..NI.LY---LLVDe........................taMPKGS.......TD-RGIG..N..T.....T....L.S..TFG.VAQA.....................-.V.LQIV.LM.F..YL...M.VS.SVVGFYSL--....RAF.............AQLTP..rKDDTTM..TTI.....IGC...CVSILVLSSa..............lPVM....S.RT...L..GITTFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAVVT.TLCLVRKF........................................................................................................................................................................................................................................................
H9H780_MONDO/21-260                    .........................................................................................RECIISTLLF.ATL.YI.L.C.HI......TLT..RF..KK..P...A...D.FTTvdded....................................................atvnkIALGLCTFT..L..A..VALAA.VL.LLPFSILS..-----.........................................................................................................................................................................................................NEVLl...........slPRNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLVF.LFSN........LSLV..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....A....G.S..K.KGv...........................lGRV...-...YET...V...VM.LL.L..LS.L.LV.L....GMV.W...VASAIVdn........................................................................................................sktSRESLYDLW..eYY.LP..YLY..SCISFLGVLLL....LV.CTPLG.LAQM...-FSVTGkll.........................................................vkpRLLEDLEE.QL.H....C.S.AFEE..A....ALTR..RM----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------cnpts...................................................................................................................................................................................................................................................
A0A0M3HMQ0_ASCLU/20-284                .........................................................................................RQHIICLLLF.ITL.YL.I.S.RW......ILG..LL..KT..C...S...D.NDElyagke..................................................dffvfrISLWMCTCS..L..A..ISIGA.AM.LLPFSVIG..-----.........................................................................................................................................................................................................SEILq...........ayPDSYY.F...Q...W...L..N..W.....PL.....I...H.................SL...W...NYVF.ALSN........LSLF..........................VL..LP.......FAY.F....F....I.E...........S...QG....F....R....G.Q..G.KAgniqrvlllriv....ssklvrdqpegimARV...-...YET...V...AV.CI.M..LI.V.VL.I....CLA.D...VVQSFLlfq.......................................................................................................qksISLSLLSFT..sVD.LP..FIY..SCVSLIGVFTL....LI.TTPIG.FAHM...-FTVVSnhll......................................................asnssPTMDPNEH.VI.S....R.L.EYET..Q....KL--..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rlvrn...................................................................................................................................................................................................................................................
A1CR57_ASPCL/12-517                    ........................................................................................g-SSIFFALAL.LAI.SV.S.V.LL......LLR..RF..LT..L...R...A.TPA..............................................................YLAVPVFLA..L..A..LPASV.VL.LVPIDLAS..SSRDG.........................................................................................................................................................................................................----..............-GGPK.A...I...W...L..P..D.....RL.....I...L.................VA...W...RIAY.WLIF........VLTW..........................AL..LP.......LLG.E....Y....I.D...........S...GY....R....D....S.K..A.RI.............................VYS...L...RSN...A...RY.QL.I..VL.C.CA.V....VGL.I...YISIQ-.............................................................................................................NGFEFT---...SI.KG..LVM..ALAYVWGLVLA....IY.LMGHG.LVSI...PRTLFR...............................................................--NASVSG.RL.R....R.V.QAHA..P....RLHD..RLMDAI...................................................................................................................................NELE........SL.ESQV...TQL..QQR.KT..GTA...........................................R..dFQ...DWI.....EELAEtsnpveara....................................................alleppaghgTVPPVI------...................................................................................----...TER....................................................................................................................................YMADLT...RRLQ...RA...........................................................RH...QK....AR...F...V...D.........EWDR...LVLLA....ADLQ.................................................................................................................................AIIN.S....S.A...S.Q........K...L....D....FGQS.--.............PRRS..TW.FSRM............--KFLT..PYT.R.YH.L.Y...VNV...I.....P......S.V.RL.ALGAL.FSVASVC..VI.WSELIKSL-...........................APRLS.......VVTLSI-..V..S.....Y....H.Q..DPK.PVNFg...................rQ.L.AASA.WL.L..YM...C.AA.ALVGVNDAKV....WGN.............RALVR...-RNTYG..ESA.....CWY...AGLVARLTV................PIA....Y.NF...L..TFLPLNv...................................................rqNTIFYH......F.....L.G...R..L.I...D.....L..T.P..LG-K..GFD.YFF.PV..FILLPV.CATLFNLY........................................................................................................................................................................................................................................................
S2J6P5_MUCC1/27-530                    ......................................................................................wlp-----LVLVT.CFM.LT.V.V.LF......TLS..RY..GN..I...K...S.QPW..............................................................YVTVVCIIG..W..F..FPFWI.IF.LLPLDLAS..TVHDD.........................................................................................................................................................................................................K---..............RGRVP.F...A...Y...V..S..Q.....HF.....L...F.................IA...W...RVLY.WTSF........CLTW..........................LA..IP.......MMQ.A....Y....V.N...........T...GD....F....T....I.V..K.RL.............................KSA...V...QVN...V...RF.YS.I..YV.V.VG.T....IGL.I...YLVFG-.............................................................................................................SGLTTRE--...GI.QS..YVM..AAANSWGLFLV....IV.FMGYG.LVSV...PRSLWY...............................................................--SGSYDR.HL.F....Q.H.YANA..A....RLKE..ECMDSE...................................................................................................................................LEFN........EL.AKTM...NAI..SKR.AM..MEI...........................................P..eIR...HCI.....NVMNR.......................................................................RFPFVLHEAFAErds............................................................................sitiPRDL...TED....................................................................................................................................YLVKIS...KRMI...LA...........................................................IR...MR....DR...K...N...A.........LWKN...LLNEA....FYLQ.................................................................................................................................DIIK.N....K.D...K.R........D...R....R....FTST.LR.............SKEN..TT.KW--............--TNIK..ASM.E.WW.W.M...LRI...A.....P......N.L.NK.FLAIV.FSVISVC..II.WSEIVFNVR...........................RPVII.......SIVYYVL..N..A.....C....G.T..NYA.--AL.....................E.I.MAFF.TL.M..YM...C.IC.VYSSLFKIRF....FNL.............YILIP...NHHTDE..NSL.....LWF...TSYMCKMMA................PLC....Y.NF...I..NLA-VDap.................................................gvsKAVFTT......F.....M.G...K..A.D...L.....I..K.F..LG--..AFA.DWF.PI..IILIPS.LSLLFNV-q.......................................................................................................................................................................................................................................................
LMBD1_NEUCR/13-303                     ......................................................................................iwv----AYAVAV.ALV.FF.V.A.VI......TVF..TW..QT..P...Y...D.RSK..............................................................LVTTVAIVS..L..T..ALLAT.VF.LLPVDIAL..VSSTAsasrgt.............................................................................................................................................................................................kkdwatP---..............--ERI.H...G...I...L..K..-.....-T.....L...K.................IV...Y...YSLY.SFDA........LLCL..........................VV..IP.......FAY.F....W....Y.E...........E...HD....E....V....L.E..E.EG.............................RET...-...WST...R...FW.QA.L..KY.T.IA.F....IIL.V...IILFLVgffvptaaqd........................................................................................hgrhldldyfkRLLTNNNGE...KA.LS..FGL..GLLMTLGVLLY....VL.YTATG.LALL...PVSLIKsapaisape.............................................lsamtaaelEHNRELQR.QI.E....M.R.--NA..G....RIVA..MSQKDR...................................................................................................................................RELD........LL.LREE...RTL..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vrrqrlaaeasgegqstim.....................................................................................................................................................................................................................................
C5L571_PERM5/3-132                     ...................................................................................eyesvh----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.SI.............................KKA...L...RNN...A...IW.YL.A..YA.C.AG.L....LIL.A...YLWYM-.............................................................................................................QRLGLQ---...GI.LG..FIY..AASNAWGLVLV....TV.LLGYG.LVAV...PQWLHV...............................................................--LSYDKR.HM.E....A.I.YAQV..V....SAED..ARLSAK...................................................................................................................................FDLM........DV.FNHY...RDQ..ERE.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------sgqgaskqlvv.............................................................................................................................................................................................................................................
F7HSP6_MACMU/105-284                   ........................................................................svecnimeleqelenvk----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............TLKT..KL.ERRK............KASAWE..RNL.V.YP.A.V...MVL...L.....-......-.-.-L.IETSI.SVLLVAC..NI.LC----LLVde.......................taMPKG-.......TRGPGIG..N..A.....S....L.S..TFG.FVGA.....................-.A.LEII.LI.F..YL...M.VS.SVVGFYSLRF....FGN.............F--TP..kKDDTTM..TKI.....IGN...CVSILVLSSa..............lPVM....S.RT...L..GLHKLHlsnt..............................................srdsETAKPS......V.....N.G...H..-.-...-.....-..-.-..----..---.---.--..------.--------qkal....................................................................................................................................................................................................................................................
A0A091SGU5_9AVES/1-417                 ......................................................................................ifp-------CVF.QAI.LI.F.C.WV......YVR..KY..QS..R...R...E.SEV..............................................................ISTITAIFA..L..A..VALIS.SA.LLPVDIFL..VSYMK.........................................................................................................................................................................................................NQNG.............tFKDWA.D...A...N...V..S..R.....QIe..dtV...L.................YG...Y...YTLY.SIIL........FCVF..........................LW..IP.......FVY.F....Y....Y.E...........E...KE....E....D....D.G..N.TC.............................SQV...-...KTA...L...KY.TL.G..FI.T.IC.A....VLL.L...IGAF-Vpldipnkkns.........................................................................................tewekvkllfEEFGSS-HG..lTA.LS..FSI..SSLTVIGMLAA....IT.YTAYG.MSAL...PLNLIK...............................................................GTTSAAYE.RL.E....N.T.----..-....----..------...................................................................................................................................EDIE........EV.EQHL...LRI..KSK.CR..DGR...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................PLSSRD...RRAV...QQ...........................................................LE...ER....LR...T...L...R.........RRER...HLESI....----.................................................................................................................................----.-....E.K...S.W........W...T....K....FCEA.--.............----..--.----............-----I..RPL.K.IV.W.G...VFF...I.....-......-.-.--.---IV.ALLFTVS..LF.LSNLDKALHsagfd................sgfiilGTNLT......nPLNMLLP..V..-.....L....Q.T..VFP.-LDY.....................-.I.LITT.IV.M..YF...I.FT.SMAGIRNMGI...wFFW.............IRLYKi.rRGKTRP..QAL.....LFL...CMILLLI--................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vlhtsymiyslap...........................................................................................................................................................................................................................................
A0A094A7T1_9PEZI/7-289                 ..................................................................................afiwlsy------AIAV.ALV.AA.A.A.AA......FTY..TY..QT..P...R...D.RSA..............................................................VVTTVTIFT..L..T..SLLAT.VF.LLPVDIAL..VSSTSssklg..............................................................................................................................................................................................ikkdwaT---..............PER--.-...-...-...V..D..S.....ILl...tL...K.................IV...Y...YTLY.SLDA........LLCL..........................IV..IP.......FTY.F....W....Y.E...........E...YD....E....V....E.A..D.EG............................tQSS...-...AQR...F...WN.AF.K..YT.I.AF.I....LLA.L...IVFLVGffvpvaahdr.........................................................................................dgrmdldyfrRLLSANKGE...RA.LT..FAL..GLLITLGTILY....VL.YTSAG.FALM...PISFIK...............................................................---SAPSI.SA.P....Q.L.YAST..A....SALV..QNRERQ...................................................................................................................................RQLE........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------grsagrpnglpakdqreleglvreertlvrrerlaae...................................................................................................................................................................................................................
A0A0V0SAW7_9BILA/253-449               .....................................................................veeemnviwlsclrnlasly----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............AQRK..LF.QKEL............HSISWL..SVV.I.YP.V.L...FIV...I.....-......-.-.-L.AITAL.SVLSVVW..NV.F-QITIGFR...........................RLPIA.......IEDFELG..S..S.....S....L.S..FLG.FYGA.....................-.F.IEII.IT.L..YL...M.LA.SLIGFYSL--....PVF.............CRLKP..iRNGTSM..TRL.....IFN...CTSTLVLSSa..............lPVL....A.RV...L..GLTNFD......................................................------......L.....L.G...N..Y.S...Q.....L..N.W..LGNI..YFV.LMY.NL..MFTFAV.VCVSLTL-l.......................................................................................................................................................................................................................................................
S9W1F2_9TRYP/142-339                   .....................................................knkiniirnevyfleahqdqliwaytqaggspfivf----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.G...KLA...L.....T......I.I.CL.GTGIV.WILHIFL..YN.T-----FNA...........................DP-F-.......LNTLLIK..L..-.....-....N.D..AFA.LCGV.....................-.A.AYAV.LA.F..YL...M.WA.TFEGQLILGL...rLIF.............FQIHPm.kKGDTQV..NAF.....LFN...ATLLNITAF................AVL....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------qfvcrsfqgyapltslnglmnvyvmhlkgigqvikwiqyglvgvallsiilvaics................................................................................................................................................................................................
G5C9G5_HETGA/1-549                     .........................................................................................MSSAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIVGTLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRcrhaaanssppes...............................................................................................................................................................................snstgsygiispvP--Rq............hPCFKP.W...S...Y...I..P..D.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PRLHLE-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSYWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DV.MEEV...RKV..NES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPIEYQEKMGRnmddye.......................................................................dfdekrNTYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....HR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVYT.FQp...........pEPEN..RF.IQY-............---FYN..PKV.E.WY.W.E...CLL...R.....P......W.F.YR.ILAVV.LSIFSVI..VV.WSECTFFST...........................TPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.I.ACFL.SI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDssis.............................................hqntqPTAYTS......I.....M.G...S..M.K...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
A2RAX9_ASPNC/10-515                    ........................................................................................g-SSVFFTLAL.LTI.SV.L.V.LL......LLR..RF..LT..L...R...A.TPA..............................................................YLSIPVFLA..L..A..LPASV.VL.LVPIDLAS..SSRDGg......................................................................................................................................................................................................gpT---..............-----.A...I...W...L..P..D.....RL.....I...L.................VS...W...RIAY.WLIF........VLTW..........................AI..LP.......LLG.E....Y....I.D...........S...GY....R....E....P.K..G.RI.............................QYS...I...RSN...A...RY.QL.I..VL.C.CA.T....VGL.I...YISIQ-.............................................................................................................NGFEFT---...SI.KT..LVM..ALAYVWGLVLA....IY.LMGHG.LVSI...PRTLFR...............................................................--NSNVSG.RL.R....R.I.QAHA..P....KLHD..RLMDAI...................................................................................................................................NDLE........SL.ESQV...AQL..QRR.KT..GTA...........................................R..dFQ...EWI.....DELAEtsnppelrs....................................................glleqadgpgTIPAVITER---...................................................................................----...---....................................................................................................................................YLADLT...RRLQ...RA...........................................................RH...QK....AR...F...V...D.........EWDR...LVLSA....ADMQ.................................................................................................................................AIIN.S....S.A...S.K........K...L....E....FIHS.--.............PHRS..SW.LPSL............--NFLS..PYM.R.YH.L.Y...VHV...I.....P......N.V.RL.GLGAV.FSAASVC..VV.WSELVKSL-...........................APRLS.......VVTLSV-..V..S.....Y....H.K..EPA.PVDFg...................rQ.L.IASA.WL.L..YM...C.SA.ALVGVNDAKV....WGN.............RALVR...-RNTYG..ESA.....CWY...AGLVARLTV................PIA....Y.NF...L..TFLPATv...................................................rqSTTFYK......F.....L.G...R..F.I...D.....L..T.P..LG-K..GFD.YFF.PV..FILVPI.GATLFNLY........................................................................................................................................................................................................................................................
J9IT80_9SPIT/1-454                     ........................................................................................m----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.IA.LLPLDMLF..LQYKQ.........................................................................................................................................................................................................L--Ld............dEEREA.T...Q...-...-..-..-.....YT.....L...E.................TM...W...NFFY.FTAF........FLCW..........................II..YP.......FLC.E....F....V.S...........T...GD....F....T....F.M..G.RL.............................KTG...F...KNF...L...FY.YS.I..AI.V.FF.I....IFL.I...YLWTQ-.............................................................................................................HAFNSS---...SF.LG..FII..ALSNAWGLFQI....II.FLGYG.IVSV...PEQCFK...............................................................--HANIEK.LY.K....Y.Q.MFKI..S....HYER..NYERAI...................................................................................................................................VNMD........EL.ARDA...LTL..KFY.TT..RAE...........................................-...IQ...HYL.....QIVID.......................................................................NCPLETLSYVEArdnid.........................................................................lvkldYAKG...DID....................................................................................................................................SLTYLN...RDCK...WA...........................................................NL...EL....IR...R...E...V.........SYEQ...ELEYA....FYIE.................................................................................................................................DLYK.N....Q.S...S.H........D...Y....L....IHSR.LFr...........lRDQN..KC.MGRC............-----R..DKT.Y.FF.L.H...IKL...I.....P......K.I.FY.ILALI.ALAFSIQ..IL.VGEMIILL-...........................DIKYT.......VITSII-..-..-.....P....D.S..IVT.QILT.....................N.I.YTVI.LL.F..YL...S.FC.IYYGCFNVKF....SSV.............YELHP...KKQTDS..FSL.....LYS...ANILTRLAT................PLC....I.NF...L..KIIHFE......................................................GTIFSN......L.....I.G...A..M.D...P.....I..P.I..IG-K..EFQ.NFF.PV..TLLIVI.IFNYFNV-w.......................................................................................................................................................................................................................................................
A0A135TJX8_9PEZI/12-517                ........................................................................................p-SEIFALLAL.LVI.SV.I.V.LL......ILR..HF..LP..L...R...T.TPA..............................................................FYLVPIFFA..L..W..LPACM.VL.LVPIDLAS..SARTD.........................................................................................................................................................................................................----..............DEATR.G...I...W...L..P..Q.....RL.....L...L.................VS...W...RITY.WLTF........ALTW..........................FI..LP.......ILG.E....Y....S.D...........S...GY....R....E....P.Q..D.SL.............................KYS...L...RQN...A...QY.HA.M..VF.G.SA.A....IGL.T...YLFAR-.............................................................................................................YGVGAF---...EF.KA..SFM..ALAYFYGLVFA....IY.LMGHG.LVSV...PRRLLR...............................................................--YASISG.RL.R....R.Q.QIRA..P....KLYE..KMEDSL...................................................................................................................................LNLE........DV.ELQV...SEL..GRR.KT..GSA...........................................V..kFS...EWI.....DELVEsanmpesq......................................................prtvvgdtrALPT--------...................................................................................---V..iTEK....................................................................................................................................FMADLS...RKLM...RA...........................................................RH...TR....SR...Y...V...N.........EWND...LLKDA....SDTQ.................................................................................................................................AILD.S....A.A...S.K........K...L....I....FAAP.--.............SPHA..GF.WDRF............--TVHT..PYT.R.YV.Y.Y...YHF...E.....P......Y.A.CI.ALGVF.LAAASVL..II.WSELVKAA-...........................FPQLS.......VIRLTVV..H..H.....W....V.G..EKG.QVGFa...................gQ.L.ISVL.WL.L..YM...C.AA.TFITMTEVKT....WRG.............RALVK...-RNTAY..ESA.....FWY...SGQVAKLSV................PLS....Y.NF...M..TFLSGEi...................................................ykKTRFYG......F.....L.G...T..L.V...N.....F..T.P..LG-R..WFD.YLF.PV..FVLLPV.AATLFGLY........................................................................................................................................................................................................................................................
W2YY79_PHYPR/6-293                     ......................................................................................fll---AVVIIIA.VAL.LI.C.N.VY......ILV..YF..QH..D...D...D.KNTa............................................................yFPKALVIFG..L..F..FAEAT.VL.LLPLDVAN..-----.........................................................................................................................................................................................................NSTA.............iGCAEG.W...N...T...V..C..G.....NI....nM...D.................LL...W...LMVF.LSII........IFLV..........................VL..LP.......FAI.F....Y....Y.E...........A...DD....G....E....D.N..P.--.............................KKS...Q...WGE...A...IK.ME.L..GT.V.FV.A....AAL.I...TVLYLTcakssvpmralevnsmsdsegf.................................................................qpyvdgttvsstivtvasnvtvQHITLT-VD..vSL.PV..YVT..GLTSFVGWFGF....SI.FCGIG.LIAL...PMDLILaff.........................................................hrpK-------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------fisadvyaiqklilqrrsvellevgrsikqsmdrpghgqsswerkkqrr.......................................................................................................................................................................................................
W7HME3_9PEZI/8-203                     ...................................................................................liwvtg------LIAL.AII.IG.V.A.IT......FVA..IY..SS..P...R...E.RSL..............................................................FVSAVTVIS..L..T..SLLAT.VC.LLPIDIAL..VSTTTd.......................................................................................................................................................................................................nT--Tg...........tkKKWAD.A...E...T...V..D..G.....ILl...sL...K.................VV...Y...YLLY.SLDA........FMCL..........................LA..MP.......FAY.F....W....Y.E...........E...WD....V....D....S.-..T.TG.............................SRI...-...RGA...L...KY.TT.I..FA.L.LV.L....VLF.L...VGFFI-.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------pvaaqrsgrehydldffkrlllenrgeraltfivglalfpvsliksi.........................................................................................................................................................................................................
D6X0Q3_TRICA/1-538                     ......................................................................................mny---GPLISKI.LLS.FI.L.A.ST......VLY..RY..GN..W...F...R.HHI..............................................................VVTLIVLLA..W..Y..FSFLI.IF.ALPLDVIS..TVYRQckeehdtfdn.....................................................................................................................................................................................atsslmqnvtNKSI.............eKCEEP.W...S...R...V..P..H.....EV.....F...P.................NL...W...RTVY.WSTQ........CLTW..........................LV..MP.......MMQ.S....Y....I.K...........A...GD....F....T....V.K..G.KL.............................KSA...V...IDN...A...IY.YG.S..YL.L.IC.G....VLL.I...YLALQ-.............................................................................................................PGIHLD-WS...KL.KA..IAS..SASNTWGLFLL....VL.LFGYA.LVEV...PRTLWN...............................................................--NSNHSF.VL.T....H.S.YFKA..A....KLSS..DKCEAE...................................................................................................................................ETVD........DV.LESL...QAV..SLA.IN..SRH...........................................P...LH...AHL.....ETILQ.......................................................................KVPTELRDRMNRrqlp...........................................................................edtpTDLP...SEK....................................................................................................................................ALVRLH...KQTI...KS...........................................................LQ...VF....QR...T...E...T.........QWNL...LVEKI....FDLE.................................................................................................................................DTIK.N....Q.I...S.R........D...K....R....FKRT.FQ.............KPRS..LF.RRF-............---LYV..PTV.E.WY.W.K...CLF...Y.....G......Y.T.QK.LLAVM.AGLFSVA..VV.WSEVTFFNK...........................QPVLS.......IFAAIV-..N..R.....A....K.V..KYD.YFTI.....................E.L.LSTI.II.L..YL...C.YC.AYSTVLKIKL....LNL.............YYLAP...HHQTNE..YSL.....IFS...GMMLSRLTP................PLC....L.NF...L..GLIHMDshii.............................................kkqvmETHYTQ......I.....M.G...H..M.D...V.....I..S.I..IS-D..GFN.VYF.PM..AILVFC.LATYFSV-g.......................................................................................................................................................................................................................................................
X6P0L6_RETFI/4-216                     .............................................................ttkkkrdeqkgcwssqicegvkwaigfl----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.G.VF.S....LVL.I...L----Mwaflhqadlpvtyrgfawnspdlr............................................................vhhsitenikdgtsfgycvtaegcgKKHLTLHVQ..vTI.GV..FLM..AMLSFLGWFLF....CV.FAGIG.LVAL...PIDLFNswkhrpk................................................pipldkyaEEKRKIGQ.RA.A....M.L.----..-....-REA..GNEIRK...................................................................................................................................DELN........AL.GRKT...SRK..E--.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------kreltetfhrfenvlflcskkkkkkttkqp..........................................................................................................................................................................................................................
K0R7D7_THAOC/1-583                     ......................................................................................met----LLLALG.TLL.FA.A.S.TW......FVL..AY..AK..-...R...K.TPC..............................................................FIILLSIAS..I..G..LGSAA.VA.LLPIDLSY..ASRAKa......................................................................................................................................................................................................anV--Tsh.........edeTDDDY.I...Y...S...Y..S..N.....NP.....T...Y.................IP...W...KVTY.WTTF........FLAW..........................II..LP.......ITR.Q....S....L.T...........S...GQ....F....T....R.Y..Q.RI.............................KDG...-...-VS...K...SI.KG.I..VL.M.MI.A....GVV.T...VIVSA-.............................................................................................................VKLRTWHIV..tIV.MP..ALM..ALGNTYGLVLV....AL.LLGNG.LVNI...PKRFWR...............................................................--EACPSS.VL.R....R.S.RIIA..S....HIEE..SLFESV...................................................................................................................................MQLE........DI.EDKI...EEV..CAM.AV..QLDeggdeglmrnedgeltlrgqskratrcsccgvdevtefhgcleV...--...---.....--LVRrkn................................................................etinLCAERRTRRNDSptrghhhrrra.............................................................srdddgdtpeeVNTM...DIN....................................................................................................................................YLLSLS...SKLM...DA...........................................................QE...NV....NS...A...Q...L.........RWDT...LMEHS....RLFSalmdgeva.................................................................................................................ttggavgdRGQG.S....D.G...S.N........E...N....L....L---.-Sp...........sSNHG..SC.G---............---KVC..YML.R.RV.W.V...RYL...R.....F......P.T.YR.VVAMI.TAVLSVF..VL.MSEVTLGS-...........................KMNLS.......PFSWLVHgiE..K.....T....D.Q..SSH.QIPF.....................Q.I.AALV.PL.L..YM...S.LS.LYSSLFQI--....FGS.............YSLRG...NRQSHG..VAL.....LFN...AQYLVRLQF................PLG....Y.NY...L..LMLKYDl....................................................sHCAFGA......I.....M.D...D..M.S...T.....I..P.F..LG-A..SFS.VYA.PL..LILAVC.LFTLCDV-y.......................................................................................................................................................................................................................................................
C9SV87_VERA1/12-124                    ........................................................................................p-SVVLTLLAL.LTI.SL.V.V.LL......ILR..FY..LP..L...R...T.TPA..............................................................FYLVPIFFA..L..W..LPACM.VL.LVPVDLAS..GAKTD.........................................................................................................................................................................................................----..............DEATR.G...V...W...L..P..A.....RV.....L...L.................VS...W...RITY.WLTF........ALTW..........................FV..NP.......LA-.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ndcsavadmmrtag..........................................................................................................................................................................................................................................
A0A0N0VEY7_9TRYP/265-458               .....................................................giknkinilrnevyfleaqqdqliwaytkaggspfi----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.-V.Y.G...KLF...L.....G......V.V.CL.VTAIM.WILQIFI..YN.T------FD..........................aDP-F-.......LNTLLLK..L..-.....-....N.N..AFA.LCGV.....................-.C.CYGV.FA.F..YL...T.WS.TFHGQIALGL...rLVF.............FQIHPm.kKHDTLV..NSF.....LFN...VSLLLITSY................AVI....F.--...F..AARSFQ.....................................................dYVAYTA......I.....N.G...L..M.N...V.....F..VmH..LRGI..GVF.I--.--..------.--------kwaqfcflgmallali........................................................................................................................................................................................................................................
W6LC00_9TRYP/5-262                     ......................................................................................wli---LIVVIFT.ILF.II.V.A.TY......IVL..YF..QS..P...E...D.EGSt............................................................fLGKGIFVLS..I..V..LSLGG.VL.LVTYDVAD..-----.........................................................................................................................................................................................................A---..............PDPTL.L...H...T...F..S..K.....TL....nT...V.................LM...W...EIVL.WLVM........LMAI..........................VV..CP.......IAM.F....F....Y.S...........F...QD....P....E....H.-..P.KT.............................KKA...L...LQA...M...IT.TL.I..VI.G.VF.A....LIV.G...TCYSIFgvskvsfqnyvtsg................................................................................qvmstsqtdvslnrtYTIVVPEIR..iGF.TT..YCI..GIFSCIGWFVL....LF.YCGLG.FISF...PIVGIF...............................................................DFKNRIK-.KI.N....A.L.EFSE..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rmyvilakadtllelgkrlqrktrsel.............................................................................................................................................................................................................................
A0A0E0K5F7_ORYPU/139-610               ....................................................................................emwvf-----YLISL.PLT.LG.M.V.TV......TLR..YF..AG..-...P...G.VPR..............................................................YVIATVGYA..W..F..CSLSF.II.LVPADIWT..TLTGR.........................................................................................................................................................................................................----..............-----.-...-...-...-..E..K.....GG.....I...G.................FF...W...SWSY.WSTF........ILTW..........................AV..VP.......TIQ.G....Y....E.D...........A...GD....F....T....V.K..E.RL.............................KTS...I...HMN...L...LF.YS.I..VG.A.IG.L....FGL.I...LLLVM-.............................................................................................................H--RAW--D..gGI.VG..FAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PRNIWK...............................................................--NADWTH.RQ.K....I.L.SHRV..A....KMAV..KLDNAH...................................................................................................................................QEYS........NA.IVVA...QAT..SNQ.MS..KRD...........................................L...LR...PYM.....DIIDK.......................................................................MLAQMLRDDPSFkpsggr.......................................................................lgendmDYDT...DDK....................................................................................................................................TMATLR...RQLR...RA...........................................................HE...EY....YR...C...K...S.........EYMT...YVMEA....LELE.................................................................................................................................DTIK.N....Y.E...-.-........-...-....-....----.--.............----..--.----............------..--R.Q.FI.W.R...CVL...R.....K......Q.L.QK.GFAIV.LGCMSAA..IL.LAEATLLPS...........................GVDLS.......LFSILVK..S..V.....G....-.-..-KQ.EVLV.....................Q.V.AAFV.PL.M..YM...C.IC.TYYSLFQIGM....LMF.............YSLTP...-RQTSS..VSL.....LMI...CSMVARYAP................PIS....Y.NF...L..NLIRLGg...................................................daKTTFEK......R.....M.G...N..I.D..dA.....V..P.F..FG-R..GFN.RIY.PL..FMVVYT.LLVASNF-f.......................................................................................................................................................................................................................................................
I0Z8K5_COCSC/265-491                   ......................................................................akavkeivdtlkkeeradg----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...R...G...R.........KWRG...AFRRI....----.................................................................................................................................----.-....-.-...-.-........Q...Q....Q....LIDL.EAd...........sKALE..LV.FPQAd..........dPGYAWA..VTV.M.GF.Y.L...QAF...G.....G......L.I.GA.VLSVA.WLVHVVL..YM.FV-------...........................YPPISp.....fLNSFFIT..L..-.....-....D.G..AFP.LFGT.....................-.V.AFAL.FC.F..YL...I.AI.TIKGCTKVGL...lLLV.............FTVRPm.rAGATLM..NDM.....LFN...VALVLLATNa.............aiQFC....A.QA...F..ALY-AN......................................................QMAIHE......I.....W.G...D..Q.I...-.....L..H.L..MG-I..KYL.YQL.NV..FVYCMF.FFIAA---til.....................................................................................................................................................................................................................................................
A8HPZ9_CHLRE/290-525                   ....................................................................seymrrgqiiaqrakqimnml----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...-T...........................................................MM...RR....GE...R...D...R.........RWRS...NFQKV....----.................................................................................................................................----.-....-.-...-.-........Q...R....E....VALL.EEd...........eYQLE..RV.FPQGe..........dGQVRWV..LFM.L.GF.Y.V...LAV...M.....A......V.V.GF.CLTCM.WIAQIIA..YM.LP-------...........................PVPLSp.....lLNEMFVA..L..-.....-....D.G..VFP.LFGV.....................-.L.AFAI.FC.L..YL...M.IA.AMKGNFMLGL...nFLV.............IKLYPm.rPGATMM..SSF.....LVN...TALILLMAPa.............ivQFC....A.QA...F..AVY-AD......................................................GTSIFD......V.....F.G...N..Q.-...V.....M..Y.L..IG-L..RYI.YNL.NI..FLYAML.AICLLTA-i.......................................................................................................................................................................................................................................................
A0A067FB84_CITSI/1-392                 ......................................................................................mwv----FYLISL.PLT.LG.M.V.LM......TLR..YF..AG..-...P...E.VPR..............................................................YVLFTVGYT..W..F..CSLSI.II.LVPADIWT..TISNP.........................................................................................................................................................................................................----..............-----.P...H...H...N..E..N.....GG.....I...S.................VL...W...SLSY.WSTF........LLTW..........................AV..VP.......LIQ.G....F....E.D...........A...GD....F....T....V.T..E.RL.............................RTS...V...HAN...L...LF.YL.I..VG.S.IG.L....FGL.I...LLITM-.............................................................................................................HKIRSR---...GV.LG..FAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PKSCWK...............................................................--NADWTT.RQ.K....V.L.SHKI..A....KMAV..KLDDAH...................................................................................................................................QDLS........NA.IVVA...QAT..SNQ.MS..KRD...........................................P...LR...PYM.....NVIDD.......................................................................MLTQMFK----Edpffkpqg...................................................................grlgendmDYDT...DEK....................................................................................................................................SMATLR...RHLR...RA...........................................................RE...EY....YR...Y...K...S.........EYMT...YVMEA....LELE.................................................................................................................................DTIK.N....Y.D...R.R........S...S...tG....WKYI.SS.............FRPA..RT.GKIG............---ALL..DTV.E.FV.W.K...CIL...R.....K......Q.I.QK.LLAII.LGTMSAA..IL.LAEATLLPS...........................GVDLS.......LFSILVN..S..-.....V....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------kseevfv.................................................................................................................................................................................................................................................
C4M0X4_ENTHI/3-271                     ....................................................................................niivi---ILLCAIP.ILL.LI.C.N.IY......MMI..YF..QN..P...E...E.KGVs............................................................wIWRIIVIIA..F..E..FLEMS.VF.LIPLDVLN..-----.........................................................................................................................................................................................................A---..............--GPP.E...P...I...I..P..-.....--.....M...Q.................IF...W...YIVY.YGMI........VFAA..........................II..LP.......FGL.C....W....Y.N...........Q...EE....D....T....ScV..K.KI.............................VYS...-...---...F...IF.AL.I..FL.V.VA.A....VFC.V...IFYIIFgvaevpvnyqsgdldlt...........................................................................sfnldnikaanvrpendDEESTISFR..iSP.VL..FII..SGISTIGYVLV....LF.FGGLG.FAVL...PIDLIF...............................................................-DFINRPE.PL.K....S.A.QIKE..Y....N---..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------kligeralamidegkeikqltgrkyrkrysqfreevy...................................................................................................................................................................................................................
A0A094KKJ3_ANTCR/1-127                 .....................................................................................qgir----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................ARI...-...LET...L...VM.LI.L..LA.L.LI.L....GIV.W...VASALIdn........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDLDE.QM.Y....I.I.TLEE..E....AIQR..RL----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------nggvsstveyqtvele........................................................................................................................................................................................................................................
A0A0D1YJR7_9PEZI/6-516                 ........................................................................................g-SSVFFAIAL.LVI.CL.L.V.LL......LIR..YY..LP..L...R...S.TPE..............................................................YVLVPVFLA..L..V..LPCSI.IL.LVPIDLAS..-----.........................................................................................................................................................................................................H-AVt............eDETAR.G...I...W...L..P..D.....RP.....I...R.................VS...W...RISY.WLTF........ILTW..........................IA..LP.......MLG.E....Y....C.D...........S...GY....R....E....P.K..D.RL.............................LYS...L...RSN...A...RY.QL.T..VL.S.VG.V....LGA.I...YFFIN-.............................................................................................................EGFHFN---...TL.KG..LVM..ALAYAWGLILA....IY.LMGHG.MVSI...PRRLFH...............................................................--DASVSR.RL.R....R.L.QSHA..P....KIWE..KLMEAT...................................................................................................................................EELQ........EH.EAQV...TQL..KSR.KN..GTA...........................................R..dYR...EWI.....EDLVDmvatpdtrvt..................................................aataalpaaraNVPNVITDR---...................................................................................----...---....................................................................................................................................YLADLT...RKLK...RA...........................................................RH...KK....LR...Y...L...S.........EWEH...LVHLA....TRTQ.................................................................................................................................TILD.S....N.S...S.R........K...L....D....FGKP.--.............SAYS..PF.YERI............--TILT..PYT.R.YL.M.H...TKL...I.....P......G.L.YY.LACVI.TTLASIC..VI.WSEVVHQIG...........................ASKFS.......LIGLTTI..H..H.....P....N.S..SRG.EIGFa...................gQ.F.LAAA.WL.C..YM...C.AC.ALWSITEVKV....WGN.............RALVR...-RGTYE..ESA.....CWY...AGQVAKLTV................PLS....Y.NF...V..TMMPSKi...................................................heATVFYS......F.....L.G...Q..L.V...D.....L..T.P..LG-K..GFS.GFF.PI..LVLLPV.LANLFGLY........................................................................................................................................................................................................................................................
A0A0R3TUX7_HYMNN/1-96                  .........................................................................................----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...--MLCRLVP................SLC....V.NF...L..CLAHLDshvlqnstllssaiasn...................fttsglpleslvtrsvvyETAFTK......F.....M.G...H..L.D...V.....V..P.S..IA-N..GFN.AYF.PM..VVVVLC.LVTFFSLG........................................................................................................................................................................................................................................................
A0A0A0ANW3_CHAVO/1-254                 .......................................................................................fq----ICFLLF.AVL.YI.V.S.YF......IIT..RY..KR..K...A...D.EQEdeda......................................................ivnrISLFLSTFT..L..A..VSAGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........sfPQNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLAS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KGi...........................rARI...-...LET...L...VM.LI.L..LA.L.LI.L....GIV.W...VASALIdn........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDLDE.QM.Y....I.I.TLEE..E....AIQ-..------...................................................................................................................................RRLN........GV.SSMV...EYQ..T--.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------velerelekvks............................................................................................................................................................................................................................................
A0A0N0P7F3_LEPSE/3-492                 .......................................................................................aa--YIVWTVVF.FIL.AL.V.A.SI......GAY..RY..YT..K...E...S.IKYi...........................................................piLCAIWHVIA..I..Y..MCALP.FP.LLVLDVDA..SLSAQ.........................................................................................................................................................................................................----..............----T.N...S...S...V..Q..Q.....GW.....M...R.................YI...W...IIIF.AATY........FCAW..........................VS..LP.......VCQ.M....Y....T.E...........V...GE....F....S....V.K..A.RI.............................LHS...I...KLN...L...IL.YA.I..II.V.VV.V....AAL.V...YFVVIT.............................................................................................................NSYHS--MA...NV.LK..VVI..SLANAWGLLIL....TL.FMPAG.LVGV...PRMLYR...............................................................--YADAKR.LL.R....S.R.LYEA..I....DIQE..DLDLAA...................................................................................................................................MDLA........AI.KSEL...ISI..DPQ.VS..DEN...........................................Rp.hLA...SML.....ELISKadsev............................................................pmyhlaA----------Qrvkt...........................................................................lpssDRND..vSLE....................................................................................................................................HLVGLN...TRLK...KA...........................................................IK...VV....YR...T...N...Y.........RWKS...TVHKC....DSLD.................................................................................................................................QIVR.G....V.K...S.T........S...N....R....----.--.............----..--.----............-----L..KKM.W.FP.I.R...AHV...Y.....-......-.-.-Y.TACAL.CSVLTLF..IL.WSELTMPLRd........................wvGRPLG.......VIELIM-..-..-.....-....K.S..PVH.LPGS.....................-.-.--II.FL.F..YM...A.YC.AYWAAFQFKV....FDV.............YVIYP...-SIADN..ASL.....CFN...ETFLVRLLM................PLC....Y.NF...L..LISGLSstan..............................................ktpvDVMYGH......V.....Y.R...S..N.M...D.....I..G.L..LFGS..YVN.KLL.PL..MIPFIA.AIVFFRL-t.......................................................................................................................................................................................................................................................
A0A093PTM3_9PASS/238-430               ............................................................................veyqtvelerele----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-Kv...........kSKKT..NL.ERRK............KASAWE..RNL.V.YP.A.V...MIL...L.....-......-.-.-L.IETSI.SVLLVAL..NI.LY---LLVDe........................taMPKGS.......-GGPGIG..N..A.....S....L.S..TFG.FVGA.....................-.A.LEII.LI.F..YL...M.VS.SVVGFYSL--....RFF.............ENFTP..rKDDTTM..TKI.....IGN...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAIMT.TLCLVRKF........................................................................................................................................................................................................................................................
N4V7J5_COLOR/12-518                    ........................................................................................p-SEIFALLAL.LSI.SV.V.V.LL......ILR..HY..LP..L...R...T.TPT..............................................................YYLVPIFFA..L..W..LPACM.VL.LVPVDLAS..SARTE.........................................................................................................................................................................................................----..............DEATR.G...I...W...L..P..Q.....RV.....L...L.................VS...W...RITY.WLTF........ALTW..........................FI..LP.......ILG.E....Y....S.D...........S...GY....R....E....P.Q..D.SL.............................KYS...L...RQN...A...QY.HL.M..VL.G.TA.S....VGL.V...YLFVR-.............................................................................................................YQPDFT---...TF.KT..SFM..ALAYFYGLIFA....IY.LMGHG.LVSI...PRRLLR...............................................................--YSSISG.RL.R....R.L.QTRA..P....QLHE..KMEDSL...................................................................................................................................LNLE........DV.ELQV...SEL..GRR.KT..GSA...........................................V..kFS...EWI.....EELVEianlpesqp.....................................................rsgvgaesrALPTVITE----...................................................................................----...--K....................................................................................................................................FMADLS...RKLM...RA...........................................................RH...AR....SR...Y...V...N.........EWND...LLKEA....SDTQ.................................................................................................................................AILD.A....A.A...S.K........K...L....E....FGTP.--.............SPHA..GF.WDRF............--TIHT..PYT.R.YL.Y.Y...YHF...E.....P......Y.A.SI.ASGVF.LAAASTL..IV.WSEVIKAA-...........................FPQLS.......VIRLTVV..H..H.....W....V.G..EKG.QVGFa...................gQ.V.ISVL.WL.L..YM...C.SA.TFITMTEVKT....WRG.............RALVR...-RNTAY..ESA.....FWY...AGQVAKLSV................PLS....Y.NF...M..TFLSSTi...................................................ytKTRFYG......F.....L.G...Q..L.I...D.....F..T.P..MG-E..WAD.YLF.PV..FVLVPV.AATLFGLY........................................................................................................................................................................................................................................................
G1KHI7_ANOCA/14-291                    ......................................................................................wcl-----FGLAL.LVI.LA.F.C.WV......YVR..KY..QS..R...R...E.SEV..............................................................ISTITSIFA..L..A..IALIT.SA.LLPVDIFL..VSYVK.........................................................................................................................................................................................................NQNGtf.........kdwADANV.T...R...Q...I..E..-.....DT.....V...L.................YA...Y...YTLY.SIIL........FCVF..........................LW..IP.......FVY.F....Y....Y.E...........E...KD....E....D....D.A..N.TC.............................SQV...-...-QT...A...LK.YT.L..GF.L.LV.C....TAL.L...IIGAFVpldiphkkns.........................................................................................tewekvkllfEELGSS-HG..lAA.LS..FSI..SSLTLIGMMAA....IT.YTAYG.MSAL...PLNLIKgtr.........................................................nasY------E.RL.E....N.-.----..-....----..-----T...................................................................................................................................EDIE........EV.EQNI...QRI..KSK.CK..DGR...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------plairerrtlqqledklrglrrrgrrleyieks.......................................................................................................................................................................................................................
W5MLV2_LEPOC/22-272                    ...................................................................................vsashl---FILLFKL.CFI.LV.T.T.FK......KTN..RY..LD..N...D...S.EDAtv..........................................................ntIAVTLCTFT..L..A..VSVCA.VL.LLPLSILS..-----.........................................................................................................................................................................................................NEILl...........sfPHSYY.M...Q...W...L..N..G.....SL.....I...H.................GL...W...NLVY.LFSN........LSLI..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....V....G.S..K.KGv...........................mARV...-...YET...A...VV.LL.L..LT.L.LV.L....GIL.W...VASALIdh........................................................................................................dsaARDSLYDLW..eCY.LP..YLY..SCISLLGVLLL....LL.CTPFG.LSRM...-FSVTGsll.........................................................vkpRLLEDVED.TM.S....C.A.VFEE..A....SLSL..KLT---...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rktscwislnievlkeef......................................................................................................................................................................................................................................
A0A078F6T9_BRANA/1-518                 ......................................................................................mwv----FYLISL.PLT.LG.L.V.VF......TLR..YF..AG..-...P...E.IPR..............................................................YVLITVGYT..W..F..CSVSV.II.LAPADIWT..-----.........................................................................................................................................................................................................T---..............-LSLP.P...N...H...P..E..N.....GA.....I...S.................FL...W...SWSY.WSTF........LLTClslrlnqwk........fafhvdlawAV..VP.......LIQ.G....F....E.D...........A...GD....F....T....V.S..E.RL.............................KTS...V...HVN...L...VF.YL.V..LG.F.VG.L....LGL.I...LLIMM-.............................................................................................................----HRNWK..gSI.LG..YAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PKSLWR...............................................................--NADWTT.RQ.K....V.L.SHKI..A....KIAV..KLDNAH...................................................................................................................................QELS........NA.IVVA...QAT..STQ.MS..KRD...........................................P...MR...PYM.....NVIDA.......................................................................MLAKMFREDPSFkpqggq.......................................................................lgendmDYDT...DEK....................................................................................................................................SMATLR...RHLR...NA...........................................................KE...EY....YR...Y...K...S.........EYLT...YVTEA....LVLE.................................................................................................................................DTMK.N....Y.E...R.R........D...St.gwK....YISS.FR............tSRNG..KW.R---............---NLL..DTL.E.FI.W.R...CLL...K.....K......Q.I.QM.MLAIV.TGIMSAA..IL.LAEATLLLS...........................KLDLS.......LFSILIR..F..-.....V....K.S..DE-.-LLV.....................Q.A.FAFV.PL.V..YM...C.IC.TYYSLFKIGM....LMI.............YSLTP...-RQTSS..VNL.....LMI...CSMIARYAP................PIS....Y.NF...I..NLIQLR.....................................................sETIFEK......K.....M.G...R..I.D...D....aV..P.V..FG-Q..RFN.EIY.PL..IMVIYT.LLVASNF-f.......................................................................................................................................................................................................................................................
A0A0N4U1H1_DRAME/25-259                .........................................................................................RQYIVCLLLF.TVI.YL.I.S.YS......IIR..IL..KG..R...S...D.NDElysgse..................................................dffvfrISLWVCTFS..L..T..ISIGA.AM.LLPFSIVS..-----.........................................................................................................................................................................................................SEIIy...........vyPNNYY.F...Q...W...L..N..W.....QL.....I...H.................SL...W...NYIF.ALSN........LSLF..........................IL..LP.......FAY.F....F....I.E...........S...QG....F....R....G.H..G.KGi...........................mTRI...-...YET...I...AV.CI.L..LF.I.VL.I....CLA.D...ILHSIVisn.......................................................................................................atcLSQSLLNFT..sIN.LP..FIY..SCVSLFGVFTL....LI.TTPIG.FAHM...-FTIVSshl.........................................................lakSIKRKES-.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------wdekachleyntfi..........................................................................................................................................................................................................................................
A0A0A1N0K7_9FUNG/8-194                 ......................................................................................awg----IYAAIF.IAL.VV.F.N.IG......FTK..YY..QS..L...R...D.SEL..............................................................SVTMVTAAM..L..S..IAMGT.VA.LVPLDIFL..VSNTVdrh..................................................................................................................................................................................................tglkK--Tw...........adEDTIY.W...M...T...L..A..-.....--.....V...Q.................VL...Y...YVFF.GLIL........VFSF..........................FI..IP.......FSY.I....Y....Y.E...........S...GR....R....A....K.-..-.AL.............................KYS...F...F--...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------fgmmgillylfglflkptilpphidlewfknllmesngakafwfvvgclfipgilifivyts..........................................................................................................................................................................................
A0A094KKJ3_ANTCR/109-311               ....................................................................rrlnggvsstveyqtvelere----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....LE--.-Kv...........kSKKT..NL.ERRK............KASAWE..RNL.V.YP.A.V...MIL...L.....-......-.-.-L.IETSI.SVLLVAL..NI.LY---LLVDe........................taMPKGS.......-GGPGIG..N..A.....S....L.S..TFG.FVGA.....................-.A.LEII.LI.F..YL...M.VS.SVVGFYSL--....RFF.............ENFTP..rKDDTTM..TKI.....IGN...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NM..LFAIMT.TLCLVRKF........................................................................................................................................................................................................................................................
H2RZ81_TAKRU/1-552                     .........................................................................................MSGAALGIEI.VVV.FF.L.A.LF......LLH..RY..GD..F...K...K.QQR..............................................................MVLFGTLLA..W..Y..LCFLI.VF.ILPLDVST..TIYKQckidqeqepvstlt.............................................................................................................................................................................plptnhttsnatptK-SVp............tPCYKP.W...S...Y...I..P..D.....GI.....M...P.................VF...W...RVVY.WTSQ........CLTW..........................LL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....SLL.I...YVAVH-.............................................................................................................PEWHLT-WY...EL.QT..IGI..TAANTWGLFLL....VL.LLGYG.LVEI...PRSYWN...............................................................--ASRHGH.LL.I....K.T.YFKA..S....KLMT..EKADAE...................................................................................................................................ENLE........DV.MEEV...RKI..SES.IK..YNH...........................................P...LR...KYV.....DTILR.......................................................................KCPVEYQEKMGRnmddye.......................................................................dfddkqNTYP...SEK....................................................................................................................................SLAKLH...KQVI...YA...........................................................VQ...RH....NR...T...R...V.........QWQM...LLQQA....IHLE.................................................................................................................................DVAK.N....E.T...S.L........T...H....Q....FVHS.FPs...........aEPDG..WF.TRY-............---IYT..PTV.E.WY.W.E...CLL...K.....H......W.F.YR.LLSVI.LALFSVA..VV.WSECTFFST...........................RPVLS.......LFAVFI-..Q..L.....A....E.R..DYN.YLYI.....................E.M.ACFI.TI.F..FL...C.TC.VYSTVFRIRV....FNY.............YYFAS...HHQTDA..YSL.....QFS...GMLFCRLTP................PLC....L.NF...L..GLIHMDsais.............................................hqqkeQTAYTS......I.....M.G...S..M.H...V.....I..S.F..IA-N..GFY.IYY.PM..LIVILC.IATYFSLG........................................................................................................................................................................................................................................................
I3K2D5_ORENI/18-257                    .........................................................................................RETIICVLLF.TCL.YM.L.S.YL......ILN..QF..RK..T...A...E.FVTddved....................................................atvnkIALWLCTFT..L..S..VAVCA.VL.LLPISILS..-----.........................................................................................................................................................................................................NEVLl...........tfPQSYY.M...Q...W...L..N..G.....SL.....I...H.................GL...W...NLVF.LFSN........LSLV..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....A....G.S..R.KGv...........................mARV...-...YEA...V...VL.LL.L..LA.L.LV.L....GIV.W...VASALLhd.........................................................................................................niARKSLYDLW..eYY.LP..YLY..SGISLFGVLLL....LL.CTPLG.LSRM...-FSVTGsll.........................................................vkpRLLEDVED.TL.S....C.T.TFEE..D....SLSR..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------kincgsts................................................................................................................................................................................................................................................
A0A0F9WZ12_TRIHA/9-290                 .....................................................................................gliw-----LAYAV.VVL.LC.L.G.AA......IIT..TFtwQT..P...I...D.RSA..............................................................MVSIVAIVS..L..T..SLLAT.VL.LLPVDIAL..VSSTG.........................................................................................................................................................................................................SSALgv..........kkDWATP.K...R...V...A..D..I.....LL....tL...K.................VV...Y...YSLY.SFDA........LLCL..........................LV..IP.......FAY.F...wY....E.E...........Y...DE....V....A....F.E..E.EG.............................RTW...-...KSR...F...WA.AT.K..YT.L.FF.V....ALT.V...VLFILGffvpaaggn..........................................................................................kghwdldyykS-LLSQNHG..eKA.LT..FAL..GLLVTLGTFLY....VV.YTSAG.LALL...PISFIKsappisapql...........................................sattasqleqNRERQHQL.EL.R....N.A.GREE..G....MSR-..---KDR...................................................................................................................................RELD........AL.IREE...Q--..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------tlvrrerlaae.............................................................................................................................................................................................................................................
X0K5R1_FUSOX/12-523                    ........................................................................................g-SAIFSCIAL.VVI.SL.V.V.LL......ILR..YY..LP..L...R...T.TPA..............................................................FYLIPIFFA..L..W..LPTIV.VI.LVPVDLAS..-----.........................................................................................................................................................................................................SAVT.............gDEESR.G...I...W...L..P..E.....RV.....I...L.................VS...W...RISY.WLTF........ALTW..........................FI..LP.......ILA.E....Y....S.D...........S...GY....R....E....P.Y..D.KF.............................MYS...V...RSN...A...QF.HA.I..VL.G.FG.F....VGL.I...YYVIS-.............................................................................................................SGFSFK-VD...VI.KG..TIM..ALAYCWGLILA....IY.LMGHG.LVSI...PRRFMR...............................................................--GASISG.RL.R....R.L.QSKA..P....KVYE..EMEDSI...................................................................................................................................TKLE........DI.EVQV...AEL..GRR.KT..GSA...........................................N..tYR...DWI.....EELQEmanlpesqpr..................................................gtrfgsssdnnIIPHVITEK---...................................................................................----...---....................................................................................................................................YLADLT...RKYV...RA...........................................................RH...AR....SR...Y...V...N.........AWSD...LVQEA....AETQ.................................................................................................................................AILD.S....A.A...S.K........K...L....D....FGEV.--.............SPHA..TF.WEKT............--AILT..PYT.R.YL.Y.Y...YQI...L.....P......Y.A.QV.LLGLS.LAAASAC..IV.WSEVVKFA-...........................FPKLS.......IIRLTVV..H..H.....W....V.G..DKP.EVGFa...................gQ.A.ISSF.WI.C..YM...C.AA.ALISMTEVKV....WRG.............RALVR...-RNTAH..ESA.....FWY...AMQVAKLTI................PIS....Y.NF...I..TFLSSQv...................................................ynKTVFYH......F.....L.G...Q..L.I...D.....F..T.P..LG-R..YFD.DLF.PV..VVLFPV.FATLFGI-y.......................................................................................................................................................................................................................................................
A0A167R769_PHYB8/8-431                 .....................................................................................awmt-----FGMVS.VGL.YL.F.S.AG......FIN..YY..HD..K...H...H.SRV..............................................................AVTLVSVLS..V..G..LSLCL.LA.LLPVDVFL..VSLTVdh.....................................................................................................................................................................................................qtG--Lkq..........ewADEDT.V...Y...W...I..T..M.....A-.....T...F.................IV...Y...YGCH.ALIG........LLLF..........................FV..LP.......FAY.F....Y....Y.K...........K...YD....E....D....Q.-..D.RR.............................QRAltgI...RYT...V...GF.GI.L..AS.V.LF.M....IGL.F...-----Grptqlpv..............................................................................................qlelewflNLINESHGE...KA.IS..FVM..ACPQLLGMFIF....VA.YTAPG.LSIL...PFKFLK...............................................................-DRGRVDT.EY.E....D.I.---T..A....RLA-..SNIEQQ...................................................................................................................................RKIE........--.----...-HH..PTS.SR..STH...........................................-...--...---.....-----.......................................................................-----------S...................................................................................EQER...TLH....................................................................................................................................NLIDEA...KIFE...RQ...........................................................LK...DL....ED...D...R...N.........KWRY...KLWLM....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.---F............RPFELA..FGI.F.LL.V.V...SFL...-.....-......I.V.LC.IILSC.FDKMVFS..IC.GSECGYIAS...........................SPDFF......qPINFIL-..V..N.....I....Q.R..AFP.-LDY.....................-.M.LLVG.LI.V..YL...L.VV.TMVGIDSLGL...kFLW.............VTLYRv.eRKATGA..QAL.....VIS...STLLTLGLL................AAN....Y.SI...V..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------sfiapayahfgs............................................................................................................................................................................................................................................
Q57XX2_TRYB2/297-431                   ...................................................................................pfivyg----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.KL.LIGIL.SVALSIS..WV.LQ-IFLHNTf........................kiVPF--.......LS--TLV..T..A.....L....D.E..VFP.LFGI.....................-.I.TYGI.FA.F..YL...V.WI.TLEGQIRVGL...rFVF.............FQIHPm.kPHDTTL..NSI.....VFN...VGLLLLTSY................AIL....Q.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------fttrsfneyiprtsinalmnlyv.................................................................................................................................................................................................................................
A0A016X0Z7_9BILA/1-92                  .........................................................................................----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...M.AT.SLTGLYSM--....PFV.............RALRP..rRRRTSL..TVI.....IIN...CSLVLVLSSa..............lPVL....A.NT...L..GITSFD......................................................------......L.....L.G...A..Y.S...S.....L..K.W..LSNF..KLV.LAY.NV..LFAAAT.IVCVFSK-i.......................................................................................................................................................................................................................................................
A0A074X3F4_9PEZI/9-287                 ......................................................................................iwv----AYAVAL.AIL.LV.V.A.SI......FVY..LY..QA..P...R...E.RSA..............................................................VVSIVCIIT..V..L..SLLAT.VL.LLPVDVAL..VSSTT.........................................................................................................................................................................................................SSKL..............GKKKD.WatpD...A...V..D..N.....ILf...qL...K.................IV...Y...YTLY.SLDA........VLCL..........................IV..VP.......FTY.F....W....Y.E...........E...RD....E....V....A.A..E.EG.............................TQT...-...-AA...A...RL.WG.A..FK.Y.TI.A....FIL.F...VVIIFLvgffvpvakn........................................................................................rpqkhldldffKDLLAENHG..eRA.LT..FCV..GLLLTLGTLLY....CI.YTAPG.LALL...PLTLIKtapr.......................................................isapTLAANTSS.QL.T....Q.N.RERQ..R....QLEN..RN----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------egrdsgldtrdrrelealireertlvrrerla........................................................................................................................................................................................................................
A0A0A0A3U6_CHAVO/1-543                 .........................................................................................MSGAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIIATLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRcklavnssp......................................................................................................................................................................................aesngsyvtvA--Ps...........kqKCFKP.W...S...Y...I..P..N.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PNFNLQ-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSHWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DI.MEEV...RKV..SES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQERMGRnmddye.......................................................................dfderqNSYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FHs...........qEPEN..KI.IQ--............--YFYT..PTV.E.WY.W.E...CLL...R.....P......W.F.YR.VLAVV.LATFSVI..VV.WSECTFFST...........................KPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.M.ACFL.TI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDstis.............................................hkntqPTAYTS......I.....M.G...S..M.R...V.....L..T.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
M4AFY0_XIPMA/10-297                    .....................................................................................sgic----IFFKML.MVI.LA.F.C.WI......YIR..KF..QS..R...Q...D.SEV..............................................................ISTITAICA..L..A..IALIT.SA.LLPVDIFL..VSYMKypng................................................................................................................................................................................................tfkqwA---..............ANNET.R...G...Q...I..E..A.....TV.....L...Y.................GY...Y...-TLY.SIIL........FCVF..........................LW..IP.......FVY.F....Y....Y.E...........E...KD....D....N....N.V..N.KC.............................SQV...-...-KN...A...LK.YT.V..GF.V.LV.C....VAL.L...LIGAFVpleappgqns.........................................................................................tqwekvqylfDELGSS-HG..lPA.LS..FSI..SSLTLIGMLAV....IT.YTAYG.MSVM...PLNLIKgtrsva..................................................yerlentEDIDEVEH.QI.E....N.L.KSKC..K....DGRP..LSSKDR...................................................................................................................................RNLQ........EL.EGKL...QVL..QR-.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rgrhldiaeshccskvgs......................................................................................................................................................................................................................................
X0D412_FUSOX/12-523                    ........................................................................................g-SAIFSCIAL.VVI.SL.V.V.LL......ILR..YY..LP..L...R...T.TPA..............................................................FYLIPIFFA..L..W..LPTIV.VI.LVPVDLAS..-----.........................................................................................................................................................................................................SAVT.............gDEESR.G...I...W...L..P..E.....RV.....I...L.................VS...W...RISY.WLTF........ALTW..........................FI..LP.......ILA.E....Y....S.D...........S...GY....R....E....P.Y..D.KF.............................MYS...V...RSN...A...QF.HA.I..VL.G.FG.F....VGL.I...YYVIS-.............................................................................................................SGFSFK-VD...VI.KG..TIM..ALAYCWGLILA....IY.LMGHG.LVSI...PRRLMR...............................................................--GASISG.RL.R....R.L.QSKA..P....KVYE..EMEDSI...................................................................................................................................TKLE........DI.EVQV...AEL..GRR.KT..GSA...........................................N..tYR...DWI.....EELQEmanlpesqpr..................................................gtrfgsssdnnIIPHVITEK---...................................................................................----...---....................................................................................................................................YLADLT...RKYV...RA...........................................................RH...AR....SR...Y...V...N.........AWSD...LVQEA....AETQ.................................................................................................................................AILD.S....A.A...S.K........K...L....D....FGEV.--.............SPHA..TF.WEKT............--AILT..PYT.R.YL.Y.Y...YQI...L.....P......Y.A.QV.LLGLF.LAAASAC..IV.WSEVVKFA-...........................FPKLS.......IIRLTVV..H..H.....W....V.G..DKP.EVGFa...................gQ.A.ISSF.WI.C..YM...C.AA.ALISMTEVKV....WRG.............RALVR...-RNTAH..ESA.....FWY...AMQVAKLTI................PIS....Y.NF...I..TFLSSQv...................................................ynKTVFYH......F.....L.G...Q..L.I...D.....F..T.P..LG-R..YFD.DLF.PV..VVLFPV.FATLFGI-y.......................................................................................................................................................................................................................................................
A0A087V5A7_BALRE/1-251                 .......................................................................................fq----ICFLLF.AVL.YI.V.S.YF......IIT..RY..KR..K...A...D.EQEdeda......................................................ivnrISLFLSTFT..L..A..VSAGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........sfPQNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLAS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KGi...........................rARI...-...LET...L...VM.LI.L..LA.L.LI.L....GIV.W...VASALIdn........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDLDE.QM.Y....I.I.TLEE..E....AIQ-..------...................................................................................................................................RRLN........GV.SSTV...EYQ..TVE.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------lerelek.................................................................................................................................................................................................................................................
A0A093GCW6_PICPB/243-371               ........................................................................nldmellreqlltipsr----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............--RR..TL.ELRH............RASPWQ..RNL.G.YP.L.A...MLG...L.....-......-.-.-L.ALTGI.SVLIVCF..HV.LE---LLLDd........................aaMPRG-.......MQDASLG..Q..V.....S....F.S..IFG.SFGA.....................-.A.LQVI.LI.L..YL...M.VS.SVVGFYSS--....PLF.............THLLP..qRQDTPL..TK-.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------v.......................................................................................................................................................................................................................................................
A0A0B2SHM7_GLYSO/1-498                 .....................................................................................mwvf-----YLISL.PLT.TG.M.V.LF......TLR..YF..AG..-...P...Y.VPR..............................................................YVLFTVGYT..W..F..CSLSI.II.LVPADIWA..TMSSN.........................................................................................................................................................................................................Q---..............-----.-...-...-...V..-..N.....GA.....I...S.................FF...W...SWSY.WSTF........LLTW..........................AV..VL.......LIQ.G....F....E.D...........A...GD....F....T....V.S..E.RL.............................KTS...V...HVN...L...IF.YL.I..VG.S.IG.L....FGL.I...LLILTH.............................................................................................................-----NKWK..gSL.LG..FAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PKSIWR...............................................................--NADWTI.RQ.K....V.L.THKI..A....QMAV..KLDDAH...................................................................................................................................QELS........NA.IVVA...QAT..SKQ.MS..KRD...........................................P...LR...PYM.....NVIDD.......................................................................MLTQMFREDPSFkpqggr.......................................................................lgeddmDYDT...DEK....................................................................................................................................SMATLR...RHLR...GA...........................................................RE...EY....YR...Y...K...S.........GYMT...YVLEA....LELE.................................................................................................................................DTIK.N....F.D...R.R........N...S...tG....WEYN.SS.............---I..RP.ARTG............KLGSLF..DTL.E.FL.W.K...CIL...R.....K......Q.V.EK.GLAVI.LGIMSVA..IL.LAEATLLP-...........................SIDLS.......LFSILIK..S..-.....V....-.-..GTE.EVLV.....................Q.V.FAFV.PL.M..YM...C.IC.TYYSLFKIGM....LMF.............YSLTP...-RQTSS..VNL.....LMI...CSMVARYAP................PVS....Y.NF...L..NLIRLGk...................................................nkTTLFEQ......R.....M.G...N..I.D...N....aV..P.F..FG-D..EFN.KIY.PL..IMVIYT.ILVASNF-f.......................................................................................................................................................................................................................................................
F4WJT5_ACREC/1-535                     ......................................................................................mvl---GAFLTEI.IVA.FL.L.A.GT......LLF..KY..GN..V...F...R.HHI..............................................................AVTISVLIA..W..Y..FSLLI.IF.ILPLDVSS..TVFRQcveqnihn.........................................................................................................................................................................................stkdpnntT--Sap..........fiTCKEP.W...P...N...V..P..E.....NV.....F...P.................NL...W...RIVY.WTSQ........CLTW..........................LI..LP.......LMQ.S....Y....I.K...........A...GD....F....T....I.R..G.KL.............................KSA...L...IDN...A...IY.YG.S..YL.F.IC.G....ILL.I...YIALK-.............................................................................................................PGLDLD-GQ...KL.KA..IAS..SASNTWGLFLL....VL.LLGYA.LVEV...PRGLWN...............................................................--ASKPGY.TL.N....Y.S.YFKV..A....KLSL..DKCEAE...................................................................................................................................ETVD........DI.LESL...QVA..TIS.IG..PGH...........................................P...FH...CNL.....ETIFQ.......................................................................KIPAELKDRMNRrqlp...........................................................................ddtpTDTP...TEK....................................................................................................................................ALIRLH...RQTI...KA...........................................................LQ...TL....QR...I...E...T.........QWGI...LVDKI....FDLE.................................................................................................................................DVAK.N....Q.V...S.H........D...R....R....FKQA.FP.............MHRS..LP.FR--............--IIYN..PVV.E.WY.W.K...CIV...K.....D......Y.V.LK.AAAIC.AGCLSVA..VV.WSEVTFFNK...........................SPVLS.......LFAQFL-..N..L.....A....K.R..NYD.YFTI.....................E.V.LSTL.II.A..YL...C.YC.AYSTVLKIRV....LNL.............YYLAP...HHQTNE..YSL.....IFS...GMMLCRLTP................PMC....L.NF...L..GLIHMDshii.............................................kthilETHYTQ......V.....M.G...H..M.D...V.....I..S.I..IS-D..GFN.VYF.PM..AILAFC.LATYFSI-g.......................................................................................................................................................................................................................................................
A0A139HQD7_9PEZI/8-511                 .....................................................................................sstl----FATTSA.VVI.AL.L.V.LL......LIR..HY..LP..L...R...S.TPA..............................................................YLLLPVFLA..L..F..LPASI.II.LVPVDLAS..-----.........................................................................................................................................................................................................VERN.............gDEHAK.A...F...W...L..P..E.....RA.....L...L.................VT...W...RITY.WLTF........ILTW..........................FL..LP.......FLA.E....Y....C.D...........S...GY....R....D....A.K..H.RS.............................IYS...L...RAN...F...RY.QL.I..VL.A.SG.I....AGL.V...YFIWQ-.............................................................................................................NGFHAE---...SI.KG..LAM..ALAYAWGLILG....LG.LMGHG.LVAL...PRRLFK...............................................................--NAKVSN.RL.R....W.L.HSQA..P....KVKD..KLDDAS...................................................................................................................................DKLE........QL.ENTL...LQL..KRH.KG..GAS...........................................R..eQQ...LWI.....DELAEtsslpdmrpg...................................................maaaiqatapGIPAVVTDR---...................................................................................----...---....................................................................................................................................YLADLT...RKLK...RA...........................................................RH...RK....AR...F...L...D.........EWDQ...LVERA....WEMQ.................................................................................................................................TILD.A....A.T...S.K........K...L....D....FGRS.--.............SGST..SL.IDR-............-LTFLT..PSM.R.FY.L.H...MNV...I.....P......V.S.RI.AVSAV.LGIMSIF..IV.WSELVKAF-...........................APSLS.......IIGISVV..H..G.....A....R.V..N--.-FGG.....................Q.L.IAAV.WL.L..YM...D.TA.ALYAIADVKV....WGN.............RALVK...-RQTYA..ESA.....CWY...SLQVAKLTV................PLS....Y.NF...I..TMM-PDav..................................................fkDTMFFQ......F.....L.G...K..L.I...Q.....L..T.P..LG-Q..GFS.AFF.PC..FLLLPV.LATLFNLY........................................................................................................................................................................................................................................................
A0A151RQJ3_CAJCA/276-488               .................................................................................ersgskgr----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........KFRK...NVKSV....----.................................................................................................................................----.-....-.-...-.-........E...K....E....LLQL.EEd...........vNLLE..EM.YPQGe..........kAETTWA..LTV.L.GY.L.A...KLV...L.....G......I.L.GF.IVSVA.WVAHIII..YL.LI-------...........................DPPLSp.....fLNEVFIK..L..-.....-....D.D..IWG.LLGT.....................-.A.AFAF.FC.F..YL...L.LA.VIAGAMMLGL...rLIF.............ITIHPm.kWGATLM..NSF.....LFN...VGLILLCSIsviqfcstafayyaqaTAA....Q.EI...F..GHT---......................................................------......-.....-.-...-..-.-...-.....L..E.S..LRGI..KYL.YKY.NV..FQIAFV.ALAGLT--fv......................................................................................................................................................................................................................................................
D3B509_POLPA/22-448                    .......................................................................................nw---IMLFIEL.FGV.GV.V.V.FI......AMK..QY..IS..F...K...R.TPF..............................................................YAMFTAFLG..W..Y..LCFNI.VF.LVPLDITA..TIHGEclvkand..........................................................................................................................................................................................tctinnttS--Cei..........nnMCPEP.I...S...Y...L..P..D.....VI.....V...V.................NQ...W...RILY.WGTF........VLSW..........................LI..FP.......ILQ.T....F....S.G...........T...GD....F....R....I.R..E.RL.............................LRA...I...KEN...I...IL.YC.F..MG.I.VG.L....ITL.I...IILAM-.............................................................................................................RLQALA---...TL.VQ..STF..IVLNVYGLVLV....VV.TMGFG.LVDV...PRNLLR...............................................................--KGDYYR.TL.R....H.Y.RVHA..L....ELKN..ELDEST...................................................................................................................................KKLE........HH.LRLI...KQT..SDR.AG..EYH...........................................P...YR...PYL.....DIIIS.......................................................................KCPLEFDQVDTEdm..............................................................................seaSDEI...TYS....................................................................................................................................KVVEMH...ANLM...DF...........................................................TH...QA....ER...A...D...T.........SYKR...LLGKA....FATE.................................................................................................................................DIIA.T....L.E...K.P........S...D....L....RS--.--.............GKIE..WS.FKQT............SSNPTK..ARW.E.YY.W.H...LYI...Y.....P......N.F.YK.ALGAL.GAIMSLL..IV.WAEISMAFSss.......................nlANVKS.......PFAMII-..R..S.....T....D.A..SMN.GLGL.....................Q.I.FCFI.PL.I..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------lv......................................................................................................................................................................................................................................................
A0A0N8JVF7_9TELE/271-458               .......................................................................ralletvlkalsafvlse----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..-M.RK--............RASPWQ..RNL.G.YP.L.A...MLL...L.....-......-.-.-L.ALTVV.CVLMVSF..HV.L----ELLFde.......................saMPRG-.......MEDPLLG..A..A.....S....F.S..MFG.SLGA.....................-.A.VQVV.LI.L..YL...M.VS.SVVGFYSS--....PLF.............AGLLP..hSQDTNL..TQI.....IGN...CISLLVLSSa..............lPVF....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....Y..N.W..LGNF..KIV.FLY.NM..LFAGLT.SASLINT-v.......................................................................................................................................................................................................................................................
A0A0V1NK79_9BILA/1-534                 .........................................................................................MNVALLAVQL.LFV.FI.I.V.VL......ILH..QY..GD..W...Q...R.QHF..............................................................LVSFSTVVA..W..F..LAFVI.VF.MLPLDVVL..TFHRLcdnreii...........................................................................................................................................................................................vnndtnrS--Fvp.........adgNCQSS.D...I...D...L..P..D.....NV.....L...P.................IL...W...RFVY.WTSQ........LLTW..........................II..LP.......IMQ.S....Y....S.N...........A...GE....F....T....A.L..G.KL.............................KRA...L...INN...A...LY.YG.T..YL.I.VF.A....FLL.L...YAVSKG.............................................................................................................HYLNA---G...NL.KT..ICI..AASNTWGLFWL....VL.LLGYG.LVEV...PRNTWL...............................................................--NSKPGY.TL.M....K.L.YFKL..G....KLMV..ERNDAE...................................................................................................................................ETVK........EL.CQQA...YLL..SLQ.NE..NCS...........................................V...RY...PML.....KVILE.......................................................................KFPTSMVRAVEKkapq..........................................................................tiaqsDKQS...SEK....................................................................................................................................MLILFH...KQVI...KS...........................................................LQ...DY....NR...T...N...A.........QYDA...AMANA....IYLE.................................................................................................................................DVEK.N....Q.Q...S.P........D...T....Q....SLIV.--.............QNQN..PL.IGV-............---ICH..PTI.R.WY.F.D...CHL...K.....R......Y.L.LI.VLSVF.CCIMSVF..IV.WSEMTFSNV...........................NPPLS.......LAALFV-..H..M.....A....A.G..DKN.YMFI.....................E.M.FSIT.TI.S..YM...C.IC.AYYTVFRLKV....YRY.............YHLDS...HHHTDE..NSL.....LFS...AILLCRLTP................PLC....L.NF...L..GIIHMDmhvtk...........................................dlnlqtETAYTK......L.....M.G...H..L.D...V.....I..E.P..IS-S..WFN.IYF.PM..AIILLC.IFTFFRL-g.......................................................................................................................................................................................................................................................
A0A093TG25_PHACA/1-543                 .........................................................................................MSGAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIIATLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRcklalnssp......................................................................................................................................................................................aenngsyvtlA--Ps...........rqKCFKP.W...S...Y...I..P..N.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PNFNLQ-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSHWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DI.MEEV...RKV..SES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQERMGRnmddye.......................................................................dfderqNSYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FHs...........qEPEN..KI.IQ--............--YFYT..PTV.E.WY.W.E...CLL...R.....P......W.F.YR.VLAVV.LATFSVI..VV.WSECTFFST...........................KPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.M.ACFL.TI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDatis.............................................hkntqPTAYTS......I.....M.G...S..M.R...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
D3ZUP8_RAT/1-549                       .........................................................................................MSGAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIVGTLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRcrhaaanssppen...............................................................................................................................................................................snvtgvyasvtpaQRQH..............PCFKP.W...S...Y...I..P..D.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PRLHLE-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSYWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DV.MEEV...RKV..NES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTDYQEKMGRnmddye.......................................................................dfdekrNTYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...H....Q....FVHT.FQs...........pEPEN..RF.IQY-............---FYN..PTV.E.WY.W.E...CLL...R.....P......W.F.HR.ILAVV.LSIFSVI..VV.WSECTFFST...........................TPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.I.ACFL.SI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDasis.............................................hqntqPTAYTS......I.....M.G...S..M.K...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
A0A0J6YGU8_COCIT/15-520                ........................................................................................g-SGIFAAFAV.VSI.FF.L.V.LL......LLR..HY..LP..L...R...S.TPA..............................................................YLALPVFLA..L..A..LPASV.IL.LVPIDLTS..STS--.........................................................................................................................................................................................................----..............GSSPS.G...I...W...L..P..S.....RV.....M...L.................VS...W...RITY.WLTF........VLTW..........................LI..LP.......LLG.E....Y....V.D...........S...GH....R....T....P.R..A.RI.............................AYS...L...RSN...A...RY.QL.L..ML.S.CG.I....VGL.V...YVLIQ-.............................................................................................................NGFRFS---...SL.KS..LVM..ALAYVWGLVLA....IY.LMGHG.LVAI...PRGLWR...............................................................--NVNPGN.RL.R....R.L.QSRA..P....LIYD..RLIDAK...................................................................................................................................SSLE........DI.RAQV...SQL..ERR.KT..SVP...........................................L..dLQ...DWI.....DDLVEgadfpgarpp...................................................qlaladasrpTGP---------...................................................................................---Vv.iTER....................................................................................................................................YLAELT...RNLN...RA...........................................................RH...KN....AR...F...T...D.........AWSR...LVQEA....ADCQ.................................................................................................................................AIID.S....S.T...S.K........H...L....E....FSRY.--.............TSHS..TL.SHRR............--PLLT..PYL.R.HV.L.H...FHV...L.....P......A.V.RI.VCAGL.FSIASAC..IV.WSEFVKSF-...........................APSIS.......IVSLSV-..T..H.....A....Y.H..GTA.TVSFl...................gQ.M.VASG.WL.L..YM...C.SA.AFAGVTDTKV....WGN.............RALVR...-RNTYG..ESA.....CWY...AGLIARLTV................PLA....Y.NF...L..TLLSRNv...................................................qhQTTFYA......F.....L.G...R..F.I...D.....L..T.P..LG-K..GFD.YFF.PI..FILVPV.AATLFNMY........................................................................................................................................................................................................................................................
M0XVI4_HORVD/1-499                     ......................................................................................mwv----FYLIAL.PLT.VG.M.V.AA......TLR..YF..AG..-...P...A.VPL..............................................................HVLATVGYA..W..L..CSLSF.VI.LVPTDIYT..TITGN.........................................................................................................................................................................................................Q---..............-----.-...-...-...-..-..K.....GD.....V...G.................FF...W...SWSY.WSTF........VLAW..........................AI..IP.......TIK.G....Y....E.D...........A...GD....F....T....V.K..E.RL.............................KTS...I...RAN...L...LY.YE.I..VG.A.IG.F....SGI.V...LIIIM-.............................................................................................................---HHD-WG..gAI.LG..FAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PKDIWR...............................................................--NADWTR.RQ.K....I.L.SHMI..A....KMAV..KLDNAR...................................................................................................................................QEYC........NT.ISVV...QAT..SSQ.MS..KRD...........................................P...LK...PFM.....DIIDN.......................................................................MLAQMLRDD--Plfklsgg....................................................................nklaendmDYDT...DEK....................................................................................................................................TMAALR...RRLR...IA...........................................................HE...EY....CR...C...K...S.........KYTT...SVMEA....LELE.................................................................................................................................DTVT.N....Y.E...Q.H........D...A....D....AWKY.VS............dLRES..RT.GTLG............---SFL..DHI.E.FI.W.R...CIL...L.....N......R.L.LK.VLSVL.LGCISAA..IL.LAEATLLPT...........................GVHLS.......LFSVLI-..N..A.....A....G.K..QEV.LV--.....................Q.V.VAFA.PL.M..YM...C.IC.TYYPLFRIGM....MVV.............YSLTP...-GQTSP..VSL.....LMI...CSMVARYAP................AIS....Y.NF...L..NLVHLGg...................................................dvRTTFEK......R.....M.G...S..I.D..dA.....V..P.F..FG-R..NFN.RIY.PL..IMVVYT.ILVAGN--ff......................................................................................................................................................................................................................................................
A0A0D8Y4R4_DICVI/1-188                 ......................................................................................msw----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....SL.....I...N.................NL...W...NYVF.ALSN........LSLF..........................VL..LP.......FSY.F....F....I.E...........S...QG....F....K....K.N..K.NGi...........................mQRV...-...YET...L...AV.CT.L..LI.V.VI.L....CLA.D...IVLALM............................................................................................................sSSVSIISIT..sVN.LP..LVY..SFVSLAGVMLL....LL.STPIG.FAKM...-FAIAGemtvvpdrdd..........................................iiinrlekyyeERTRN---.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ansnmtsnkfwqrncdpptfyspvlhrfstlrqrpqkifpagmn............................................................................................................................................................................................................
A0A0D2AM56_9PEZI/9-291                 ......................................................................................iwv----AYAVAI.AIL.LI.I.A.AL......FVF..IY..QD..P...R...E.RAP..............................................................SVTTVCIFT..T..L..CLLAT.VL.LMPVDIAL..VSATTsskwgr.............................................................................................................................................................................................kkdwatP---..............-----.-...D...K...V..D..S.....ILy...aL...E.................IV...Y...YCLY.SLDA........LLCL..........................LV..IP.......FTY.F...wY....E.E...........S...ED....E....E....G.E..R.TL............................gQKF...-...WGA...F...KY.TV.F..FI.L.IV.V....ILF.L...VGFFVPyakgirdd............................................................................................egdknldyfKKLLTENHG..eRA.LT..FAL..GLLISIGTLVY....II.YTAAG.LALL...PVALIKsapsisapgl...........................................aantashleqNRERQRQL.EL.R....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------negreggldsrdrreldalvreertlvrrerlaaearg..................................................................................................................................................................................................................
A0A091QT28_9GRUI/1-106                 ....................................................................................elrhr----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............-VSPWQ..KNL.G.YP.L.A...MLG...L.....-......-.-.-L.ALTGI.SVLIVCV..HE.L-----LLDe........................aeMPRG-.......IQDASLG..Q..V.....S....F.S..IFG.SFGA.....................-.A.LQVV.LI.F..YL...M.VS.SIVGFYSS--....PLF.............TRLLP..eRQDTPL..TK-.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------v.......................................................................................................................................................................................................................................................
A0A074SZ96_HAMHA/4-285                 .......................................................................................ii--LVFFLLYF.LIT.LL.A.N.LK......LLF..YF..EH..S...S...D.SSLta.........................................................pevVCKVTILAG..L..Q..LAWLL.IL.ALPLDAYN..-----.........................................................................................................................................................................................................QHSP..............FVDEA.A...G...V...A..T..A.....GL....dM...R.................LY...W...GVVA.WFTA........LYLL..........................LA..VP.......FAT.F....Y....Y.E...........A...DF....D....P....R.-..-.-V............................tRRT...P...WKR...A...LS.QT.V..LA.V.CC.A....CIV.V...FVVYILcrsislkidddvcsqwqsqdvsqp............................................................lkdfceaaartaagpsasqgdakkeDNFTSLKMK..vDL.SV..YLL..AAMSFAGWFTF....AL.FGGIG.VAAL...PLDAFVnfrrrpr................................................aislstfkEIRRQLGE.KA.K....K.L.RFIG..E....ALRE..E-----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------eavq....................................................................................................................................................................................................................................................
A0A010RIZ0_9PEZI/10-293                ..................................................................................sliwvay------AAAV.VFC.LL.A.A.II......TTF..TW..QT..P...R...E.RSA..............................................................IVSIVAIVS..L..T..ALLAT.VL.LLPVDIAL..-ISST.........................................................................................................................................................................................................THASl...........gvKKDWA.T...E...A...R..V..H.....DIl..qtL...R.................IV...Y...YSLY.SFDA........LLCL..........................LI..IP.......FAY.F....W....H.E...........E...YD....E....I....E.V..E.EG.............................-RS...F...GSR...L...IS.AL.K..YT.L.VF.V....ILV.L...ILFLVGffvpaagdh..........................................................................................ngahwdldyfKRILVQNNG..qKA.LA..FAL..GLLVTLGILLY....VI.YTAAG.LALL...PMSFIKsapsisapql...........................................testataleqNRERQRQL.EM.R....N.A.----..-....----..-----Grpegm.........................................................................................................................sskdrRELE........AL.VREE...RTL..TRR.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------erlaaeas................................................................................................................................................................................................................................................
M0TXG3_MUSAM/257-490                   ...........................................................................atelgkkagglkka----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...---I...EA...........................................................LH...QE....ERsgsK...G...R.........KWRK...NVKAA....----.................................................................................................................................----.-....-.-...-.-........E...K....E....LLIL.EDd...........mKALE..EM.YPQGe..........kAETLWA..LTV.L.GY.L.G...KLV...L.....G......I.I.GL.IVSVA.WVAHIII..YL.LI-------...........................SPPISp.....fLNEVFIK..L..-.....-....D.N..VWG.LLGT.....................-.A.AFAF.FC.F..YL...L.LA.VIAGEMMLGL...kLVF.............ITIHPm.kWGGTLM..NSF.....LFN...VGLILLCSIsviqfcatafayysqaTAA....Q.EI...F..GHT---......................................................------......-.....-.-...-..-.-...-.....L..Q.S..LRGI..KYL.YKY.NV..FQYGFV.ILAIITLF........................................................................................................................................................................................................................................................
A0A0D3FAQ7_9ORYZ/1-498                 .....................................................................................mwvf-----YLISL.PLT.LG.M.V.TV......TLR..YF..AG..-...P...G.VPR..............................................................YVIATVGYA..W..F..CSLSF.II.LVPADIWT..TLTGR.........................................................................................................................................................................................................----..............-----.-...-...-...-..E..K.....GG.....I...G.................FF...W...SWSY.WSTF........ILTW..........................AV..VP.......TIQ.G....Y....E.D...........A...GD....F....T....V.K..E.RL.............................KTS...I...HMN...L...LF.YS.I..VG.A.IG.L....FGL.I...LLLVM-.............................................................................................................H--RAW--D..gGI.VG..FAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PRNIWK...............................................................--NADWTH.RQ.K....V.L.SHRV..A....KMAV..KLDNAH...................................................................................................................................QEYS........NA.IVVA...QAT..SNQ.MS..KRD...........................................L...LR...PYM.....DIIDK.......................................................................MLAQMLREDPSFkpsggr.......................................................................lgendmDYDT...DDK....................................................................................................................................TMATLR...RQLR...RA...........................................................HE...EY....YR...C...K...S.........EYMT...YVMEA....LELE.................................................................................................................................DTIK.N....Y.E...R.R........D...An.gwK....FVSS.FR............eSRPG..TL.----............--GSLL..DTM.E.FI.W.R...CVL...R.....K......Q.L.QK.GFAIV.LGCMSAA..IL.LAEATLLPS...........................GVDLS.......LFSILVK..S..V.....G....-.-..-KQ.EVLV.....................Q.V.AAFV.PL.M..YM...C.IC.TYYSLFQIGM....LMF.............YSLTP...-RQTSS..VSL.....LMI...CSMVARYAP................PIS....Y.NF...L..NLIRLGg...................................................daKTTFEK......R.....M.G...N..I.D..dA.....V..P.F..FG-R..GFN.RIY.PL..FMVVYT.LLVASNF-f.......................................................................................................................................................................................................................................................
A0A167HPM2_9HYPO/12-521                ........................................................................................g-SIIFSILAL.LVV.SL.V.V.LL......ILR..HY..LP..L...R...S.TPG..............................................................FYFVPIFFA..I..W..LPSVI.VL.LVPIDLAS..SAGTD.........................................................................................................................................................................................................----..............DDGTR.G...I...W...L..P..E.....RV.....I...L.................VS...W...RITY.WLTF........ALTW..........................FI..LP.......ILG.E....Y....S.D...........A...GY....R....E....P.H..D.RL.............................MYS...L...RSN...A...QF.YA.M..VL.G.SA.M....VGL.A...YVVIR-.............................................................................................................YDVTYD---...SL.KG..VVM..ALAYCWGLTFA....IY.LMGHG.LVSI...PKRLIR...............................................................--DANIAN.KL.R....R.L.QAKA..P....KAYE..KMEDSA...................................................................................................................................TSLE........EI.EAQV...AEL..AKR.KM..GSA...........................................A..dFR...DWI.....EELQEianvaetrph..................................................vtafdvntmdrTVPNVMTSK---...................................................................................----...---....................................................................................................................................YLADLT...RRLI...RA...........................................................KH...AS....SR...F...V...Q.........EWHD...LVNEA....GKTQ.................................................................................................................................EILD.S....A.A...S.K........K...L....D....FGDV.--.............SLHG..GL.WDKA............--KLLN..PYT.R.YL.W.H...YQI...A.....P......Y.M.QM.GLGIL.LTLASAC..VI.WSEVVKLP-...........................FPHLS.......VIRLSVI..H..H.....W....V.G..DRA.EVGFa...................gQ.V.ISAF.WI.C..YM...C.AA.ALVTMTEVKV....WRG.............RALVR...-RNTGY..EAA.....FWY...AMQVAKLTV................PLS....Y.NF...L..TFLSSEv...................................................ytKTAFYG......F.....L.G...R..L.V...D.....F..T.H..LG-R..WFD.DLF.PY..LLIIPV.IAATFGLY........................................................................................................................................................................................................................................................
Q22CC8_TETTS/4-272                     .......................................................................................fl--LIMTIIVG.VLL.IF.C.N.IY......ILG..VY..CH..P...E...D.KGFga..........................................................naYCKLIVVVG..F..T..LSWGQ.VL.MVPLDVSN..-----.........................................................................................................................................................................................................S---..............--RGY.G...G...G...F..D..-.....--.....M...M.................TV...W...YVIY.IIVL........VFIS..........................FI..IP.......TAQ.F....Y....Y.E...........S...DD....E....K....S.M..CeRL.............................TQT...I...AME...F...VM.IL.L..MG.V.FQ.C....IFY.L...FCSQASvpitvlyygssvanngmv.........................................................................nfdyvipqnyfvtvsqstQQANLK-FN..vSL.YI..SIM..AFLSFIGYFFL....VL.FGGMG.LSAL...PIDLLR...............................................................SYRSRPTF.KT.S....K.Q.---A..F....AKKN..QLKEMT...................................................................................................................................QKLI........DL.SEKI...QE-..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------dlleikyqkgfwa...........................................................................................................................................................................................................................................
A0A0G4J4M5_PLABS/3-467                 ...................................................................................twlqvw-----LACTV.AAS.AV.V.S.GA......LLY..QL..AH..-...P...D.VRL..............................................................PCKVTVFFA..W..A..LAFTV.IW.VTPLDLDA..-----.........................................................................................................................................................................................................D---..............-----.-...-...H...A..A..S.....AL.....L...F.................PV...W...NATY.WCVS........LLTW..........................LL..IP.......LQQ.A....Y....Y.D...........S...GH....F....T....V.R..D.KL.............................KDA...F...RAN...V...RF.YV.V..AL.V.LI.S....VVG.V...TAAAT-.............................................................................................................SGLRPD---...EL.VG..LGM..ALANVWGMLLM....VL.LLGT-.----...----FG...............................................................-DRRRIG-.--.R....A.L.YFNA..V....AVHD..EYQDSL...................................................................................................................................EKLS........DS.MTMV...VET..SLR.VK..QMD...........................................Dp.lLA...HYM.....EIIEG.......................................................................ECPAPGTLELTQeyapss.......................................................................laaelrGSDL...NEP....................................................................................................................................ILARLH...SRVK...AD...........................................................HH...ES....RR...A...Q...Y.........QWHL...LLDKV....----.................................................................................................................................----.-....-.-...-.-........-...D....E....FERE.ED............eSARR..NV.----............----FH..QTL.Y.RT.V.N...LHV...-.....-......-.A.AR.VLSVV.CAIMTLA..VI.WSEVTLSI-...........................GVRLS.......IFYNIVN..S..-.....-....V.S..DPA.LVYL.....................-.-.TGAV.VS.S..YL...A.VC.AFYSMFRLRL....SSF.............YHLHF...GRHSEA..NSL.....LFN...ASYILRLVF................PIG....V.NV...F..SMTKDDr...................................................gqTTAFES......V.....L.G...V..M.N...V.....V..P.L..LG-E..KFN.LFV.PI..VISVFC.FITLANFY........................................................................................................................................................................................................................................................
F4PI14_DICFS/4-511                     ......................................................................................gni---AVLVIEL.ALI.GV.V.V.VF......GMK..QY..IS..F...R...K.TPF..............................................................YASSTAWLG..W..F..LCFSI.VF.LVPVDILA..TDHNQcle...................................................................................................................................................................................................khvN-QTg............dFCHEP.I...T...Y...V..P..E.....SL.....M...L.................AQ...W...KVLY.WGTF........IFSW..........................AI..FP.......VLQ.T....F....S.V...........T...GD....F....R....F.Q..E.RL.............................WRA...I...KDN...I...IL.YI.F..MG.I.AG.L....IFV.I...VLFAL-.............................................................................................................KNMTLD---...GL.IS..LVM..SLANAYGLVLV....VI.TMGFG.LVDL...PRNLLR...............................................................--QSDKYK.TL.R....H.Y.RVDA..V....VLRN..DLEQSQ...................................................................................................................................SALN........DH.LRLI...KAT..SDA.AG..EYD...........................................P...YR...PYL.....DIIIS.......................................................................KCPLEFAMNDNTpss.............................................................................vsvDSEL...SYD....................................................................................................................................KLVSMH...STLM...DL...........................................................VH...QN....QR...A...T...V.........MYDR...LLGKG....FATE.................................................................................................................................DIID.TievpA.K...T.R........E...K....K....IKWS.FK.............HYSK..NP.NKV-............------..-LF.E.YY.W.I...VYI...H.....P......A.L.YK.FLGVV.CSIMSLL..IV.WSELSLAFKg.........................eTKNYS.......PFALVI-..N..N.....S....G.D..SLN.GIGL.....................Q.I.FCFI.PL.L..YM...T.IC.AYTTLFKFRI....FNY.............YRLVP...QQQTNA..MSI.....MFS...A----KLAA................PLS....F.NF...I..QICALS......................................................DASFNA......V.....M.G...E..M.D...A.....F..S.-..LG-K..NFI.FFF.PI..FVAVVC.LVSLFNV-h.......................................................................................................................................................................................................................................................
A0A0V0QH19_PSEPJ/184-403               .....................................................................................rdcf----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.TILL........ILTF..........................IV..LP.......YTY.F....Y....S.E...........E...RS....S....D....Y.D..I.DLdyt......................esdaN--...-...--E...K...II.SA.I..KN.T.VY.F....VLI.F...LVMLVIglslrpkqktd.......................................................................................lkrgqevewvkQLFDVDNVG..eQA.IH..FCL..AIIASFGTIFW....II.YGSYG.LGIL...PWMLIKgkk.........................................................sleQE------.--.-....-.-.---K..T....ELQN..DLTEIK...................................................................................................................................LKFK........FI.QQKY...SKS..HTK.IS..KSD...........................................-...--...---.....-----.......................................................................------------...................................................................................--QK...ILA....................................................................................................................................QLRKKE...RIIT...AK...........................................................NS...RI....VE...I...Q...D.........NTSE...LVQ--....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------klvkiftpfrqmigi.........................................................................................................................................................................................................................................
A0A016WPM1_9BILA/1-240                 ........................................................................................m-GAVPLVVEL.IAV.FV.L.T.AL......LLN..KY..AD..W...R...R.HHL..............................................................FVTVSTFVG..W..Y..FSFVI.IF.VLPLDVAI..TFYHKceve................................................................................................................................................................................................qarslNNTLge..........ltHCEKP.G...G...Y...I..P..D.....AV.....L...L.................CL...W...RIVY.WTAQ........VLTW..........................LV..LP.......FMQ.S....Y....V.N...........A...GD....F....T....A.Y..G.KM.............................KAA...L...FNN...A...VY.YG.L..YL.L.VF.A....LLL.V...YAIIK-.............................................................................................................-GVVIN-ME...HL.KV..ILV..SASNTWGLFLL....VV.LLGYG.FVEL...PRSLWH...............................................................--MGSRDY.RL.N....K.T.YFNI..D....KMSS..DKCEAE...................................................................................................................................EGIK........ET.YR--...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------filha...................................................................................................................................................................................................................................................
K2MYD4_TRYCR/296-457                   ..................................................................................spfiiyg----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...RLL...L.....G......I.I.SL.GISIA.WILHIFI..YN.T-----FNK...........................SP-F-.......LNNLLI-..-..S.....L....D.H..IFG.LFGV.....................-.I.AYGV.LV.F..YL...M.WV.SFEGQVRLGM...rLVF.............FQIYPl.kPHDTTL..NAL.....LFN...VALSLLISP................-AI....V.EF...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------asrsfqeygprtainalmniyvlhlkgigvfirwaglcfvgisllsii........................................................................................................................................................................................................
LMBRL_DANRE/259-451                    .....................................................................isahlealnkeflsvqskri----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..TL.ELRK............RASPWQ..RNL.V.YP.V.A...MLL...L.....-......-.-.-L.ALTAV.SVLMVCF..HV.L----ELLFde.......................saMPRG-.......MEDPHLG..L..A.....S....F.S..MLG.SLGA.....................-.A.VQVV.II.L..YL...M.VS.SVVGFYSS--....PLF.............TGLLP..rAQDTTL..TQI.....IGN...CVSLLILSSa..............lPVF....S.RT...L..GITKFD......................................................------......L.....L.G...D..F.G...R.....H..D.W..LGSF..HIV.FLY.NM..LFAGLT.SACLINT-v.......................................................................................................................................................................................................................................................
A0A077ZC10_TRITR/1-532                 ......................................................................................mgv---TSLVLEL.LIV.FV.I.V.LM......VLH..QY..GD..W...K...R.QHV..............................................................VVSLSTIVA..W..Y..FAFVI.VF.LLPLDVVL..TFHRLcvihy..............................................................................................................................................................................................nstlnkTHQA.............nPCHPP.S...S...Y...M..F..G.....NA.....L...P.................VL...W...RVVY.WTSQ........LLTW..........................IV..LP.......LMQ.S....Y....S.N...........A...GE....F....T....P.V..G.KL.............................KRA...L...INN...A...AY.YG.T..YL.I.VF.T....FLL.I...YATIS-.............................................................................................................-GHIPS-GE...NL.KT..ICI..AASNTWGMFWL....VL.LLGYG.LVEV...PRNVWL...............................................................--SSLDGF.SL.R....K.A.YFRL..G....KLSI..EKNDAE...................................................................................................................................EAVK........EA.YRDT...TAA..HAA.LR..NCP...........................................E...RG...PLV.....KVILQ.......................................................................KFPETIVTKLMKssdfe.........................................................................vsgadYAGA...DIK....................................................................................................................................SLANLH...KRSI...RS...........................................................LQ...DY....NR...S...V...A.........QWDA...LMASA....LRRE.................................................................................................................................DIFE.S....E.K...N.P........Q...R....E....LVMS.SV.............V---..-V.DRSF............SALLCS..PRI.R.WY.W.E...CKL...R.....R......Y.V.LR.AIAIF.MCIMTGF..IV.WSESTFFSL...........................HPPLS.......LAALFV-..H..L.....A....A.V..NQD.YVFI.....................E.V.FSII.TI.M..YL...C.LC.AYYTVFRLKV....YRY.............YHLDS...HHHTDE..NSL.....LFS...AILFCRLTP................PMC....L.NF...L..GLIHMDahvtk...........................................dlmletETAYTA......I.....M.G...H..L.D...V.....I..E.A..IA-G..SFN.IYF.PM..AIILLC.MCTYFRL-g.......................................................................................................................................................................................................................................................
A0A0D8Y797_DICVI/1-502                 .........................................................................................MSAGPLVIEL.VTV.FI.L.T.SV......LLN..KY..AD..W...R...R.HHV..............................................................IVALSTFIG..W..C..FSFVI.IF.VLPLDVAI..TFYNRcemq.................................................................................................................................................................................................nallNSTLsk..........ytYCEKP.G...G...Y...I..P..S.....DV.....L...L.................CL...W...RVVY.WTTQ........ILTW..........................IV..LP.......FMQ.S....F....V.N...........A...GD....F....T....T.Y..G.KM.............................RAA...L...FNN...A...IY.YG.I..YM.L.VF.A....VLL.V...YAIVKG.............................................................................................................--VVIN-VE...HL.KV..ILV..SASNTWGLFLL....VV.LLGYG.FVEL...PRTLWN...............................................................--MGSKNY.PL.R....K.T.YFNI..D....KLST..DKNEAE...................................................................................................................................EALK........DA.YREA...RSV..LNI.LK..NEH...........................................R...AR...EKA.....QIIIS.......................................................................RFPEEVVDE---...................................................................................----...-LF....................................................................................................................................PVRSAV...-EFS...SL...........................................................SA...AD....VR...S...V...N.........SDKS...LVRDA....LYLE.................................................................................................................................DIEQ.A....E.L...T.G........H...L....E....----.--.............----..--.---S............PCSLFP..GKI.R.YF.L.V...VVA...R.....R......P.F.YK.FVSAT.LMAMTIV..IL.ISECTFFIV...........................NPTLT.......PAGIII-..H..F.....V....A.E..RFH.YNYT.....................Q.I.IAMT.II.C..YL...C.SC.VYFTVFRLRI....YQY.............YHLDP...NRHTDA..NSL.....IFS...AMLLCRLTP................PLC....L.NF...L..GVIHLDshitr...........................................akflgvETQFTK......I.....M.G...H..L.D...V.....I..P.I..LA-K..GIN.IYL.PI..CILIFC.ATTYFRI-g.......................................................................................................................................................................................................................................................
A9RIF8_PHYPA/1-496                     .......................................................................mwlfyalagpialgmvtg----------.---.--.-.-.--......VLQ..YF..AA..-...R...T.VTL..............................................................YVRLIVGYT..W..F..CTISI.IV.LVPADIWI..TISSS.........................................................................................................................................................................................................H---..............-----.-...-...-...S..S..K.....AS.....I...A.................VL...W...SWSY.WSTF........FLTW..........................AI..VP.......TLQ.G....Y....E.D...........A...GD....F....T....V.T..K.RF.............................KTS...I...HQN...V...VL.YA.S..VG.G.VG.A....LGV.L...IMIFM-.............................................................................................................NKLHWN---...GL.LA..LAI..ASSNTFGLVTG....AF.LLGYG.LVEI...PRGMWR...............................................................--NAELEF.RQ.K....Y.L.THKI..S....RCAV..KLDDAH...................................................................................................................................QELS........TA.IVIA...QAT..SNQ.MS..RRD...........................................R...MR...PYM.....DVIDD.......................................................................MLAEMVRED--Pvfkpsgg.....................................................................rmgesdmDYDQ...DEK....................................................................................................................................SMAALR...RRLR...KA...........................................................QS...AY....NR...Y...K...S.........DYTS...YVWEA....LEME.................................................................................................................................ETLK.N....I.Q...R.A........D...G....R....FVST.IR............pPRTG..PF.ANV-............-----L..DIA.E.YV.W.R...CQL...R.....K......N.V.VM.VLAAL.LGAMSVA..IV.MAEATLVF-...........................EADLS.......LLSLIIR..G..-.....V....G.D..SEI.LV--.....................Q.V.VAFV.PL.A..YM...C.VC.TYFSLIRLGM....MTI.............YYLAP...-KQTSS..VSL.....LMI...CSMIARYAA................PLC....Y.NF...L..SLIKLRs...................................................dqKTVFEE......K.....M.G...S..M.T...V.....I..P.Y..IGDE..RFN.TFY.PI..FMVIYT.GLLA----snvl....................................................................................................................................................................................................................................................
B6K3S4_SCHJY/2-447                     .................................................................................lyqllavg----------.-AP.AL.F.V.FF......WLL..RL..TR..I...R...D.LAP..............................................................VVGTVVFVG..F..Y..VPFFM.FF.VLPIDVVW..-----.........................................................................................................................................................................................................T---..............-----.-...-...-...-..-..-.....-V.....P...S.................LV...W...RITY.WTSF........VLTW..........................FF..VP.......FIQ.E....Y....V.A...........S...PF....K....T....P.R..M.KI.............................RDS...I...HSN...L...KY.SA.L..LS.V.IT.L....VML.V...YLRFVL.............................................................................................................RSMTFK---...GF.TN..LII..SLTYFYGLIFA....IF.LLGHG.LVTV...PRDCWR...............................................................--RAFLSK.RM.A....Q.L.ECYA..V....KVYD..KIQDRM...................................................................................................................................DELS........DL.SNAT...PGT..GFD.RS..TFH...........................................-...--...---.....-----.......................................................................------------...................................................................................QSDF...SHT....................................................................................................................................HLSDSEavtAEVA...DA...........................................................SL...RL....HP...L...K...I.........QWNE...TVREY....AKLK.................................................................................................................................ALQT.C....R.E...K.H........S...Y....W....LRLP.--.............--PG..--.----............-SFRTH..PLL.D.YV.L.Y...SYV...Y.....P......L.L.RL.ILAVI.FGALSVL..VV.VSE--LFL-...........................GSKYS.......VTGIVL-..E..K.....A....A.T..ISP.MFHL.....................-.L.ATAV.VF.W..YM...C.MC.TCSSLLRSRS...sFNY............lTALLP...KQATHP..LAL.....LAF...LVQSCRLVI................PLS....Y.NF...V..SLQ-FS......................................................QTRFHL......L.....F.G...N..S.I...D.....L..L.P..LG-Y..YIS.KRY.PM..IVLLPV.FSSIFSL-h.......................................................................................................................................................................................................................................................
U6N0W7_9EIME/38-362                    ...............................................................................vgigasaaag----------.-AA.LV.L.P.LL......LYY..HF..VD..R...K...K.STL..............................................................VTGLTFCCT..L..T..SALLL.AL.LVPIDIMQ..ASTANsdsmqvpeepravqapsvaeaaaa........................................................................................................................................................ahaanassaftpagaaaaaaaaagwA---..............ALRSA.T...L...P...L..T..A.....DL.....L...Q.................RI...Y...LFLG.VAVF........VCCF..........................LL..TP.......AAV.F....Y....A.N...........E...RN....R....R....C.A..Q.DVd...........................eDDS...L...PCE...A...LF.VA.L..RK.T.GF.F....VLA.L...CAVLLLllalrpgmpspa.....................................................................................flrpektalppvAPEQQQ-LR..pPN.PE..GTS..PAAQ----VVW....IV.FGAFG.LATL...PFAWLY...............................................................-RGLSTQQ.KQ.R....Q.V.QHEI..A....TLRE..QQRQLQ...................................................................................................................................RKYA........GG.LHEM...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rpedsealeklrvqqrlcsernyklqyppt..........................................................................................................................................................................................................................
A0A075B2X4_9FUNG/1-468                 ........................................................................................m-GYAIFGLAS.TFV.LS.L.T.IF......LVY..QY..GS..W...K...R.TRW..............................................................FVAIIVFMA..W..F..FSLCI.IF.LLPIDLSS..ARYLNclqrkqe...........................................................................................................................................................................................wssgnftT--Pf...........qdNCTEP.S...T...F...I..D..P.....NV.....L...K.................II...W...TISY.WNTF........FSTW..........................LI..IP.......ILM.G....Y....V.D...........N...GE....F....T....M.R..S.KL.............................WSS...I...KYN...A...IY.YS.S..LG.V.VG.L....GFL.I...YLIAV-.............................................................................................................VKLNTY--Q...TL.IS..FVM..ALSNAWGMLLL....VM.FLGYG.LVEV...PRSFWN...............................................................--KANKKA.WL.L....R.M.QFEA..P....KVKE..ELDDSI...................................................................................................................................GDYE........DA.LAEI...REM..KKR.KD..IPE...........................................P...LK...AYA.....QRLIR.......................................................................KVCPLIFNNSGQcftge.........................................................................lfddiPNHI...DKP....................................................................................................................................YLISLN...HRVR...RG...........................................................LR...FV....AR...N...Q...WyyinvilisLWDI...TLEKV....LFLE.................................................................................................................................DVLN.C....N.N...S.P........E...R....I....IKSG.IH............kPPAN..KI.LAHL............GNVSFY..FEK.E.WI.W.Y...CKL...E.....S......H.F.MR.LLSIV.FALMSLS..II.WSEVTLFYE...........................PIDLS.......IFSFLIH..S..N.....H....I.-..TMS.GIEV.....................R.L.CPSF.PL.F..IW...H.FA.VIIVY-----....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------lrleylayidwfrgitlt......................................................................................................................................................................................................................................
E9F792_METRA/10-286                    ..................................................................................sliwtty------AIVV.VLC.FL.A.A.II......TTF..TW..QT..P...R...D.RSA..............................................................VVSIVAIVT..L..T..SLLAT.VL.LLPVDIAL..V-SAT.........................................................................................................................................................................................................NSVSq...........gaK--KD.WatpE...R...V..N..S.....ILl...tL...K.................IV...Y...YCLY.SADA........LLCL..........................VV..IP.......FAY.F...wY....E.E...........Y...DE....I....E....F.E..E.QG.............................RTW...-...HSR...F...WA.AC.K..YT.L.FF.V....ALV.V...VLFLLGffmpspgds..........................................................................................skahwdldyfKDLIARNHA..eKA.LT..FAL..GLLITLGTLLY....VV.YTGSG.LALM...PIAFIK...............................................................--SAPSMS.AP.Q....L.S.ATTA..S....QLE-..QNRERQ...................................................................................................................................RQLE........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------mrnsgrqdgmsrkdrreldalireeqtlvrr.........................................................................................................................................................................................................................
A0A0V0UQW5_9BILA/9-559                 .........................................................................................MNVALLAVQL.LFV.FI.I.V.VL......ILH..QY..GD..W...Q...R.QHF..............................................................LVSFSTVVA..W..F..LAFVI.VF.MLPLDVVL..TFHRLcdnreii...........................................................................................................................................................................................vnndtnrS--Fvp.........adgNCQSS.D...I...D...L..P..D.....NV.....L...P.................IL...W...RFVY.WTSQ........LLTW..........................II..LP.......IMQ.S....Y....S.N...........A...GE....F....T....A.L..G.KL.............................KRA...L...INN...A...LY.YG.T..YL.I.VF.A....FLL.L...YAVSKG.............................................................................................................HYLNA---G...NL.KT..ICI..AASNTWGLFWL....VL.LLGYG.LVEV...PRNTWL...............................................................--NSKPGY.TL.M....K.L.YFKL..G....KLMV..ERNDAE...................................................................................................................................ETVK........EL.CQQA...YLL..SLQ.NE..NCS...........................................V...RY...PML.....KVILE.......................................................................KFPTSMVRAVEKkapq..........................................................................tiaqsDKQS...SEK....................................................................................................................................MLILFH...KQVI...KS...........................................................LQ...DY....NR...T...N...A.........QYDA...AMANA....IYLE.................................................................................................................................DVEK.N....Q.Q...S.P........D...T....Q....SLIV.QNqnpli...gvichPTIS..TF.FAFF...........lFRCSVV..RFL.G.WY.F.D...CHL...K.....R......Y.L.LI.VLSVF.CCIMSVF..IV.WSEMTFSNV...........................NPPLS.......LAALFV-..H..M.....A....A.G..DKN.YMFI.....................E.M.FSIT.TI.S..YM...C.IC.AYYTVFRLKV....YRY.............YHLDS...HHHTDE..NSL.....LFS...AILLCRLTP................PLC....L.NF...L..GIIHMDmhvtk...........................................dlnlqtETAYTK......L.....M.G...H..L.D...V.....I..E.P..IS-S..WFN.IYF.PM..AIILLC.IFTFFRL-g.......................................................................................................................................................................................................................................................
H3FSB7_PRIPA/1-225                     ........................................................................................m----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...-H....NR...A...N...S.........QWKT...LMDEA....MFDE.................................................................................................................................DIQQ.A....T.L...T.G........Q...L....I....TTYI.--.............---S..S-.----............WDAVIP..SSV.R.YS.W.H...VIL...S.....R......P.I.AK.IFGVL.FASMTVF..IL.ISECTFFIV...........................DPTIS.......PAAILL-..Q..A.....S....A.H..KFH.YTST.....................Q.L.VSFA.LL.T..YI...C.CC.AYSTLFRLRI....YKY.............YYLDS...HGLTDD..NSL.....LFS...AALLCRLTP................PIC....L.NL...L..GLIHLDshish...........................................eknhgvETQFTK......L.....M.G...H..L.D...L.....L..P.I..LA-K..GIN.IYL.PF..LILLFC.ALTYYKL-g.......................................................................................................................................................................................................................................................
F4P8T4_BATDJ/307-542                   ................................................................................qllmevgkt----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................VN...QE....VK...E...A...A.........RGNS...FNKRY....---R.................................................................................................................................VIKN.R....E.R...Q.F........R...K....D....VIIL.DYh...........yKKLE..EC.YRFQ............SG----..-NI.L.LQ.Y.I...KLF...L.....A......C.L.ST.LLTLL.WTIHIGL..YV.IP---SLLQqrg.....................qavNPVSP......fLNDMLN-..-..-.....L....T.Q..GVP.VVGI.....................-.F.LYAL.FT.F..YL...L.FC.VLKGNAKLGM...rLVF.............ITVHPl.vVGETLM..SGL.....VFN...AGIILLCSL................PLA....Q.-F...C..NVA-FAgy..................................................aqYTSNQS......I.....F.G...V.sI.S...T.....L..K.G..IS-V..GFD.VCV.YV..MLGFMV.ITFF----ynmy....................................................................................................................................................................................................................................................
C4JIE2_UNCRE/8-299                     ......................................................................................liw---IVYAIVI.GIL.IV.V.A.ST......FVY..VY..QT..P...R...D.RSA..............................................................AVTTVCIFT..L..I..ALLAT.VL.LLPVDVAL..VSSTTssk...................................................................................................................................................................................................tgqR--Ke............wASQRE.V...D...K...I..T..S.....S-.....L...T.................VV...Y...YFLY.TLDA........VLCL..........................LI..VP.......FTY.F....W....Y.E...........E...YD....E....I....A.H..E.EG............................wQTT...-...GKQ...F...WG.AF.K..YT.L.VF.I....LLT.I...ILFLVGffvpvakdr..........................................................................................kgahfdldyfKKLLTENHG..eRA.LT..FAL..GLLIVVGIITY....VI.YSSTG.LAFF...PVSFIKssps.......................................................isspA-------.--.-....-.L.SA--..-....SLDS..RLDENNerqrqlegrcg.............................................................................................................gnpehlspkdrRELD........SL.VREE...RTL..RRR.K-..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rlaeasrgqgksrii.........................................................................................................................................................................................................................................
C5G8K1_AJEDR/14-520                    ........................................................................................g-SGIFMIIAL.LVI.SI.L.V.LL......LLR..HY..LP..L...R...S.TPA..............................................................FLSLPVFLA..L..A..LPASV.VL.LVPIDLTS..STKGD.........................................................................................................................................................................................................----..............-EPSS.G...I...W...L..P..P.....RV.....M...L.................VS...W...RIAY.WLTF........VMTW..........................VI..LP.......LLG.E....Y....V.D...........S...GY....R....T....P.K..D.RI.............................LYS...L...RSN...G...RY.QL.I..VL.G.SG.I....AGL.V...YISIQ-.............................................................................................................NGFDFT---...SI.KA..LVM..ALAYFWGLALA....IY.LMGHG.LVVI...PRTLIR...............................................................--NANPGN.KL.R....R.L.QARA..P....RIYD..RLTDSM...................................................................................................................................ADLE........DL.EFQV...SQL..RKR.KT..GVP...........................................H..dLQ...EWI.....DELVDmtsipesrlr...................................................asasandsrlSVPSIITTR---...................................................................................----...---....................................................................................................................................YLADIT...RRLG...RA...........................................................RH...QN....AR...F...T...N.........AWER...LVREA....ADTQ.................................................................................................................................SIID.S....S.A...S.K........R...L....E....FSLP.--.............SFRS..SP.NKSV............--TYMT..PTV.R.YY.I.H...VHI...L.....P......A.A.RL.ILAGF.FSLASAC..VV.WSEIVKSF-...........................APRVS.......IVTLSV-..V..H.....N....P.T..KSE.PIGFl...................gQ.V.ASAA.WI.F..YM...C.SA.AFVGITDARV....WGN.............RALVP...-RNTYS..ESA.....CWY...AGQIAKLTV................PLS....Y.NF...L..TFLPQDi...................................................qkKTTFYH......F.....L.G...R..L.I...N.....L..T.P..LG-K..GFD.YAF.PI..FILIPV.CATLFNLY........................................................................................................................................................................................................................................................
A0A183HC75_9BILA/1-200                 .........................................................................................----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................----MCTWS..L..A..VSMGA.AT.LLPFSVIG..-----.........................................................................................................................................................................................................SEIIq...........ayPDNYY.F...Q...W...L..N..W.....PL.....I...H.................SL...W...NYIF.ALSN........LSLF..........................IL..LP.......FAY.F....F....I.E...........S...QG....F....K....G.H..G.KGi...........................mTRV...-...YET...V...VV.CV.L..LI.I.VL.T....CLA.D...VIYSLFlte.......................................................................................................sasISLSILNLT..sVS.LP..FLY..SCVSLLGVLTL....LI.TTPIG.LARM...-FSVVSnhll......................................................atehsK-------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------iidpleemvfrleyqtlkrrlrrnnqgdvs..........................................................................................................................................................................................................................
A0A087UE13_9ARAC/1-34                  .........................................................................................----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....M.G...H..M.D...V.....I..P.I..IS-D..GFN.IYF.PI..LIFFVC.LATYFNIC........................................................................................................................................................................................................................................................
S9UHX5_9TRYP/63-309                    ......................................................................................wlv---LISVIVA.LVI.LL.L.A.LY......VVC..YF..AA..D...E...D.RGEa............................................................wSIRVVAVLI..I..S..FACYN.IL.LLPLDVGN..-----.........................................................................................................................................................................................................A---..............---SE.A...T...G...L..N..-.....--.....M...L.................WV...W...SAVL.LTSV........LLFT..........................VA..AP.......FAM.M....Y....Y.E...........A...WD....P....A....E.D..G.HGh..........................qvKAA...L...LPA...A...IV.SA.I..FW.I.AL.A....GVH.F...FCSTPItddln..................................................................................................natglhNETENEVLS..sAL.FT..SLV..GFSSMLGWPFF....AV.FGGIG.LVFL...PCAGVQhfl.........................................................grpKPVSPIDY.EA.A....H.A.SLHT..-....-TSA..RLMEEG...................................................................................................................................RALD........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------aesagglrlsrstwrkv.......................................................................................................................................................................................................................................
A0A183D9X4_9BILA/1-92                  .........................................................................................----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...M.IA.SVIGVYSV--....PLL.............RRIRP..qLHKTSM..TCV.....IAN...CTTVLVLSSa..............lPVL....A.RT...L..GITTFD......................................................------......L.....V.G...A..Y.S...S.....F..I.W..LSNF..TLV.WTY.NV..AFAIAT.VFCLFNYF........................................................................................................................................................................................................................................................
A0A0E0L791_ORYPU/150-420               ...............................................................kvdftvrhlssavetfpnsftsfssg----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....QPCIS.......................................................................TSPRQEATELGKk................................................................................arELKK...AAE....................................................................................................................................ALHQEE...----...--...........................................................--...RS....GK...K...G...R.........KWRK...NVKAL....----.................................................................................................................................----.-....-.-...-.-........G...K....E....LVLL.EDd...........mKALE..EM.YPQGe..........qAEATWA..LTV.L.GY.I.G...KLL...F.....G......A.V.GL.IISIA.WVAHIVI..YL.LI-------...........................DPPLSs.....fLNEIFIK..L..-.....-....D.G..VWG.LLGT.....................-.A.AFAF.FC.F..YL...L.IA.VIAGEMMLGL...kLVF.............ITIHPm.kWGGTLM..NSF.....LFN...VGLILLCSIsviqfcatafayyaqaTAA....Q.EI...F..GHT---......................................................------......-.....-.-...-..-.-...-.....L..Q.S..LRGI..KYL.YKY.NV..FQYGFV.ALAILTLF........................................................................................................................................................................................................................................................
F0V8P3_NEOCL/279-512                   ......................................................................................fig----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...--E....................................................................................................................................ALCAEE...TVQQ...TL...........................................................SW...KE....IR...R...K...R.........QFRT...DVNRY....----.................................................................................................................................----.-....-.-...-.-........K...K....A....VFDL.DQe...........hRQLA..IC.MRER............GE----..NPF.F.SY.L.-...KLF...L.....G......I.V.AF.AMSVI.WTAHTIL..NC.VLP--QILDvs......................stsNPVFG.......FLDAFLR..L..L.....A....D.H..SAA.LLAL.....................-.L.IYAA.FV.C..YL...L.VC.VVKGCFKFGAs..vFCF.............IGIHPm.rKDETHL..NSF.....LFN...VVLVLLSCAavvqftarcfrdyshsTVA....A.WI...F..DVQ---......................................................------......-.....-.-...-..-.-...-.....L..L.L..LPFF..GFV.FKY.NI..FIYIFL.GVELISA-f.......................................................................................................................................................................................................................................................
A0A0B0P4C6_GOSAR/244-490               ........................................................................pkavitrsqyikeatel----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...--G....................................................................................................................................KRAKEV...KKAA...DA...........................................................LH...QE....ER...S...GskcR.........KWRK...NVKAV....----.................................................................................................................................----.-....-.-...-.-........E...K....E....LLQL.EEd...........vKLLE..EM.YPQGe..........kAETSWA..LTV.L.GY.L.A...KLV...L.....G......I.L.GL.IVSVA.WIIHIVI..YL.LI-------...........................DPPLSp.....fLNEIFIK..L..-.....-....D.D..IWG.LLGT.....................-.V.AFAF.FC.F..YL...L.LA.VIAGAMMLGL...rLVF.............ITIHPm.kWGATLM..NSF.....LFN...VGLILLCSIsviqfcatafgyyaqaT--....-.--...-..------......................................................--AAQE......I.....F.G...H..T.-...-.....L..Q.S..LRGI..KYL.YKY.NV..FQIAFI.VLAALTF-v.......................................................................................................................................................................................................................................................
A0A016WPU0_9BILA/1-242                 ........................................................................................m-GAVPLVVEL.IAV.FV.L.T.AL......LLN..KY..AD..W...R...R.HHL..............................................................FVTVSTFVG..W..Y..FSFVI.IF.VLPLDVAI..TFYHKceve................................................................................................................................................................................................qarslNNTLge..........ltHCEKP.G...G...Y...I..P..D.....AV.....L...L.................CL...W...RIVY.WTAQ........VLTW..........................LV..LP.......FMQ.S....Y....V.N...........A...GD....F....T....A.Y..G.KM.............................KAA...L...FNN...A...VY.YG.L..YL.L.VF.A....LLL.V...YAIIK-.............................................................................................................-GVVIN-ME...HL.KV..ILV..SASNTWGLFLL....VV.LLGYG.FVEL...PRSLWH...............................................................--MGSRDY.RL.N....K.T.YFNI..D....KMSS..DKCEAE...................................................................................................................................EGIK........ET.YSS-...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------liplqv..................................................................................................................................................................................................................................................
LMBD1_MAGO7/9-443                      ......................................................................................liw---IAYAVAV.GLA.LF.A.A.IV......TTF..TW..QK..P...R...E.RSA..............................................................VVNTVAVVS..L..T..SLLAT.VL.LLPVDIAL..VSSTGsvh..................................................................................................................................................................................................lgvnKE-W.............aTPEHV.A...G...M...L..R..-.....-T.....L...Q.................IV...Y...YSLY.SLDA........LLCL..........................IV..IP.......FAY.F....W....Y.E...........E...YD....E....V....E.E..E.EG.............................TRS...-...-TG...A...KL.WG.A..FK.Y.TS.G....FII.L...VLILFFvgffvpaagnq.......................................................................................kgghldldyfkRLLAANKGE...KA.LT..FAV..GLLVCLGTLLY....VL.YTSSG.LALL...PISFIK...............................................................SAPSISAP.QL.S....E.T.--TA..S....ALE-..RNRERQ...................................................................................................................................RQLE........--.----...---..-LR.NG..GNH...........................................-...--...---.....-----.......................................................................------------...................................................................................----...--D....................................................................................................................................EMPSKD...RREL...ES...........................................................LV...RE....ER...T...L...V.........RRAR...LAAEA....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-Q............gEGRS..WV.YRT-............--WTKI..CAV.F.RP.L.K...-LV...G.....G......I.L.LL.LVSVI.VWVSMLI..TT.IDKASNSLCkghc..................gyilgQIKIFq.....pVNWLFL-..-..Q.....A....A.K..AFP.-VDY.....................-.I.IMAF.LV.L..FF...F.SS.SISGLATVGI...rFLW.............VQIFQi.rRGRTAP..QAI.....LIA...TVMMAL---................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------iilginysiammaa..........................................................................................................................................................................................................................................
C0NNS1_AJECG/8-293                     ......................................................................................liw---VVYAIVF.FLL.VA.V.A.SI......FIY..IY..QT..P...S...E.RST..............................................................YVTTVCIFT..L..T..ALLAT.VL.LLPVDVAL..VSSTTssre................................................................................................................................................................................................grrksW---..............ATQDE.V...D...K...I..T..-.....-F....sL...T.................VA...Y...YFLY.SLDA........VLCL..........................LV..VP.......FTY.F....W....Y.E...........E...YD....E....V....A.S..E.DG.............................SQT...F...RKR...F...WG.AF.K..YT.V.AF.I....LLT.V...ILFLVGffvpvgrrk..........................................................................................depnldldyfRRLLTENHG..eRA.LT..FAL..GLLITIGILVY....VL.YTSTG.LALL...PVTFIKsapais...................................................spslsaNTASRLEE.NI.E....R.Q.RQL-..-....----..-----Egrcggnp....................................................................................................................drlpskqrRELD........SL.VRQA...RTL..RRR.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------qrlaeearrp..............................................................................................................................................................................................................................................
A0A0L9VTD1_PHAAN/277-488               ...............................................................................kggskgrkfr----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................---K.N....V.K...S.V........E...K....E....LLQL.EEd...........vKLLE..EM.YPQGe..........kAEATWA..LTV.L.GY.L.A...KLV...L.....G......I.L.GL.IVSVA.WVGHIII..YL.LV-------...........................DPPLSp.....fLNEVFIK..L..-.....-....D.D..IWG.LLGT.....................-.A.AFAF.FC.F..YL...L.LA.VIAGAMVLGL...rLVF.............ITIHPm.kWGATLM..NSF.....LFN...VGLILLSSIsviqfcstafayyaqaTAA....Q.EI...F..GHT---......................................................------......-.....-.-...-..-.-...-.....L..E.S..LRGI..KYL.YKY.NV..FQIAFV.ALAGLT--fv......................................................................................................................................................................................................................................................
G3VSI5_SARHA/268-457                   ...........................................................................dmkllhrqvvtlqt----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............-QRL..ML.EKRQ............KASAWQ..RNL.G.YP.L.A...MLC...L.....-......-.-.-L.LLTGL.SVLIVAI..HI.L----ELLIde.......................aaMPRG-.......MQDTSLG..Q..V.....S....F.S..KLG.SFGA.....................-.I.IQVI.LI.L..YL...M.LS.SVVGFYSS--....PLF.............RGLRP..kQQDTAM..TQI.....IGN...CVCLLVLSSa..............lPIF....S.RT...L..GLTRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.FLY.NA..AFAGLT.TLCLVK--tv......................................................................................................................................................................................................................................................
D8TFX8_SELML/1-251                     .......................................................................................nq----------.---.--.-.-.--......---..--..--..-...-...-.-AY..............................................................LPKIIVVIG..L..S..IAQLS.IL.MLPADVAN..-----.........................................................................................................................................................................................................RHSC..............EKNLY.V...G...A...C..K..L.....TL....pM...K.................QL...W...WAVY.IIDT........VLV-..........................-I..L-.......FAI.F....F....Y.E...........S...DQ....E....K....T.-..-.-V............................tQRV...-...-KN...A...LL.WV.V..IL.L.TV.F....CLL.L...GILYAVigyanftvrhlssttlafindfsslna.......................................................kapflfsasfslssnvtlmcaaymsgsLVKTTWSVR..aPF.PT..YVI..TLNTIIGSILF....TM.FGGVG.MATL...PVSLIF...............................................................AFKYRPKC.VI.T....R.A.Q---..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------yvkvcdlakcsnelktatlglqreerggkk..........................................................................................................................................................................................................................
A0A0N0VGA1_9TRYP/3-492                 .......................................................................................av--YIVWTVIF.SVL.AL.V.A.SV......AAY..RY..YT..K...E...S.IKYi...........................................................plMCAIWHVIS..V..Y..MCVLP.FP.LLVLDVDA..SLTAQtr....................................................................................................................................................................................................pgdA---..............-----.-...-...-...-..-..Q.....GW.....M...R.................YF...W...ITIF.AATY........FCAW..........................VS..LP.......VCQ.M....Y....T.E...........V...GE....F....S....V.K..G.RI.............................MHS...I...KLN...L...IL.YA.I..II.V.VI.V....AAL.V...YFVIIT.............................................................................................................NSYHSV--A...NV.LK..VVI..SLANAWGLLIL....TL.FMPAG.LVGV...PRMLYR...............................................................--YADAKR.LL.R....R.R.LYEA..T....DIQE..DLDLAA...................................................................................................................................MDLA........AI.KSEL...ISI..DPQ.VS..DEN...........................................Rp.hLT...SML.....ELISNadre..............................................................vpmyhI----AAQ---Rvkas...........................................................................psndNGDV...SLE....................................................................................................................................HLVELN...ARLK...KA...........................................................IK...VV....NR...T...N...Y.........RWTS...TVRKC....DSLD.................................................................................................................................QIVR.G....V.K...S.T........-...-....-....----.--.............----..--.----............-----N..NRL.K.KL.W.F...-PI...R.....A......Y.V.YY.TGCVV.CSVLTLF..IL.WSELTMPLRd........................wvGHPLG.......VIELIM-..-..-.....-....K.S..SVH.LPGS.....................-.-.--II.FL.F..YM...A.YC.AYWAAFQFKV....FDV.............YVIYP...-SIADN..ASL.....CFN...ETFLVRLLM................PLC....Y.NF...L..LISGLSstas..............................................etrvDVAYGH......V.....Y.R...S..N.M...D.....I..G.L..LFGS..YVN.KLL.PL..MIPFIA.IIVFFQL-t.......................................................................................................................................................................................................................................................
LMBR1_XENTR/18-269                     .........................................................................................RECIICFLLF.AIL.YI.V.S.YF......IIK..RY..KR..K...G...D.EQEdeda......................................................tvnrVSLFLCTFT..L..A..VSGGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........cfPKSYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLVS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KGi...........................kARI...-...LET...I...IM.LI.L..LA.L.LI.F....GIV.W...VASALIdn........................................................................................................ssaSMESLYDLW..dCY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDIDE.QM.Y....I.I.SLQE..E....ALQ-..------...................................................................................................................................RKLN........GG.NYTA...DYS..RKK.IE..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------hdll....................................................................................................................................................................................................................................................
A0A0F8CY97_CERFI/4-439                 ..................................................................................dvasrgi----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...W...L..P..Q.....RL.....L...L.................VW...W...RITY.WLTF........CLTW..........................FI..LP.......VLG.E....Y....A.D...........S...GF....R....E....P.Y..D.RF.............................LYS...L...RQN...A...QF.HA.M..VI.G.SS.V....VGL.V...YLIFS-.............................................................................................................YGFTMA---...SL.KT..TIM..ALSYCWGLLFA....IY.LMGHG.LVSI...PRKLFR...............................................................--NANISA.RL.R....R.L.QIHA..P....RLHE..KLDDAR...................................................................................................................................LALE........DV.EVLV...REL..ARR.KG..SSA...........................................R..gFV...EWI.....DELADiad................................................................aanrSLPTVITE----...................................................................................----...--Q....................................................................................................................................YMAEIT...RQLF...RA...........................................................RH...VR....TR...Y...S...K.........EWQQ...LVSEA....GYLQ.................................................................................................................................SLLD.S....K.A...S.K........K...L....E....FGTP.--.............SPDA..PF.WERI............--IFLT..PYG.R.YF.L.H...VQV...I.....P......A.L.RV.LLGGV.LSVASVC..II.WSELVKGA-...........................FPKLS.......VIRLSVV..H..H.....WtestD.S..GKG.QVGFg...................gQ.V.MAAC.WL.L..YM...C.IA.VFASISEVKV....WRG.............RALVR...-RNTAH..ESA.....FWY...AGQVAKLSV................PLS....Y.NF...L..TFVSPEy....................................................eDTVFHS......F.....L.G...K..Y.V...D.....F..T.A..LG-R..GFN.LIF.PA..LVLLPV.FAALFGLY........................................................................................................................................................................................................................................................
LMBD1_PODAN/12-295                     .....................................................................................liwv----AYAVAV.ALV.LL.V.A.II......TTF..TW..QS..P...H...E.RSV..............................................................TVSIVAIVS..L..T..SLLAT.VF.LLPVDIAL..VSSTAsahlg..............................................................................................................................................................................................akkdwaT---..............PERID.G...I...L...L..T..-.....--.....L...K.................VV...Y...YTLY.SFDA........LLCL..........................IV..IP.......FAY.F....W....Y.E...........E...YD....E....V....E.E..E.EGts........................gagARF...-...WKA...A...KY.TL.G..FV.F.LV.L....ILF.L...LGFFVPaagsgngk.............................................................................................hldldyfkRLLAANKGE...KA.LT..FGV..GLLITLGTFLY....TL.YTGAG.LALL...PVSLIKsapsisapq.............................................lsatiatdlEHNRELQR.QI.E....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------mrnagrpdgisqkdrreldallreertlvrrerlaaetr.................................................................................................................................................................................................................
A0A0S4JTI8_BODSA/301-500               .......................................................kkhnkkvlafknqvndleqyyekveisykekgge----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..--I.L.KA.W.I...ALA...V.....G......I.V.AT.GLSIA.WFFHIIL..FN.IA-------...........................NATPF.......LNALFIW..L..-.....-....D.K..AFS.LLGV.....................-.L.AYAI.FA.F..YL...L.WC.VVKGCTRVGV...nLLL.............FTVYPm.kVNGTLM..NAF.....LFN...CILIMLTSV................SVI....Q.-F...C..AIS-FKnyae..............................................ntsvSTLFTT......Y.....V.S...R..L.V...G.....V..N.Y..VV--..-MY.LQY.PL..VAVSFL.ALLWL---cic.....................................................................................................................................................................................................................................................
A0A135V1Q8_9PEZI/10-291                ..................................................................................sliwvay------AAAV.VFC.LL.A.A.II......TTF..TW..QT..P...R...E.RSA..............................................................IVSIVAIVS..L..T..ALLAT.VL.LLPVDIAL..-ISST.........................................................................................................................................................................................................THASl...........gvKKDWA.T...E...A...R..V..H.....DIl..qtL...R.................IV...Y...YSLY.SFDA........LLCL..........................LI..IP.......FAY.F....W....H.E...........E...YD....E....I....E.V..E.EGrs.........................fgSRL...-...ISA...L...KY.TL.V..FV.V.LV.L....ILF.L...V----Gffvpaagdh..........................................................................................ngahwdldyfKRILVQNNG..qKA.LA..FAL..GLLVTLGVLLY....VI.YTAAG.LALL...PMSFIKsapsisapql...........................................tentataleqNRERQRQL.EM.R....N.A.----..-....----..-----Grpegm.........................................................................................................................sskdrRELE........AL.VREE...RTL..TRR.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------erlaae..................................................................................................................................................................................................................................................
A0A0N4WRL1_HAEPC/176-336               ...............................................................................ttdsenlryc----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...-WI...H.....-......-.-.SL.CLQGI.SLLMVVI..NS.LK----LVF..........................gFRSLP.......AYAQYME..V..H.....T....R.H..SLG.IVGV.....................-.I.IESI.TI.M..YV...M.ST.SLTGLYSM--....PFV.............RALRP..qRARTSL..TVI.....IIN...CSLVLVLSSa..............lPVL....A.NT...L..GITSFD......................................................------......L.....L.G...A..Y.S...S.....L..K.W..LSNF..KLV.LAY.NV..LFAAAT.IVCVFSQ-i.......................................................................................................................................................................................................................................................
S3CDR0_GLAL2/8-306                     .....................................................................................fiwv----AYAVAV.GLV.AL.V.A.AI......FTY..TY..QT..P...R...D.RSA..............................................................LVSTITVIT..L..T..SLLAT.VL.LLPVDIAL..VSSTT.........................................................................................................................................................................................................SSKLg............rKKDWA.T..pE...A...V..H..N.....ILf...qL...K.................IV...Y...YALY.SLDA........VLCL..........................LV..VP.......FTY.F....F....Y.E...........E...LD....D....E....E.A..D.ND.............................RQS...F...GSK...A...LG.AL.K..YT.L.IF.V....VLV.L...ILFLVGffvpvarnre.........................................................................................gkhmdldyfkKLLQEDHGT...RA.LT..FSL..GFLICIGTLLY....VL.YTAAG.LALL...PISFIKsapsisapq.............................................lsettasalE-------.--.-....-.-.----..-....---Q..NRERQHqlearntgr.................................................................................................................dgglpakdqRELE........AL.K---...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------reertlvrrerlaaeargdgksfivrvwtktc........................................................................................................................................................................................................................
A0A063C923_9HYPO/11-310                .....................................................................................liwi----TYAVAV.GLC.LL.A.A.II......TTF..TW..QT..P...R...D.RSA..............................................................VVSIVAIIS..L..T..SLLAT.VL.LLPVDIAL..VSATGsvsq................................................................................................................................................................................................gtkkdW---..............--ATP.E...R...V...G..S..I.....LL....tL...K.................IV...Y...YSLY.SVDA........LLCL..........................VI..IP.......FAY.F...wY....E.E...........Y...DE....I....E....F.E..E.EG.............................RTW...-...QSR...F...LA.SV.K..YT.L.FF.V....AFV.V...VLFLLGffvpspgdps........................................................................................hgqrwdldyfkHLLAVSHAE...KA.LT..FAL..GLLVTLGTLLY....VV.YTGSG.LALM...PVSLIKsapaisapq.............................................lsattasqlE-------.--.-....-.-.----..-....----..QNRERQ...................................................................................................................................RQLE........--.MRNV...GRQ..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------egmsrkdrreldalvreeqtlvrrerlaaeaqgegrskvyqawlkic.........................................................................................................................................................................................................
A0A0M9F437_9HYPO/52-561                ........................................................................................g-SAVFSCIVL.VVI.SL.I.V.LL......ILR..YY..LP..L...R...T.TPA..............................................................FYLIPIFFA..L..W..LPTIV.VI.LVPIDLAS..-----.........................................................................................................................................................................................................SAVT.............gDEATR.G...I...W...L..P..E.....RV.....I...L.................VS...W...RISY.WLTF........ALTW..........................FI..LP.......ILA.E....Y....S.D...........S...GY....R....E....P.Y..D.KF.............................MYS...V...RSN...A...QF.HA.I..VL.G.FS.S....IGL.V...YFFIK-.............................................................................................................FGFKVE---...AI.KG..TIM..ALAYCWGLILA....IY.LMGHG.LVSI...PRRLMR...............................................................--GASISG.RL.R....R.L.QSKA..P....KVYE..EMEDSI...................................................................................................................................AKLE........DI.EVQV...TEL..GRR.KT..GSA...........................................N..vYR...DWI.....EELQEmanvpesqpr..................................................strfgggsdttIIPHVI------...................................................................................----...TEK....................................................................................................................................YLADLT...RKYV...RA...........................................................KH...AR....SR...Y...V...N.........TWSD...LVQEA....TETQ.................................................................................................................................AILD.S....A.A...S.K........K...L....E....FGDV.--.............SPHA..TL.WER-............-TVVLT..PYT.R.YL.Y.Y...YQI...L.....P......Y.A.QV.LLGIF.LAAASAC..IV.WSEVVKVA-...........................FPKLS.......VIRLTVV..H..H.....W....V.G..DKP.EVGFa...................gQ.A.ISSL.WI.C..YM...C.AA.ALISMTEVKV....WRG.............RALVR...-RNTAH..ESA.....FWY...AMQVAKLTI................PIS....Y.NF...I..TFLSSQv...................................................ykKTVFYH......F.....L.G...Q..L.I...D.....F..T.P..LG-H..WFD.DLF.PV..VVLFPV.FATLFGI-y.......................................................................................................................................................................................................................................................
A0A063BM13_9HYPO/12-522                ........................................................................................g-SVVFSVTVL.LVI.SV.V.V.LL......ILR..HY..LP..L...R...A.TPG..............................................................FYLVPIFFA..L..W..LPSIA.VL.LVPIDLAS..SAATD.........................................................................................................................................................................................................----..............DDASR.G...I...W...L..P..E.....RV.....I...L.................VS...W...RITY.WLTF........VLTW..........................FI..LP.......ILG.E....Y....S.D...........A...GY....H....E....P.N..D.KL.............................KYS...L...RQN...A...QF.YA.S..LL.G.AS.F....LGL.L...YVFIA-.............................................................................................................YRPSFS---...SL.KG..LIM..TLAYCWGLVLA....IY.LMGHG.LVSI...PRRMIR...............................................................--KASISG.RL.R....R.L.QTRA..P....KVHE..HMEDAL...................................................................................................................................ITLE........EV.EGQV...AEL..SRR.KT..GTS...........................................L..nFQ...EWI.....EELQDvanighgrfap.................................................iaggssatsnrGVPNFI------...................................................................................----...TEK....................................................................................................................................YLAELS...RKLV...RA...........................................................RH...TR....TR...Y...V...N.........EWIQ...LVQEA....GKLQ.................................................................................................................................AILD.S....A.G...P.K........Q...L....D....LEAS.--.............STHA..RT.WDPS............--RLLN..PHA.R.YL.C.F...FYL...V.....P......F.S.HL.ACGFF.LALASAC..IV.WSELVRYT-...........................FPRLS.......IVRISVV..H..H.....W....V.R..EKP.EVGFa...................gQ.V.VSAF.WI.C..YM...C.AA.TFVSMTEVKV....WRG.............RALVK...-RNTSY..ESA.....FWY...SMQVAKLTI................PLS....Y.NF...M..TFLSKEv...................................................yeKTIFYK......F.....L.G...Q..L.I...E.....N..T.A..PG-R..WFD.DLF.PI..VVLFPV.VATLFGLY........................................................................................................................................................................................................................................................
A0A0C7MZR8_9SACH/2-491                 ....................................................................................lfwlv-----IVAAT.GIT.AV.C.S.FL......FVN..RY..LS..F...K...R.HKNt...........................................................ipFTLAILLLN..M..W..ILLSI.TY.LLPLDVFY..AARASssehpegt.........................................................................................................................................................................................ngpqlrrsN--P..............WISRD.L...Q...S...S..D..Q.....MP....dV...S.................LL...W...YIIY.WSEF........AICW..........................FV..LP.......VLI.S....Y....L.DlkylfpthgdtS...QQ....R....P....V.L..N.RV.............................KKA...I...FTN...F...KF.YA.L..CA.L.GL.I....GGI.I...YLEFG-.............................................................................................................AKRGMA---...DL.KP..LII..SLSHLYSLSYT....LI.LLSMG.LILL...PKDILL...............................................................--ENDNE-.--.N....K.L.FVEL..S....KSND..ESNDAR...................................................................................................................................LALT........EY.ATKI...LSM..AEV.RN..GDV...........................................-...--...-VL.....NQALN.......................................................................ECKLEVQSLVNEk.................................................................................qI--Ql.pVTS....................................................................................................................................RRDQSA...STLN...KL...........................................................NE...RF....NA...F...K...T.........EYYN...YLYYQ....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............TKSD..RI.IHSL............----AQ..SQV.E.PV.-.S...-WT...R.....K......V.G.KW.VLGLL.CLAISSL..VV.FLELTPSRF...........................----A.......HDKLFEG..G..-.....-....-.-..--R.WFNF.....................-.M.LEIS.IL.M..YN...T.LA.SLYAMSCFKF....AN-.............LHLIP...NGQSSP..QNA.....LYF...SLYSSRLLL................PLC....F.NF...I..TLISHAsg..................................................vqECGFEK......V.....L.Y...R..D.L...K.....L..I.P..LV-D..ILN.RYL.PV..IFIIAV.PLGYF---fd......................................................................................................................................................................................................................................................
A0A091P301_LEPDC/2-192                 .................................................................................hddedaav----------.---.--.-.-.--......---..--..--..-...-...-.-NR..............................................................IALGLCTFT..L..A..VALGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEVLl...........sfPQNYY.I...Q...W...L..N..G.....SL.....V...H.................GL...W...NLVF.LFSN........LSLV..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....A....G.S..K.KGi...........................mARV...-...YET...S...VV.LL.L..LT.S.RA.W....CHW.P...D-----.............................................................................................................PAVSAD-LW..eYY.LP..YLY..SCISLFGVLLL....LL.CTPFG.LSIM...-FTVTGkll.........................................................vkpRLLEDLDE.QL.S....C.T.RLEE..A....AVS-..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------rr......................................................................................................................................................................................................................................................
A0A0V1AB61_9BILA/17-221                .........................................................................................RENVVATLLF.IIL.YA.C.S.YI......LVG..KF..RL..N...P...E.KDElftged.................................................sdaivfrISFWICIFS..T..A..VSLSA.IL.LVPFSIFS..-----.........................................................................................................................................................................................................NEILl...........lySKNYY.I...Q...W...L..S..S.....SL.....L...K.................SL...W...NSVF.ACSN........LCIF..........................IL..LP.......FAY.F....L....I.E...........S...HG....F....V....S.-..F.RFty........................siwNRV...-...L-E...T...TV.NS.S..LL.V.IL.S....VLL.V...QIVIIFlekench..............................................................................................pytfetcfNMWSFLITA..sTK.LP..VIY..SYISMFGVGL-....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------slg.....................................................................................................................................................................................................................................................
I0Z9H7_COCSC/1-113                     ........................................................................................m----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..TSISI.IA.IVPIDVWV..TLNGG.........................................................................................................................................................................................................N---..............-----.-...-...-...-..-..N.....KS.....V...F.................IM...W...AICY.WATQ........LLTW..........................FL..IP.......MSQ.G....F....S.D...........A...GD....F....T....V.L..G.RL.............................VSS...L...KQN...L...TY.YL.S..IA.V.AG.L....VGI.G...LLLIS-.............................................................................................................GSLHAG---...DL.LP..LAM..LLSNTYG----....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------el......................................................................................................................................................................................................................................................
G3VS14_SARHA/1-523                     .........................................................................................MSGAALGLEI.VFV.FF.L.A.LL......ILH..RY..GD..F...K...K.QHR..............................................................LVIVATLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRckqaansspse...................................................................................................................................................................................nnnitgsysaaA--Pvt.........gkhPCFKP.W...S...Y...I..P..D.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PNLHLE-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSHWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DI.MECP...TEY..QEK.MG..RNM...........................................D...DY...EDF.....DEKHN.......................................................................------------...................................................................................-TYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWRI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FQp...........qEPEN..RF.IQY-............---FYS..PTI.E.WY.W.E...CLL...R.....P......W.F.YR.ILAVV.LAIFSVI..VV.WSECTFFST...........................KPVLS.......LFAVFI-..Q..L.....A....E.R..TYN.YIYI.....................E.I.ACFL.SI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDstis.............................................hqdtqPTAYTS......I.....M.G...S..M.K...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
K7HF72_CAEJA/1-321                     .....................................................................................mgtv----SLVGQL.FVV.FL.L.T.SY......LLN..KY..ST..I...R...K.QNP..............................................................IVTISTFIG..W..Y..FSLII.IF.VLPLDVAI..TFFHKcetdrqril......................................................................................................................................................................................naslagtpspI--I.............pECELP.G...G...Y...V..P..D.....KV.....L...F.................DL...W...RVVY.WSAQ........MLTW..........................LI..LP.......LLQ.S....Y....V.T...........A...GN....F....T....I.F..G.KI.............................RAA...V...INN...A...LY.YG.I..YS.L.CF.L....AIL.I...YAMIK-.............................................................................................................-GVSIN-IE...NV.KV..ILV..SASNTWGLFLL....VV.LLGHG.LVEL...PRSLWH...............................................................--HGNRHY.RL.R....R.T.YFDI..E....KLAS..EKSEAE...................................................................................................................................ENVK........EM.YKRV...RIL..FNS.MK..SDT...........................................N..gQR...RKV.....RTILS.......................................................................KFSDEIIDNLFPsrqvid......................................................................nankeedGGFC...SEA....................................................................................................................................KLISLH...KKSI...YA...........................................................VQ...TL....NN...T...T...A.........LWK-...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------........................................................................................................................................................................................................................................................
W5PAW8_SHEEP/1-262                     .........................................................................................----ICFLLF.AML.YV.V.S.YV......VIT..RY..KR..K...S...D.EQEdeda......................................................ivnrISLFLSTFT..L..A..VSAGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........sfPQNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLAS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KGi...........................rARI...-...LET...L...VM.LI.L..LA.L.LI.L....GIV.W...VASALIdn........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpAILEDLDE.QI.Y....I.I.TLEE..E....ALQR..RLSGLSssv............................................................................................................................eynvTELE........QE.LENV...KIL..KK-.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------klerrkk.................................................................................................................................................................................................................................................
F6SQH3_CALJA/1-443                     .........................................................................................----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PHLHLE-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSYWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DA.MEEV...RKV..NES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQEKMGRnmddye.......................................................................dfdekhNIYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FQs...........pEPEN..RF.VQY-............---FYN..PTF.E.WY.W.E...CLL...R.....P......W.F.YK.ILAVV.LSIFSVI..VV.WSECTFFST...........................TPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.I.ACFL.SI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDssis.............................................hkntqPTAYTS......I.....M.G...S..M.K...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
A0A0V0SFV2_9BILA/1-534                 .........................................................................................MNVALLAVQL.LFV.FI.I.V.VL......ILH..QY..GD..W...Q...R.QHF..............................................................LVSFSTVVA..W..F..LAFVI.VF.MLPLDVVL..TFHRLcdnkeii...........................................................................................................................................................................................vnngtnrS--Fvp.........addNCQSS.D...I...D...L..P..D.....NV.....L...P.................IL...W...RFVY.WTSQ........LLTW..........................II..LP.......IMQ.S....Y....S.N...........A...GE....F....T....A.L..G.KL.............................KRA...L...INN...A...LY.YG.T..YL.I.VF.A....FLL.L...YAVSKG.............................................................................................................HYLNA---G...NL.KT..ICI..AASNTWGLFWL....VL.LLGYG.LVEV...PRNTWL...............................................................--NSKPGY.TL.M....K.L.YFKL..G....KLMV..ERNDAE...................................................................................................................................ETVK........EL.CQQA...YLL..SLQ.NE..NCS...........................................V...RY...PML.....KVILE.......................................................................KFPTSMVRAVEKkapq..........................................................................tiaqsDKQS...SEK....................................................................................................................................MLILFH...KQVI...KS...........................................................LQ...DY....NR...T...N...A.........QYDA...AMANA....IYLE.................................................................................................................................DVEK.N....Q.Q...S.P........D...T....Q....SLIV.--.............QNQN..PL.IGV-............---ICH..PTI.R.WY.F.D...CHL...K.....R......Y.L.LI.VLSVF.CCIMSVF..IV.WSEMTFSNV...........................NPPLS.......LAALFV-..H..M.....A....A.G..DKN.YMFI.....................E.M.FSII.TI.S..YM...C.IC.AYYTVFRLKV....YRY.............YHLDS...HHHTDE..NSL.....LFS...AILLCRLTP................PLC....L.NF...L..GIIHMDmhvtk...........................................dlnlqtETAYTK......L.....M.G...H..L.D...V.....I..E.P..IS-S..WFN.IYF.PM..AIILLC.IFTFFRL-g.......................................................................................................................................................................................................................................................
A0A136J2E6_9PEZI/12-291                .....................................................................................iwva-----YAVAV.GLA.LL.V.A.AV......TTF..TW..QT..P...R...D.RSA..............................................................IVSIVAIVS..L..T..ALLAT.VL.LLPVDIAL..VSATTst....................................................................................................................................................................................................aagT---..............--KKD.WatpD...R...V..N..N.....ILl...tL...K.................IV...Y...YSLY.SVDA........LLCL..........................IV..IP.......FSY.F....W....Y.E...........E...YD....E....V....E.E..Q.EG.............................NQT...V...GSR...L...WS.AF.K..YT.I.AF.I....LLV.V...IIFLIGffvpsagnngg.......................................................................................shldleffkrlL--EEN-HG..eRA.LT..FGL..GLLITLGTILY....VL.YTGAG.LALF...PISFIKsapavsapql...........................................settasaleqN-------.--.-....-.-.----..-....----..-R-ERQ...................................................................................................................................RQLE........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------mrsagradgmpakdrreldalhreertlvrrerlaa....................................................................................................................................................................................................................
I1RSW7_GIBZE/18-527                    ........................................................................................g-SAVFSCIVL.VVI.SL.V.V.LL......ILR..YY..LP..L...R...T.TPA..............................................................FYLIPIFFA..L..W..LPTIV.VI.LVPIDLAS..-----.........................................................................................................................................................................................................SAVT.............gDEATR.G...I...W...L..P..E.....RV.....I...L.................VS...W...RISY.WLTF........ALTW..........................FI..LP.......ILA.E....Y....S.D...........S...GY....R....E....P.Y..D.KF.............................MYS...V...RSN...A...QF.HA.I..VL.G.FS.S....IGL.V...YFFIK-.............................................................................................................FGFKVE---...AI.KG..TIM..ALAYCWGLILA....IY.LMGHG.LVSI...PRRLMR...............................................................--GASISG.RL.R....R.L.QSKA..P....KVYE..EMEDSI...................................................................................................................................AKLE........DI.EVQV...AEL..GRR.KT..GSA...........................................N..vYR...DWI.....EELQEmanvpesqpr..................................................strfgggsdttIIPHVI------...................................................................................----...TEK....................................................................................................................................YLADLT...RKYV...RA...........................................................KH...AR....SR...Y...V...N.........TWSD...LVQEA....TETQ.................................................................................................................................AILD.S....A.A...S.K........K...L....D....FGDV.--.............SPHA..TF.WER-............-TVILT..PYT.R.YL.Y.Y...YQI...L.....P......Y.A.QV.LLGLF.LAAASAC..IV.WSEVVKVA-...........................FPKLS.......VIRLTVV..H..H.....W....V.G..DKP.EVGFa...................gQ.A.ISFL.WI.C..YM...C.AA.ALTSMTEVKV....WRG.............RALVR...-RNTAH..ESA.....FWY...AMQVAKLTI................PIS....Y.NF...I..TFLSSQv...................................................ykKTVFYH......F.....L.G...Q..L.I...D.....F..T.P..LG-H..WFD.DLF.PV..VVLFPV.FATLFGI-y.......................................................................................................................................................................................................................................................
K2NSK7_TRYCR/3-489                     ......................................................................................ags---VFSTVFF.FFL.SL.V.A.TI......LIF..RY..YT..K...I...S.AKDm...........................................................pvLCRVFIIIA..L..L..SAILP.FP.LLVVDINA..-----.........................................................................................................................................................................................................A--I..............DAKAD.P...S...M...P..K..E.....TW.....L...I.................GV...W...YAIV.SATY........IMGW..........................AV..LP.......VSQ.S....Y....T.E...........V...GD....F....A....P.T..R.KI.............................KHA...I...RSN...V...KM.YA.I..SL.I.II.V....VLF.G...YVVFL-.............................................................................................................KGAYNS-IA...DI.LK..LAI..SLANAWGLILL....VL.FMSAG.LVGV...PKMLWR...............................................................--SSDAVR.ML.R....R.A.YFRA..V....DIQE..DLDIAS...................................................................................................................................MDLA........EV.KAEL...MTI..HPL.VA..EEH...........................................K..vYW...THM.....MEKIT.......................................................................KADRDIAQHHSAgalvr.........................................................................pvtgeNHTD..vSLK....................................................................................................................................HLEELH...ARVK...YS...........................................................IK...IV....RR...M...N...H.........LWDS...TIRDC....LAY-.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............---D..EF.LRGV............K--STN..NPF.K.RV.W.F...-PI...R.....G......V.V.FR.GAAVC.TSILTLL..VL.WSELLLPFQp........................ltTRQLS.......VIALAM-..-..-.....-....G.S..KFQ.LVGS.....................-.-.--MV.FM.F..YM...A.YC.SYWAILQLKV....FDI.............YVILP...-GISDN..ASM.....CFG...ATFLNRLIM................PLG....F.NF...L..LIADLMtd..................................................ntDVMYGH......V.....Y.R...R.nM.D...V.....S..L.V..LG-S..WLN.QFI.PM..FIPFVS.ILVLLKL-v.......................................................................................................................................................................................................................................................
A0A0L0MZX6_9HYPO/10-293                ..................................................................................sliwvty------AIAV.AFC.LL.A.A.II......TTF..TW..QT..P...R...D.RSA..............................................................IVSIVAIVS..L..T..ALLAT.VL.LLPVDIAL..VSATGa.......................................................................................................................................................................................................pA--Lga..........kkGWATP.A...R...V...A..D..I.....LL....tL...E.................VV...Y...YSLY.SLDA........LLCL..........................VV..IP.......FAY.F...wY....E.E...........Y...DE....I....E....F.E..E.EG.............................RTW...-...RSR...F...WA.AA.K..YT.L.FF.V....ALV.V...VLFLLGffvpaagds..........................................................................................skaqwdldyfKKLVTQNHG..eKA.LT..FAL..GLLVTLGTLLY....VV.YTGAG.LALM...PISFIKsapsisapql...........................................sattasqleqNRERQRQL.EM.R....N.A.GCEE..G....MSR-..---KDR...................................................................................................................................RELD........AL.VREE...QT-..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------lvrrerlaaea.............................................................................................................................................................................................................................................
M3YT49_MUSPF/267-455                   .............................................................................vellhrqvlalq----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............TQRV..LL.EKRR............KASAWQ..RNL.G.YP.L.A...MLC...L.....-......-.-.-L.VLTGL.SVLIVAI..HI.L----ELLIde.......................aaMPRG-.......MQDASLG..Q..V.....S....F.S..KLG.AFGA.....................-.V.IQVI.LI.F..YL...M.VS.SVVGFYSS--....PFF.............RSLRP..rWHDTAM..TQI.....IGN...CVCLLVLSSa..............lPVF....S.RT...L..GLTRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.FLY.NA..AFAGLT.TLCLVKT-f.......................................................................................................................................................................................................................................................
F0UMR6_AJEC8/8-292                     ......................................................................................liw---VVYAIVF.FLL.VA.V.A.SI......FIY..IY..QT..P...S...E.RST..............................................................YVTTVCIFT..L..T..ALLAT.VL.LLPVDVAL..VSSTTssre................................................................................................................................................................................................grrksW---..............ATQDE.V...D...K...I..T..-.....-F....sL...T.................VA...Y...YFLY.SLDA........VLCL..........................LV..VP.......FTY.F....W....Y.E...........E...YD....E....V....A.S..E.DG.............................SQT...F...RKR...F...WG.AF.K..YT.V.AF.I....LLT.V...ILFLVGffvpvgrrk..........................................................................................depnldldyfRRLLTENHG..eRA.LT..FAL..GLLITIGILVY....VL.YTSTG.LALL...PVTFIKsapais...................................................sptlsaNTASRLEE.NI.E....R.Q.RQL-..-....----..-----Egrcggnp....................................................................................................................drlpskqrRELD........SL.VRQA...RTL..RRR.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------qrlaeearr...............................................................................................................................................................................................................................................
A2G7G8_TRIVA/2-285                     ....................................................................................yawvv---ILATIIF.CIL.SI.L.VgIY......LVV..RF..QM..P...E...D.KKSs............................................................wFIKIIIILT..I..G..ISVMN.VL.ILPLDALN..-----.........................................................................................................................................................................................................R---..............-----.-...-...S...T..P..N.....PM....nT...T.................LM...C...WILT.IISA........VLAF..........................IV..IP.......FTL.T....Y....Y.E..........nA...ED....E....D....V.K..H.PI.............................---...-...CKA...T...LS.VI.P..FL.L.FF.I....IFL.L...ILYFLVsdcqipatihagkv.................................................................................vdeselttsiyscsTSTTID-IK..lSP.LI..FVV..TVIGFIGYIIL....II.LGGMG.FATL...PINLFIdfvrrprpislkqyakgq...........................qlinrwaeelieegnkirEEGKHKGY.KN.R....K.V.KRMV..N....KYAD..QI----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------enmerayqlievsykvr.......................................................................................................................................................................................................................................
K3VUN5_FUSPC/12-521                    ........................................................................................g-SAVFSCIVL.VVI.SL.V.V.LL......ILR..YY..LP..L...R...T.TPA..............................................................FYLIPIFFA..L..W..LPTIV.VI.LVPIDLAS..-----.........................................................................................................................................................................................................SAVT.............gDEATR.G...I...W...L..P..E.....RV.....I...L.................VS...W...RISY.WLTF........ALTW..........................FI..LP.......ILA.E....Y....S.D...........S...GY....R....E....P.Y..D.KF.............................MYS...V...RSN...A...QF.HA.I..VL.G.FS.S....IGL.V...YFFIK-.............................................................................................................FGFKVE---...AI.KG..TIM..ALAYCWGLILA....IY.LMGHG.LVSI...PRRLMR...............................................................--GASISG.RL.R....R.L.QSKA..P....KVYE..EMEDSI...................................................................................................................................AKLE........DI.EVQV...TEL..GRR.KT..GSA...........................................N..vYR...DWI.....EELQEmanvpesqpr..................................................strfgggsdttIIPHVI------...................................................................................----...TEK....................................................................................................................................YLADLT...RKYV...RA...........................................................KH...AR....SR...Y...V...N.........TWSD...LVQEA....TETQ.................................................................................................................................AILD.S....A.A...S.K........K...L....D....FGDV.--.............SPHA..TF.WER-............-TVILT..PYT.R.YL.Y.Y...YQV...L.....P......Y.A.QV.LLGLF.LAAASAC..IV.WSEVVKVA-...........................FPKLS.......VIRLTVV..H..H.....W....V.G..DKP.EVGFa...................gQ.A.ISSL.WI.C..YM...C.AA.ALTSMTEVKV....WRG.............RALVR...-RNTAH..ESA.....FWY...AMQVAKLTI................PIS....Y.NF...I..TFLSSQv...................................................ykKTVFYH......F.....L.G...Q..L.I...D.....F..T.P..LG-H..WFD.DLF.PV..VVLFPV.FATLFGI-y.......................................................................................................................................................................................................................................................
A0A0P7VF00_9TELE/286-470               .........................................................................ellvpldasggfliqr----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.--RK............KASAWE..RNL.L.YP.V.V...MLI...L.....-......-.-.-L.TGTAI.SVLLVAL..NI.LY---LLVDe........................taMPKG-.......SKERGIG..N..A.....S....L.S..PFG.VVQA.....................-.A.IEII.MM.F..YL...L.VS.SVVGFYSL--....RVF.............EGLTP..rKDDTTM..TTI.....IGC...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAVVT.TLCLVRKF........................................................................................................................................................................................................................................................
L5K9Q0_PTEAL/535-772                   .........................................................................................RECIISTLLF.ATL.YI.L.C.HI......ALT..HF..KK..P...A...E.FTTvdded....................................................atvnkIALELCTFT..L..A..VALGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEVLl...........slPRNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLVF.LFSN........LSLI..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....A....G.S..R.KGv...........................lGRV...-...YET...V...VM.LM.L..LT.L.LV.L....GMV.W...VASAIVdn........................................................................................................nkaSRESLYDFW..eYY.LP..YLY..SCISFLGVLLL....LV.CTPLG.LARM...-FSVTGkll.........................................................vkpRLLEDLEE.QL.Y....C.S.AFEE..A....ALTR..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ricnp...................................................................................................................................................................................................................................................
A0A091F2H4_CORBR/1-252                 ........................................................................................q----ICFLLF.AVL.YI.V.S.YF......IIT..RY..KR..K...A...D.EQEdeda......................................................ivnrISLFLSTFT..L..A..VSAGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........sfPQNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLAS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KGi...........................rARI...-...LET...L...VM.LI.L..LA.L.LI.L....GIV.W...VASALIdn........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDLDE.QM.Y....I.I.TLEE..E....AIQ-..------...................................................................................................................................RKLN........GV.SSTV...EYQ..TVE.L-..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------erelekvk................................................................................................................................................................................................................................................
F6V418_CANLF/291-480                   ............................................................................dmellhrqvlalq----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............TQRV..LL.EKRR............KASAWQ..RNL.G.YP.L.A...MLC...L.....-......-.-.-L.VLTGL.SVLIVAI..HI.L----ELLIde.......................aaMPRG-.......MQDASLG..Q..V.....S....F.S..KLG.SFGA.....................-.V.IQVV.LI.F..YL...M.IS.SVVGFYSS--....PFF.............RSLRP..rWHDTAM..TQI.....IGN...CVCLLVLSSa..............lPVF....S.RT...L..GLTDFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.FLY.NA..AFAGLT.TLCLVKT-f.......................................................................................................................................................................................................................................................
V5G3B1_BYSSN/10-516                    ........................................................................................g-SGIFFAFAL.VTI.SI.L.V.LL......LLR..RF..LT..L...R...A.TPA..............................................................YIIVPVFLA..L..A..LPASV.VL.LVPIDLTS..SSRAK.........................................................................................................................................................................................................----..............-GHAT.G...I...W...L..P..D.....RM.....V...L.................VS...W...RIAY.WLIF........VLTW..........................II..LP.......LLG.E....F....V.D...........S...GY....R....D....P.K..G.RL.............................MYS...L...RSN...G...RY.QL.T..VL.C.CG.I....VGL.I...YICIQ-.............................................................................................................NGFEFT---...SI.KG..LVM..ALAYVWGLILA....IY.LMGHG.LVSI...PRTLLR...............................................................--NANASG.RL.R....R.I.QARA..P....KVHD..RLMDAI...................................................................................................................................TDLE........EL.EAQV...SQL..QRR.KT..GSA...........................................R..eFH...DWI.....EELAE.......................................................................TCNSSESQPLAGqsiae.........................................................................atatvP--Av.iTER....................................................................................................................................YMADLT...RRLQ...RA...........................................................RH...RR....AR...F...L...D.........EWDR...LVQSA....ADAQ.................................................................................................................................AIID.S....C.A...S.K........K...L....D....FGRT.--.............APHA..SF.LSRA............--KFLT..PYM.R.YH.L.H...VNI...L.....P......N.I.RL.LFAGI.FAAASVC..II.WSELIKSF-...........................APKLS.......VISLTV-..V..P.....H....S.S..DPG.AIGFg...................gQ.V.TASA.WL.L..YM...C.TA.ALVGMYDAKV....WGN.............RALVR...-RNTYG..ESA.....CWY...AGQVAKLTV................PLS....Y.NF...L..TFLPEEv...................................................qrSTTFYK......F.....L.G...R..L.I...N.....L..T.P..LG-K..GFD.YFF.PV..FIFLPV.CATMFNLY........................................................................................................................................................................................................................................................
N6T715_DENPD/38-203                    .............................................................ksnhinirmrnvdvrstlgyqiseieek----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............--GK..LL.DKQR............KTSSLR..RNV.A.YP.F.A...MLL...L.....-......-.-.-I.GLTVI.AVLLVGQ..NI.LSMLIGIRA...........................LP-IS.......SKQFTLG..V..N.....S....L.F..KLG.PFGA.....................-.G.LEII.MI.V..YF...I.AT.SSIGLYTS--....SCM.............KNIRP..vIKRTSF..TLI.....IAN...CALLLMISSa..............fPLL....S.KT...L..AL----......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------efh.....................................................................................................................................................................................................................................................
A0A0P7Y997_9TELE/1-241                 .........................................................................................----IFALFF.FSL.YI.F.S.YL......VIT..HY..RK..N...A...E.--Fvtddne..................................................daivnrIALWLCTFS..L..S..VSIGA.IL.LLPLSILS..-----.........................................................................................................................................................................................................NEVLl...........sfPDSYY.M...Q...W...L..N..G.....SL.....V...H.................GL...W...NLVF.LFSN........LSLV..........................FL..LP.......FAY.L....F....T.E...........S...EG....F....V....G.S..K.KGv...........................mARV...-...YET...A...VV.LL.L..LS.L.LV.L....GMV.W...VASALVhh.........................................................................................................stAQESLNDLW..eYY.VP..YLY..SCISLFGMLLL....LL.CTPFG.QSRM...-FSVTGnvl.........................................................vkpRLLENVED.TM.N....C.A.IFEE..A....SLSR..KL----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------tsgtscwvdln.............................................................................................................................................................................................................................................
H3EX74_PRIPA/1-218                     .........................................................................................----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................----MCTTS..L..A..GSIGC.IM.LLPFSVLG..-----.........................................................................................................................................................................................................AELLqsdffivlidcaryPSSYY.L...Q...W...L..S..W.....SL.....L...H.................SL...W...NYVF.FLCN........ISLF..........................VL..LP.......FAY.F....F....I.E...........S...QG....F....N....K.K..R.TGv...........................lQRA...-...YET...G...AV.CA.I..LV.V.LL.L....CLS.D...LVFTLIlptg.....................................................................................................agggGGFAFG-LS..sLS.VP..LLY..SIVSLGGVVLL....LV.STPLG.FTKM...-FGIVS...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------elaqarpppaddvsverlelccrstpqrppaataaregeyglrsra..........................................................................................................................................................................................................
A0A0M3HMQ0_ASCLU/293-471               ..........................................................................ltppepflpqkplrg----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............-YQKVL..QSV.K.YP.L.A...III...L.....-......-.-.-L.LLTAV.SVLMVLI..NT.L----QLLF..........................gYRALP.......VYAQYIE..V..N.....S....R.H..TFG.IFGA.....................-.L.VEVI.II.S..YL...M.VA.SLVGVYSV--....PLL.............RRLRP..rKGKTTM..TFI.....IAN...CTTVLVLSSa..............lPVL....A.RT...L..GITTFD......................................................------......L.....L.G...A..Y.G...S.....F..N.W..LSNF..TLV.WTY.NV..AFAIAT.VSCLVNH-f.......................................................................................................................................................................................................................................................
S2JDT1_MUCC1/7-418                     .....................................................................................iawt----VFAITA.LCL.SL.F.S.IA......FTK..YY..QS..K...R...D.SEL..............................................................SATIVTMIA..L..A..LIFAT.VA.LLPIDIFL..VSSTVdsh..................................................................................................................................................................................................tglkK--Lw...........adKDTIY.W...M...T...F..T..-.....--.....V...Q.................IM...Y...YVFY.GSIV........AFSF..........................FV..IP.......YAY.F....Y....Y.E...........E...YE....E....E....G.Q..S.KS.............................QRR...-...-LS...A...LK.YT.I..FT.V.SI.V....GCL.F...LFGLFLkpnilpp...............................................................................................hidldwfKHLLTESHG..aKA.IW..FVV..GCLFVPGMAVF....IV.YTAPG.LSII...PFNLIK...............................................................-GKRRIDA.EH.D....E.I.----..-....--N-..------...................................................................................................................................HRLV........LV.REQQ...RLI..EHK.YA..GSD...........................................-...--...---.....-----.......................................................................-------QALSA...................................................................................HDYR...TLE....................................................................................................................................NLNDEE...RILV...RR...........................................................LG...GI....EE...D...R...G.........NFLQ...KVLKA....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............-----L..RPF.Q.VL.I.G...LIL...L.....-......-.V.FV.VLMAV.SMFMTIIdkVT.WSVCGRKCGyi.......................isHPKLFn.....pINFIFV-..-..H.....L....-.Q..KLF.PLDY.....................-.I.FMVA.IV.I..YF...F.MA.TMAGIIQIGV...kFLW.............VTLYRi.kRGSTAP..QGL.....LFS...AILL-----................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------tfgllalny...............................................................................................................................................................................................................................................
Q4Q9X7_LEIMA/4-277                     .....................................................................................wwli---VLIVVVA.LVC.VG.L.T.IY......TLI..YF..QS..E...E...D.SKWd............................................................yVPKAVAGLG..L..I..LAMGS.IL.LVPYDVAN..SPN--.........................................................................................................................................................................................................---P.............tVAHKY.V...Q...T...L..N..-.....--.....T...Q.................LM...W...EIVL.WMMA........VMAV..........................VV..CP.......FFM.F....F....Y.E...........A...YD....P....D....K.P..S.VG.............................TQV...-...-SH...G...VI.ST.V..II.A.FL.F....ALI.V...GLCYHFqgvaditfqaykgnp...............................................................................qmalpesstisyvsdSIKSTITVS..vSI.YT..YCI..GMLCFFGWIFF....FF.YGGAG.IVAY...PMSLIQ...............................................................NFKSRPKA.IG.A....S.K.FAEE..M....AIIL..AKADAM...................................................................................................................................----........--.LELC...MRL..QQE.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------srgsisrstknkinivrnev....................................................................................................................................................................................................................................
A0A0R3SWM1_HYMDI/326-480               .............................................................................lklneaslkrps----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..-SV.L.ST.I.A...FVL...L.....T......I.V.FI.ASVIS.TSVNIIA..ML.YS----LLIlrg.....................eetADRSS......vSDCIILG..H..E.....S....V.S..KFG.FFGA.....................-.F.LQAL.MV.T..LV...I.FT.SVIGFYSL-P....LVS.............KHIYP..qYHGTSM..SLL.....LFN...VTCILAMSSa..............vPLH....A.SL...L..GLVN--......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------psfplvyyssfl............................................................................................................................................................................................................................................
F7BEN1_XENTR/11-431                    ......................................................................................gwc----IFGVLL.LAI.LA.F.C.WV......YVR..KY..QS..H...Q...E.SEV..............................................................ISTITAISS..L..A..IALIT.SA.LLPVDIFL..VSFMK.........................................................................................................................................................................................................NHNGtfk........dwaESNTT.R...L...Q...I..E..-.....NT.....V...L.................IG...Y...YTLY.SIIL........FCVF..........................LW..IP.......FVY.F....Y....Y.E...........E...KD....D....T....D.G..S.QC.............................SQI...-...ANA...F...KYtSG.F..IL.V.CS.C....LLL.I...GAFAPLdihtnknst...........................................................................................dldkikllfLELGSSNGL...AA.LS..FSI..SSLTLIGMLAA....IT.YTAYG.MSAL...PLNLIK...............................................................GTRNA---.HY.E....R.L.----..-....----..---ENS...................................................................................................................................EDIE........EV.EQQV...ERI..MSK.CK..DGR...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................PLSSKD...RQAL...YK...........................................................LK...EK....LR...T...L...K.........RRDR...HLEYH....----.................................................................................................................................----.-....E.N...N.C........W...T....-....----.--.............----..KC.CIVI............RPFKVT..NKF.F.FL.L.T...PLV...I.....L......A.I.PF.LISTL.DKALHSA..GI.DSGFIIFGTn.........................lTN---.......PLNMLLP..V..-.....L....Q.T..VFP.-LDY.....................-.I.FITI.IT.M..YF...I.FT.SMAGIRNMGI...wFFW.............IRLYKi.rRRRTRP..QAL.....LFL...CMILLLI--................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------vlhtsymiysla............................................................................................................................................................................................................................................
Q22CC8_TETTS/258-483                   ....................................................................................qedll----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........--EI...KYQKG....FWAR.................................................................................................................................RKMN.N....K.S...S.A........E...F....Q....VFSE.AVl..........qlDDEH..QL.FKME............LDIATT..NP-.L.IY.Y.A...KLL...L.....G......F.F.GI.IISLV.WWVHILL..AV.LI---KKNG...........................FPIYA......lLDKMFLK..L..-.....E....S.I..GVS.FLAV.....................-.A.FFTM.FT.L..YL...L.WC.TMKGNFKIGIa..iPFL.............FTIHPm.rPNETWM..NSF.....LFN...LNIILITTV................ALV....Q.-F...V..SKC-FSqy..................................................mrYTELDQ......I.....Y.G...R.qV.E...Y.....L..E.F..YKYF..YTN.NVF.EI..ALLCWS.GLS-----aiyf....................................................................................................................................................................................................................................................
T1HA65_RHOPR/293-430                   ........................................................................ldvvkknrqllelqksi----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......SPQFTLG..L..T.....S....L.S..KLG.PVGA.....................-.G.IEIV.VI.T..YL...A.VT.SCAGLYTL--....PLL.............AKIRP..tNHGTPL..SLL.....IAN...AAILLVLSSa..............lPLL....S.RI...L..GITNFD......................................................------......L.....L.G...H..F.G...K.....I..E.W..LGNF..QIV.FLY.NL..LFAGVT.TLCLVNK-l.......................................................................................................................................................................................................................................................
Q5CYA0_CRYPI/1-571                     ................................................................mlvavvgvlgsltlsfflwkcmdei----------.---.--.-.-.--......---..--..-A..S...D...D.IST..............................................................FTIIPCYLG..A..L..ISISP.IL.ILPFDIAG..-----.........................................................................................................................................................................................................S-LLg............yENNNY.F...S...I...V..K..-.....--.....-...-.................FF...W...KLAY.LVLF........ILCW..........................VV..FP.......ILL.E....Y....E.L...........S...GD....F....D....H.N..K.KL.............................RTS...L...ERN...K...NR.WI.T..QI.I.II.A....ITS.I...LYLTV-.............................................................................................................--FNLHDSK..fSI.SS..MCI..AVAHFWGMAQI....TF.LWGFG.LVAI...PLKIKNsr...........................................................klVNKNDIIK.TL.N....K.Y.YTIL..H....NLED..WKAINH...................................................................................................................................HEIK........KL.NDKL...NYL..YSI.SN..EER...........................................-...KK...TII.....GKMIK.......................................................................TINESKTVLIKNnylgethhs................................................................nnidfknfseKSIL...MIE....................................................................................................................................DLITLN...RELK...LL...........................................................VT...EQ....KR...I...Y...Y.........LWES...TLLNS....WKLEnlivdiephlysknennplifss..................................................................................ratgsvhtsnnslknddslsvrsnYLVM.N....N.E...T.I........D...G....V....FLPN.--.............---N..NF.R--I............KNAELI..KNI.R.YL.L.E...KLFtinK.....E......Y.L.NQ.FLYIF.SLVTSIG..II.SAEATMYFP...........................NLNIS.......LYSHIIR..T..C.....Lr..iK.Y..MNN.YIKFi..................lvY.F.ICQC.LL.I..YV...Y.VC.TYWGLFYFKI....PKK.............YGIYL...NKHTDG..PCI.....VFF...SQFLCKLST................ALC....F.HY...L..SILKIE......................................................ETEFGK......F.....Y.G...K.qI.Q...H.....L..L.D..IFGK..DFNiFFF.PI..IVVLVY.AINVFDL-q.......................................................................................................................................................................................................................................................
A0A093GKK2_PICPB/1-543                 .........................................................................................MSGAALGLEI.VFV.FF.L.A.LF......LLH..RY..GD..F...K...K.QHR..............................................................LVIIATLLA..W..Y..LCFLI.VF.ILPLDVST..TIYNRcklavnssp......................................................................................................................................................................................aesngsyvtlA--Ps...........kqKCFKP.W...S...Y...I..P..N.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PNFNLQ-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSHWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DI.MEEV...RKV..SES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQERMGRnmddye.......................................................................dfderqNSYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWEI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FRs...........rEPEN..KI.VQY-............---FYT..PTV.E.WY.W.E...CLL...R.....P......W.F.YR.VLAVV.LATFSVI..VV.WSECTFFST...........................KPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.M.ACFL.TI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDatis.............................................hkntqPTAYTS......I.....M.G...S..M.R...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
A0A093IDC9_FULGA/1-485                 ............................................................tiynrcklavnsspaesngsyvtlapskq----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............KCFKP.W...S...Y...I..P..N.....GI.....M...P.................IF...W...RVVY.WTSQ........FLTW..........................IL..LP.......FMQ.S....Y....A.R...........S...GG....F....S....I.T..G.KI.............................KTA...L...IEN...A...IY.YG.T..YL.L.IF.G....AFL.I...YVAVN-.............................................................................................................PNFNLQ-WN...QL.QT..IGI..AAANTWGLFLL....VL.LLGYG.LVEI...PRSHWN...............................................................--GAKRGY.LL.M....K.T.YFKA..A....KLMT..EKADAE...................................................................................................................................ENLE........DI.MEEV...RKV..SES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQERMGRnmddye.......................................................................dfderqNSYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FHs...........qEPEN..KV.VQ--............--YFYT..PTV.E.WY.W.E...CLL...R.....P......W.F.YR.VLAVV.LATFSVV..VV.WSECTFFST...........................KPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.M.ACFL.TI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDatis.............................................hkntqPTAYTS......I.....M.G...S..M.K...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
A0A0L8I8R2_OCTBM/228-527               ........................................................................................l----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.--EI...KRA..SES.IR..YNH...........................................Y...LR...RHV.....DTILL.......................................................................KCPENFRKSIQRnvddy........................................................................edydspMDSP...TER....................................................................................................................................TLVRLH...KRVI...RA...........................................................SQ...IY....QR...T...Q...C.........QWNM...LMEKV....FALE.................................................................................................................................DVAN.N....E.S...N.P........E...R....I....FKHY.SSs...........vSVTG..L-.----............SKHFYN..PKV.E.WY.W.K...CLF...Q.....P......W.V.MK.IVAIC.LAVMSFM..VV.WSECLFFIK...........................KPVLS.......LFAVSI-..N..L.....A....N.Q..NHD.YVYI.....................E.L.TSIL.TI.G..FL...C.FC.AYYTVFQIRI....LNY.............YYIAP...HHQTNE..YSL.....IFT...GMMLCRLTP................PLC....L.NF...L..GLIHLDshvth............................................vnnleETAYTT......I.....M.G...H..M.D...V.....I..A.I..VS-D..GFN.IYF.PI..AIVLLC.ICTYFSLG........................................................................................................................................................................................................................................................
A0A094KE23_ANTCR/1-182                 .........................................................................................----ICVLLF.TSL.YI.L.C.HF......IIT..HF..KK..H...T...D.FTAehd........................................................dedAAVNRIAFT..L..A..VALGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEVLl...........sfPQNYY.I...Q...W...L..N..G.....SL.....V...H.................GL...W...NLVF.LFSN........LSLV..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....A....G.S..K.KGi...........................mARV...-...YET...S...VV.LL.L..LT.L.LD.Q....ALV.L...KGRRDAqwc.......................................................................................................wsdPVISTD-LW..eFY.LP..YLY..SCISLFGVLLL....L-.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------........................................................................................................................................................................................................................................................
M4A9N0_XIPMA/18-253                    .........................................................................................RETIICVLLF.TCL.YM.V.C.YL......ILT..HF..KK..T...A...E.F-Itddie...................................................datvnkIALWLCTFT..L..S..VAVCA.VL.LLPISILS..-----.........................................................................................................................................................................................................NEVLl...........tfPHSYY.M...E...W...L..N..G.....SL.....I...H.................GL...W...NLVF.LFSN........LSLV..........................FL..MP.......FAY.F....F....T.E...........S...EG....F....A....G.S..K.KGv...........................mARV...-...YEA...V...VL.LI.L..LA.L.LV.L....GIV.W...VASALLhd.........................................................................................................nvARQSLYDLW..eYY.LP..YLY..SGISLFGVLLL....LL.CTPFG.LSRM...-FSVTGsll.........................................................vkpRLLEDIED.TL.S....C.T.VFEE..D....SL--..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------frklnc..................................................................................................................................................................................................................................................
A0A091TME5_PHALP/1-321                 ........................................................................................l----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...---Y.SIIL........FCVF..........................LW..IP.......FVY.F....Y....Y.E...........E...KE....E....D....D.G..N.TC.............................SQV...-...KTA...L...KY.TL.G..FI.T.IC.A....VLL.L...IGAF-Vpldipnkkns.........................................................................................tewekvkllfEEFGSS-HG..lTA.LS..FSI..SSLTVIGMLAA....IT.YTAYG.MSAL...PLNLIK...............................................................GTTSAAYE.RL.E....N.T.----..-....----..------...................................................................................................................................EDIE........EV.EQRL...LRI..KSK.CR..DGR...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................PLSSRD...RRTV...QQ...........................................................LE...ER....LR...T...L...K.........RRER...HLESI....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............-EKS..WW.MKFC............EA---I..RPL.K.IV.W.G...VFF...I.....-......-.-.--.---IV.ALLFTVS..LF.LSNLDKALHsagfds...............gfiilgT-NLT......nPLNMLLP..V..-.....L....Q.T..VFP.-LDY.....................-.I.LITT.IV.M..YF...I.FT.SMAGIRNMGI...wFFW.............IRLYKi.rRGKTRP..QAL.....LFL...CMILLL---................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------ivlht...................................................................................................................................................................................................................................................
A0A087YCR1_POEFO/261-452               .............................................................................gsftfqltkeld----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.-Ni...........rNQKN..KL.ERRK............KASGWE..KNL.L.YP.M.V...MLI...L.....-......-.-.-L.AGTTI.SVIMVAL..NI.LY---LLVDe........................taMPKGS.......-TERGIG..N..T.....S....L.S..TFG.VIQA.....................-.V.VEII.LM.F..YL...M.VS.SVVGFYSL--....RVF.............EGLTP..rKDDTTM..TTI.....IGC...CVSILVLSSa..............lPVM....S.RT...L..GITRFD......................................................------......L.....L.G...D..F.G...R.....F..N.W..LGNF..YIV.LSY.NL..LFAVVT.TLCLVRKF........................................................................................................................................................................................................................................................
A0A0V0VXZ7_9BILA/17-309                .........................................................................................RENVVATLLF.IIL.YA.C.S.YI......LVG..KF..RL..N...P...E.KDElftged.................................................sdaivfrISFWICIFS..T..A..VSLSA.IL.LVPFSIFS..-----.........................................................................................................................................................................................................NEILl...........lySKNYY.I...Q...W...L..S..S.....SL.....L...K.................SL...W...NSVF.ACSN........LCIF..........................IL..LP.......FAY.F....L....I.E...........S...HG....F....V....S.-..F.RF.............................TYS...I...WNR...LletTV.NS.S..LL.V.IL.S....VLL.V...QIVIIFlekench..............................................................................................pytfetcfNMWSFLITA..sTK.LS..VIY..SYISMFGVGLS....LA.CTPLG.FGRI...-FAVFNvli.........................................................peaRIRNKIIN.DL.Q....L.L.SAEE..M....HLVK..KAKTAVsilkhtpfve..............................................................................................................eemnviwlsclR---........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------nlanlyaqrklfqkelns......................................................................................................................................................................................................................................
R0GP85_9BRAS/13-420                    .......................................................................................lg----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....F....E.D...........A...GD....F....T....V.S..E.RL.............................KTS...V...HVN...L...VF.YL.V..LG.F.IG.L....LGL.I...LLIMM-.............................................................................................................----HRNWK..gSI.LG..YAM..ACSNTFGLVTG....AF.LLGFG.LSEI...PKTIWK...............................................................--NADWTT.RQ.K....V.L.SHKI..A....KIAV..KLDNAH...................................................................................................................................QELS........NA.IVVA...QAT..STQ.MS..KRD...........................................P...MR...PYM.....NVIDA.......................................................................MLAKMFREDPSFkpqggq.......................................................................lgendmDYDT...DEK....................................................................................................................................SMATLR...RHLR...NA...........................................................KD...EY....YR...Y...K...S.........EYLT...YVTEA....LVLE.................................................................................................................................DTMK.N....Y.E...R.R........D...At.gwK....YISS.FR............aSRTG..KM.GDI-............-----L..DTL.E.FM.W.R...CIL...K.....K......Q.I.QM.VLAVV.MGIMSAA..IL.LAEATLLLS...........................KLDLS.......LFSILI-..S..S.....-....-.V..KSD.ELLV.....................Q.A.FAFV.PL.V..YM...C.VC.TYYSLFKIGM....LMI.............YSLTP...-RQTSS..VNL.....LMI...CSMIARYAP................PIS....Y.NF...I..NLIQLH.....................................................sETIFEK......K.....M.G...R..I.D...D....aV..P.V..FG-Q..RFN.EIY.PL..IMVIYT.LLVASNF-f.......................................................................................................................................................................................................................................................
A0A094LEQ8_9AVES/1-302                 ........................................................................................q----------.---.--.-.-.--......---..--..--..-...-...-.---..............................................................---------..-..-..-----.--.--------..-----.........................................................................................................................................................................................................----..............-----.-...-...-...-..-..-.....--.....-...-.................--...-...----.----........----..........................--..--.......---.-....-....-.-...........-...--....-....-....-.-..-.--.............................---...-...---...-...--.--.-..--.-.--.-....---.-...------.............................................................................................................---------...--.--..---..-----------....--.-----.----...------...............................................................--------.--.-....-.-.----..-....----..------...................................................................................................................................----........--.-QEV...RKV..SES.IK..YNH...........................................P...LR...KCV.....DTILK.......................................................................KCPTEYQERMGRnmddye.......................................................................dfderqNSYP...SEK....................................................................................................................................SLVKLH...KQVI...YS...........................................................VQ...RH....RR...T...Q...V.........QWQI...LLEQA....FYLE.................................................................................................................................DVAK.N....E.T...S.A........T...R....Q....FVHT.FH.............SQEA..EN.KII-............-RYFYT..PTV.E.WY.W.E...CLL...R.....P......W.F.YR.VLAVV.LATFSVI..VV.WSECTFFST...........................KPVLS.......LFAVFI-..Q..L.....A....E.K..TYN.YIYI.....................E.M.ACFL.TI.F..FL...S.IC.VYSTVFRIRV....FNY.............YYLAS...HHQTDA..YSL.....LFS...GMLFCRLTP................PLC....L.NF...L..GLTHMDatis.............................................hqhtqPTAYTS......I.....M.G...S..M.R...V.....L..S.F..IA-D..GFY.IYY.PM..LVVILC.IATYFSLG........................................................................................................................................................................................................................................................
A0A096NXX0_PAPAN/19-283                ........................................................................................r-ESTICFLLF.AIL.YV.V.S.YF......IIT..RY..KR..K...S...D.EQEdeda......................................................ivnrISLFLSTFT..L..A..VSAGA.VL.LLPFSIIS..-----.........................................................................................................................................................................................................NEILl...........sfPHNYY.I...Q...W...L..N..G.....SL.....I...H.................GL...W...NLAS.LFSN........LCLF..........................VL..MP.......FAF.F....F....L.E...........S...EG....F....A....G.L..K.KGi...........................rARI...-...LET...L...VM.LL.L..LA.L.LI.L....GIV.W...VASALIdn........................................................................................................daaSMESLYDLW..eFY.LP..YLY..SCISLMGCLLL....LL.CTPVG.LSRM...-FTVMGqll.........................................................vkpTILEDLDE.QI.Y....I.I.TLEE..E....ALQR..RLNGLSssv............................................................................................................................ecniMELE........QE.LENV...KTL..KTK.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------lerrk...................................................................................................................................................................................................................................................
V4Z3T5_TOXGV/4-286                     .......................................................................................ii--LVFFLLYF.LIT.LL.A.N.LK......LLF..YF..EH..S...S...D.SSLta.........................................................pevVCKVTILAG..L..Q..LAWLL.IL.AVPLDAYN..-----.........................................................................................................................................................................................................QHSP..............FVDKA.A...G...V...A..T..A.....GL....dM...R.................LY...W...GVVA.WFTA........LYLL..........................FA..VP.......FAT.F....Y....Y.E...........A...DF....D....S....R.-..-.-V............................sRRT...P...WKR...A...LS.KT.V..LA.V.CC.A....GLV.V...FVVYILcrsislkidddlcsqwqsqdvsqp............................................................lkdfceaaartaagpsssqsdakkeESFASLNMK..vDL.GV..YLL..AAMSFVGWFTF....AL.FGGIG.VAAL...PLDAFVnfrrrpr................................................aislstfkEIRRQLGE.KA.K....K.L.RFIG..E....ALRD..EE----...................................................................................................................................----........--.----...---..---.--..---...........................................-...--...---.....-----.......................................................................------------...................................................................................----...---....................................................................................................................................------...----...--...........................................................--...--....--...-...-...-.........----...-----....----.................................................................................................................................----.-....-.-...-.-........-...-....-....----.--.............----..--.----............------..---.-.--.-.-...---...-.....-......-.-.--.-----.-------..--.---------...........................-----.......-------..-..-.....-....-.-..---.----.....................-.-.----.--.-..--...-.--.----------....---.............-----...------..---.....---...---------................---....-.--...-..------......................................................------......-.....-.-...-..-.-...-.....-..-.-..----..---.---.--..------.--------alqq..............................................................................