
Database: Pfam
Entry: LMBR1
Original site: LMBR1 
#=GF AC   PF04791.12
#=GF DE   LMBR1-like membrane protein
#=GF AU   Waterfield DI, Finn RD, Bateman A
#=GF SE   Pfam-B_6189 (release 7.5)
#=GF GA   29.80 29.80;
#=GF TC   29.90 29.80;
#=GF NC   29.70 29.70;
#=GF BM   hmmbuild HMM.ann SEED.ann
#=GF SM   hmmsearch -Z 80369284 -E 1000 --cpu 4 HMM pfamseq
#=GF TP   Family
#=GF RN   [1]
#=GF RM   12032320
#=GF RT   Disruption of a long-range cis-acting regulator for Shh causes
#=GF RT   preaxial polydactyly. 
#=GF RA   Lettice LA, Horikoshi T, Heaney SJ, van Baren MJ, van der Linde
#=GF RA   HC, Breedveld GJ, Joosse M, Akarsu N, Oostra BA, Endo N, Shibata
#=GF RA   M, Suzuki M, Takahashi E, Shinka T, Nakahori Y, Ayusawa D,
#=GF RA   Nakabayashi K, Scherer SW, Heutink P, Hill RE, Noji S; 
#=GF RL   Proc Natl Acad Sci U S A 2002;99:7548-7553.
#=GF RN   [2]
#=GF RM   11287427
#=GF RT   Molecular cloning of a novel lipocalin-1 interacting human cell
#=GF RT   membrane receptor using phage display. 
#=GF RA   Wojnar P, Lechner M, Merschak P, Redl B; 
#=GF RL   J Biol Chem 2001;276:20206-20212.
#=GF RN   [3]
#=GF RM   11090342
#=GF RT   Acheiropodia is caused by a genomic deletion in C7orf2, the
#=GF RT   human orthologue of the Lmbr1 gene. 
#=GF RA   Ianakiev P, van Baren MJ, Daly MJ, Toledo SP, Cavalcanti MG,
#=GF RA   Neto JC, Silveira EL, Freire-Maia A, Heutink P, Kilpatrick MW,
#=GF RA   Tsipouras P; 
#=GF RL   Am J Hum Genet 2001;68:38-45.
#=GF DR   INTERPRO; IPR006876;
#=GF CC   Members of this family are integral membrane proteins that are
#=GF CC   around 500 residues in length. LMBR1 is not involved in preaxial
#=GF CC   polydactyly, as originally thought [1]. Vertebrate members of
#=GF CC   this family may play a role in limb development [3]. A member of
#=GF CC   this family has been shown to be a lipocalin membrane receptor
#=GF CC   [2]
#=GF SQ   1676
#=GS M7U7V2_BOTF1/18-517       AC M7U7V2.1
#=GS E9BHM4_LEIDB/298-458      AC E9BHM4.1
#=GS A0A059LEH9_9CHLO/66-222   AC A0A059LEH9.1
#=GS C1H239_PARBA/15-177       AC C1H239.1
#=GS A2YAR5_ORYSI/7-220        AC A2YAR5.1
#=GS E9ECR0_METAQ/17-280       AC E9ECR0.1
#=GS U6IIN3_HYMMI/1-463        AC U6IIN3.1
#=GS W5HIL5_WHEAT/2-365        AC W5HIL5.1
#=GS A0A024TJW4_9STRA/7-535    AC A0A024TJW4.1
#=GS H2RTB5_TAKRU/1-355        AC H2RTB5.1
#=GS A0A022Z7T0_TRIRU/13-517   AC A0A022Z7T0.1
#=GS R0GKZ9_9BRAS/6-499        AC R0GKZ9.1
#=GS M3ZJT7_XIPMA/25-445       AC M3ZJT7.1
#=GS D7MTA3_ARALL/6-499        AC D7MTA3.1
#=GS W6LC00_9TRYP/11-277       AC W6LC00.1
#=GS K0R7D7_THAOC/8-580        AC K0R7D7.1
#=GS J9HVG5_9SPIT/45-547       AC J9HVG5.1
#=GS G3I7S0_CRIGR/6-120        AC G3I7S0.1
#=GS G1M126_AILME/8-546        AC G1M126.1
#=GS C6LRV5_GIAIB/12-681       AC C6LRV5.1
#=GS K9KBL8_HORSE/1-92         AC K9KBL8.1
#=GS J9HY79_9SPIT/1-335        AC J9HY79.1
#=GS W9ZWK3_FUSOX/17-274       AC W9ZWK3.1
#=GS V6TBL7_GIAIN/8-694        AC V6TBL7.1
#=GS M4G4R1_MAGP6/16-258       AC M4G4R1.1
#=GS G1LJZ5_AILME/28-267       AC G1LJZ5.1
#=GS H7C1Y4_HUMAN/1-45         AC H7C1Y4.1
#=GS A0A024R0Y9_HUMAN/235-450  AC A0A024R0Y9.1
#=GS V9ESJ5_PHYPR/13-276       AC V9ESJ5.1
#=GS E3RPZ3_PYRTT/14-517       AC E3RPZ3.1
#=GS L7LY39_9ACAR/23-232       AC L7LY39.1
#=GS A8XT56_CAEBR/73-686       AC A8XT56.2
#=GS K9FX96_PEND2/15-255       AC K9FX96.1
#=GS W5GNP9_WHEAT/1-388        AC W5GNP9.1
#=GS G0R0T0_ICHMG/6-515        AC G0R0T0.1
#=GS E1F7T5_GIAIA/8-693        AC E1F7T5.1
#=GS X6NXG2_RETFI/73-362       AC X6NXG2.1
#=GS A0DFW7_PARTE/10-496       AC A0DFW7.1
#=GS L1JX39_GUITH/1-247        AC L1JX39.1
#=GS Q7RYT2_NEUCR/18-521       AC Q7RYT2.1
#=GS J9EUJ9_WUCBA/96-218       AC J9EUJ9.1
#=GS W6KQQ3_9TRYP/9-286        AC W6KQQ3.1
#=GS F2PKR0_TRIEC/1-232        AC F2PKR0.1
#=GS M4AGX1_XIPMA/1-110        AC M4AGX1.1
#=GS G0TWL5_TRYVY/11-482       AC G0TWL5.1
#=GS G8BKC2_CANPC/7-493        AC G8BKC2.1
#=GS M7B8G2_CHEMY/4-383        AC M7B8G2.1
#=GS Q178R5_AEDAE/6-528        AC Q178R5.1
#=GS F0XPR6_GROCL/23-515       AC F0XPR6.1
#=GS U6MA57_EIMMA/11-376       AC U6MA57.1
#=GS G0RD09_HYPJQ/19-518       AC G0RD09.1
#=GS W6LED7_9TRYP/10-489       AC W6LED7.1
#=GS N1Q3H6_MYCP1/21-515       AC N1Q3H6.1
#=GS T1HXA6_RHOPR/8-521        AC T1HXA6.1
#=GS A0A010QUR7_9PEZI/19-514   AC A0A010QUR7.1
#=GS A8B830_GIAIC/14-475       AC A8B830.1
#=GS U3FZM7_MICFL/19-257       AC U3FZM7.1
#=GS C7YNK4_NECH7/19-518       AC C7YNK4.1
#=GS H2TMI6_TAKRU/242-446      AC H2TMI6.1
#=GS Q8NDP7_HUMAN/1-127        AC Q8NDP7.1
#=GS G0U669_TRYVY/11-294       AC G0U669.1
#=GS T1EDW8_HELRO/8-603        AC T1EDW8.1
#=GS W2MWK9_PHYPR/8-540        AC W2MWK9.1
#=GS F7AVT2_HORSE/1-274        AC F7AVT2.1
#=GS A0A022U4P3_9EURO/13-515   AC A0A022U4P3.1
#=GS W9YJK0_9EURO/13-509       AC W9YJK0.1
#=GS H2LTX9_ORYLA/25-270       AC H2LTX9.1
#=GS Q584V8_TRYB2/12-486       AC Q584V8.1
#=GS V5GP41_IXORI/9-549        AC V5GP41.1
#=GS W2FS91_PHYPR/15-310       AC W2FS91.1
#=GS F1SHV3_PIG/12-93          AC F1SHV3.2
#=GS A8K4S2_HUMAN/26-281       AC A8K4S2.1
#=GS G3VS14_SARHA/8-520        AC G3VS14.1
#=GS G3IKM4_CRIGR/1-410        AC G3IKM4.1
#=GS F6Y2U7_CIOIN/8-550        AC F6Y2U7.2
#=GS H3DN30_TETNG/8-553        AC H3DN30.1
#=GS F1QF10_DANRE/18-303       AC F1QF10.1
#=GS A0A023A2Y3_TRIRU/13-517   AC A0A023A2Y3.1
#=GS LMBD1_ASPFC/15-253        AC B0YA61.1
#=GS M0SFK9_MUSAM/65-541       AC M0SFK9.1
#=GS LMBRL_PONAB/263-450       AC Q5RBY7.1
#=GS Y3707_DICDI/12-493        AC Q54QP7.2
#=GS V4RXD8_9ROSI/1-365        AC V4RXD8.1
#=GS E1QCE6_MYCPB/3-269        AC E1QCE6.1
#=GS G9K8B9_MUSPF/1-274        AC G9K8B9.1
#=GS X6P0L6_RETFI/8-216        AC X6P0L6.1
#=GS D8S065_SELML/5-111        AC D8S065.1
#=GS H2QQR9_PANTR/8-546        AC H2QQR9.1
#=GS T1KY36_TETUR/20-228       AC T1KY36.1
#=GS G0S5B5_CHATD/16-511       AC G0S5B5.1
#=GS F1RTT5_PIG/23-297         AC F1RTT5.1
#=GS M7WYQ9_ENTHI/7-491        AC M7WYQ9.1
#=GS G3P330_GASAC/25-251       AC G3P330.1
#=GS I3N7B2_SPETR/8-542        AC I3N7B2.1
#=GS E4XQV6_OIKDI/8-523        AC E4XQV6.1
#=GS YNC2_CAEEL/74-693         AC P34535.1
#=GS A0A022V014_TRIRU/15-258   AC A0A022V014.1
#=GS U1NQR3_ASCSU/324-460      AC U1NQR3.1
#=GS F7FJY9_MONDO/8-545        AC F7FJY9.1
#=GS Q00X06_OSTTA/9-159        AC Q00X06.1
#=GS G5C8R7_HETGA/2-156        AC G5C8R7.1
#=GS H2LTX9_ORYLA/226-447      AC H2LTX9.1
#=GS W4FYA9_9STRA/40-273       AC W4FYA9.1
#=GS D8LWX9_BLAHO/2-220        AC D8LWX9.1
#=GS Q38BH4_TRYB2/290-457      AC Q38BH4.1
#=GS C5M8D4_CANTT/4-466        AC C5M8D4.1
#=GS A0A022VW65_TRIRU/15-258   AC A0A022VW65.1
#=GS D4AQ78_ARTBC/15-268       AC D4AQ78.1
#=GS V7CR22_PHAVU/7-495        AC V7CR22.1
#=GS G0UW29_TRYCI/265-456      AC G0UW29.1
#=GS A0A026W6A3_CERBI/8-532    AC A0A026W6A3.1
#=GS A0A024RZY7_HYPJE/16-276   AC A0A024RZY7.1
#=GS E5AAE6_LEPMJ/13-512       AC E5AAE6.1
#=GS W2GGR9_PHYPR/13-276       AC W2GGR9.1
#=GS B0E7E1_ENTDS/1-91         AC B0E7E1.1
#=GS B8NSQ9_ASPFN/5-418        AC B8NSQ9.1
#=GS T1DML7_CROHD/8-548        AC T1DML7.1
#=GS G0SCW1_CHATD/17-260       AC G0SCW1.1
#=GS Q6FIX4_CANGA/10-481       AC Q6FIX4.1
#=GS E0V9N5_PEDHC/205-462      AC E0V9N5.1
#=GS K4E5L5_TRYCR/10-486       AC K4E5L5.1
#=GS Q22W34_TETTS/48-572       AC Q22W34.2
#=GS G5A514_PHYSP/8-543        AC G5A514.1
#=GS F4Q4S9_DICFS/1-464        AC F4Q4S9.1
#=GS A0A024WJM5_PLAFA/10-239   AC A0A024WJM5.1
#=GS C5P9K0_COCP7/22-517       AC C5P9K0.1
#=GS I7MIP6_TETTS/74-574       AC I7MIP6.2
#=GS S4PVR4_9NEOP/1-103        AC S4PVR4.1
#=GS V9KSZ6_CALMI/1-193        AC V9KSZ6.1
#=GS H2RSU8_TAKRU/1-55         AC H2RSU8.1
#=GS S4RXV9_PETMA/289-448      AC S4RXV9.1
#=GS W6XTG0_COCCA/15-260       AC W6XTG0.1
#=GS D7TRM2_VITVI/6-492        AC D7TRM2.1
#=GS B6K3S4_SCHJY/6-444        AC B6K3S4.2
#=GS N4UPY0_COLOR/18-258       AC N4UPY0.1
#=GS S9YQI3_9CETA/347-495      AC S9YQI3.1
#=GS D8RQM8_SELML/2-114        AC D8RQM8.1
#=GS J3LH96_ORYBR/6-495        AC J3LH96.1
#=GS F0UMR6_AJEC8/15-257       AC F0UMR6.1
#=GS D8S063_SELML/13-503       AC D8S063.1
#=GS N4U2D5_FUSC1/17-274       AC N4U2D5.1
#=GS F6YTE9_XENTR/34-268       AC F6YTE9.1
#=GS M8AX40_TRIUA/8-426        AC M8AX40.1
#=GS H3EX74_PRIPA/1-226        AC H3EX74.1
#=GS Q4RGQ6_TETNG/278-349      AC Q4RGQ6.1
#=GS U6PKA3_HAECO/77-579       AC U6PKA3.1
#=GS H2N1Q2_ORYLA/1-49         AC H2N1Q2.1
#=GS G4N3S8_MAGO7/27-533       AC G4N3S8.1
#=GS E9BYP7_CAPO3/8-628        AC E9BYP7.1
#=GS M3VU39_FELCA/28-268       AC M3VU39.1
#=GS W4FRF3_9STRA/8-519        AC W4FRF3.1
#=GS T1K5N2_TETUR/31-460       AC T1K5N2.1
#=GS I2CP79_9STRA/1-398        AC I2CP79.1
#=GS S9U7P2_9TRYP/272-498      AC S9U7P2.1
#=GS H2TMI7_TAKRU/227-445      AC H2TMI7.1
#=GS C5DC09_LACTC/7-500        AC C5DC09.1
#=GS T5AL92_OPHSC/1-160        AC T5AL92.1
#=GS E2BPT8_HARSA/8-532        AC E2BPT8.1
#=GS G7P2Z4_MACFA/20-293       AC G7P2Z4.1
#=GS C1GTK0_PARBA/1-351        AC C1GTK0.1
#=GS A0A022R3P5_MIMGU/6-491    AC A0A022R3P5.1
#=GS W7TPT9_9STRA/69-573       AC W7TPT9.1
#=GS LMBD1_PHANO/15-260        AC Q0UUE1.1
#=GS D2VRG6_NAEGR/72-582       AC D2VRG6.1
#=GS E1BV17_CHICK/8-540        AC E1BV17.2
#=GS G5AU28_HETGA/264-449      AC G5AU28.1
#=GS LMD2A_DICDI/7-538         AC Q54Q92.1
#=GS L8IHY6_9CETA/235-450      AC L8IHY6.1
#=GS G2YRC7_BOTF4/18-453       AC G2YRC7.1
#=GS H3DGN7_TETNG/20-302       AC H3DGN7.1
#=GS C0S360_PARBP/22-505       AC C0S360.1
#=GS K8ER22_9CHLO/6-578        AC K8ER22.1
#=GS R0KTT4_ANAPL/6-240        AC R0KTT4.1
#=GS G3UI42_LOXAF/8-546        AC G3UI42.1
#=GS E1ZL65_CHLVA/11-475       AC E1ZL65.1
#=GS G0UJT5_TRYCI/11-285       AC G0UJT5.1
#=GS A0E6M0_PARTE/7-503        AC A0E6M0.1
#=GS B3NZS8_DROER/7-540        AC B3NZS8.1
#=GS LMBD1_PODAN/19-272        AC B2AA26.1
#=GS W5HH57_WHEAT/2-290        AC W5HH57.1
#=GS W5L0L8_ASTMX/25-243       AC W5L0L8.1
#=GS D0N4S3_PHYIT/13-278       AC D0N4S3.1
#=GS H9MAA4_PINLA/1-69         AC H9MAA4.1
#=GS H2UV38_TAKRU/15-299       AC H2UV38.1
#=GS LMBRL_HUMAN/235-450       AC Q6UX01.2
#=GS F7EIN7_MACMU/265-450      AC F7EIN7.1
#=GS K2GJ60_ENTNP/7-491        AC K2GJ60.1
#=GS G3UPB7_MELGA/1-206        AC G3UPB7.1
#=GS C1MZX1_MICPC/5-464        AC C1MZX1.1
#=GS K1XBW7_MARBU/15-256       AC K1XBW7.1
#=GS B4LWE0_DROVI/28-215       AC B4LWE0.1
#=GS B4IMY0_DROSE/7-91         AC B4IMY0.1
#=GS R8BVA2_TOGMI/18-259       AC R8BVA2.1
#=GS W2YXF5_PHYPR/8-540        AC W2YXF5.1
#=GS C1G5H2_PARBD/15-274       AC C1G5H2.1
#=GS F7HSP6_MACMU/1-127        AC F7HSP6.1
#=GS LMBR1_XENTR/25-267        AC Q5U4X7.1
#=GS E9CCY3_CAPO3/218-432      AC E9CCY3.2
#=GS K6ZBT3_PANTR/240-445      AC K6ZBT3.1
#=GS A0A059J3X4_9EURO/13-515   AC A0A059J3X4.1
#=GS H3GLU2_PHYRM/8-540        AC H3GLU2.1
#=GS G2RBV0_THITE/23-522       AC G2RBV0.1
#=GS W9IR89_FUSOX/17-274       AC W9IR89.1
#=GS W9WGM3_9EURO/13-508       AC W9WGM3.1
#=GS F2PH44_TRIEC/15-275       AC F2PH44.1
#=GS A0A022WLM9_TRIRU/13-517   AC A0A022WLM9.1
#=GS K9FJG1_PEND2/19-513       AC K9FJG1.1
#=GS U6MDB7_EIMMA/102-198      AC U6MDB7.1
#=GS K7HV66_CAEJA/38-165       AC K7HV66.1
#=GS B7Z633_HUMAN/218-415      AC B7Z633.1
#=GS F4P0N2_BATDJ/8-489        AC F4P0N2.1
#=GS F7A4I2_MONDO/243-445      AC F7A4I2.1
#=GS I7GPL7_MACFA/1-78         AC I7GPL7.1
#=GS A0A023B3V7_GRENI/15-459   AC A0A023B3V7.1
#=GS G7P2J7_MACFA/4-466        AC G7P2J7.1
#=GS V4LCH4_EUTSA/104-579      AC V4LCH4.1
#=GS LMBD1_ASPFU/15-253        AC Q4WCL2.1
#=GS X0K5R1_FUSOX/19-520       AC X0K5R1.1
#=GS L7IIM5_MAGOY/27-533       AC L7IIM5.1
#=GS F2TAA0_AJEDA/21-517       AC F2TAA0.1
#=GS I1P4G5_ORYGL/6-495        AC I1P4G5.1
#=GS F6W863_ORNAN/3-211        AC F6W863.1
#=GS W2VXI1_PHYPR/15-310       AC W2VXI1.1
#=GS LMBRL_MOUSE/28-269        AC Q9D1E5.1
#=GS A9T3A3_PHYPA/14-495       AC A9T3A3.1
#=GS C1BPY3_9MAXI/9-279        AC C1BPY3.1
#=GS I3JTS9_ORENI/17-303       AC I3JTS9.1
#=GS A0A024V9E3_PLAFA/5-545    AC A0A024V9E3.1
#=GS W2RKV9_9EURO/38-312       AC W2RKV9.1
#=GS M7B2F5_CHEMY/384-446      AC M7B2F5.1
#=GS G3RWF7_GORGO/28-268       AC G3RWF7.1
#=GS D2VJK4_NAEGR/223-466      AC D2VJK4.1
#=GS H0EGU3_GLAL7/8-164        AC H0EGU3.1
#=GS L7I0J7_MAGOY/16-271       AC L7I0J7.1
#=GS C0NU62_AJECG/1-351        AC C0NU62.1
#=GS W5J515_ANODA/1-281        AC W5J515.1
#=GS Q4RGQ6_TETNG/345-496      AC Q4RGQ6.1
#=GS G1MYC8_MELGA/8-540        AC G1MYC8.1
#=GS H6C332_EXODN/13-511       AC H6C332.1
#=GS W5DPE6_WHEAT/2-290        AC W5DPE6.1
#=GS W5L0L9_ASTMX/25-243       AC W5L0L9.1
#=GS W5G7F4_WHEAT/1-388        AC W5G7F4.1
#=GS Q16UA7_AEDAE/27-482       AC Q16UA7.1
#=GS Q7QC62_ANOGA/6-530        AC Q7QC62.2
#=GS G9K8C0_MUSPF/1-99         AC G9K8C0.1
#=GS Q57XX2_TRYB2/11-245       AC Q57XX2.1
#=GS S7ZGH5_PENO1/19-516       AC S7ZGH5.1
#=GS F6TEM6_XENTR/196-420      AC F6TEM6.1
#=GS V6TPQ5_GIAIN/12-681       AC V6TPQ5.1
#=GS Q7LDY5_HUMAN/1-50         AC Q7LDY5.1
#=GS M2S4K6_ENTHI/285-454      AC M2S4K6.1
#=GS Q0CTG4_ASPTN/17-512       AC Q0CTG4.1
#=GS A7RHN0_NEMVE/281-410      AC A7RHN0.1
#=GS K7VBQ0_MAIZE/2-290        AC K7VBQ0.1
#=GS H0ZYW4_TAEGU/2-166        AC H0ZYW4.1
#=GS W4ZK09_STRPU/8-277        AC W4ZK09.1
#=GS J9BKW3_WUCBA/26-259       AC J9BKW3.1
#=GS W4YYE7_STRPU/11-265       AC W4YYE7.1
#=GS F4PI14_DICFS/11-508       AC F4PI14.1
#=GS M7Z4C2_TRIUA/6-496        AC M7Z4C2.1
#=GS A0A034VPN9_BACDO/10-297   AC A0A034VPN9.1
#=GS H2YCN3_CIOSA/8-247        AC H2YCN3.1
#=GS A0CB69_PARTE/7-516        AC A0CB69.1
#=GS O73804_TAKRU/21-272       AC O73804.1
#=GS C5XYA9_SORBI/6-496        AC C5XYA9.1
#=GS W6UTP0_ECHGR/8-579        AC W6UTP0.1
#=GS A0A058ZCL4_9EUKA/5-399    AC A0A058ZCL4.1
#=GS A0A017SHX6_9EURO/15-445   AC A0A017SHX6.1
#=GS U9U671_RHIID/32-499       AC U9U671.1
#=GS LMBRL_DANRE/25-255        AC Q803C7.1
#=GS LMBD2_CHICK/8-540         AC Q5F3F5.1
#=GS G7PHS1_MACFA/265-450      AC G7PHS1.1
#=GS G9K8C1_MUSPF/1-104        AC G9K8C1.1
#=GS G9P4Q7_HYPAI/19-518       AC G9P4Q7.1
#=GS R0KLI6_ANAPL/1-221        AC R0KLI6.1
#=GS G3NXX4_GASAC/8-376        AC G3NXX4.1
#=GS F8N2H0_NEUT8/24-265       AC F8N2H0.1
#=GS Q22RN8_TETTS/71-556       AC Q22RN8.2
#=GS E1BMA6_BOVIN/28-264       AC E1BMA6.1
#=GS U3DXH0_CALJA/264-450      AC U3DXH0.1
#=GS LMBD1_NEUCR/19-262        AC Q7SDN3.2
#=GS D3BC73_POLPA/1-96         AC D3BC73.1
#=GS A0DTG9_PARTE/41-327       AC A0DTG9.1
#=GS Q6C0H8_YARLI/9-480        AC Q6C0H8.1
#=GS A2EHB0_TRIVA/9-481        AC A2EHB0.1
#=GS I3K2D5_ORENI/25-252       AC I3K2D5.1
#=GS C5L569_PERM5/3-153        AC C5L569.1
#=GS D3B509_POLPA/28-448       AC D3B509.1
#=GS W5JHZ1_ANODA/324-472      AC W5JHZ1.1
#=GS F6WVI3_CALJA/243-445      AC F6WVI3.1
#=GS F7VYL4_SORMK/19-522       AC F7VYL4.1
#=GS Q86AH0_DICDI/99-712       AC Q86AH0.1
#=GS U3ESK3_MICFL/234-450      AC U3ESK3.1
#=GS F1KVP9_ASCSU/279-443      AC F1KVP9.1
#=GS I3JF56_ORENI/243-453      AC I3JF56.1
#=GS W7K9R9_PLAFO/5-545        AC W7K9R9.1
#=GS I1MYP4_SOYBN/6-495        AC I1MYP4.1
#=GS V9EN96_PHYPR/8-540        AC V9EN96.1
#=GS S9UHX5_9TRYP/271-498      AC S9UHX5.1
#=GS F2SIJ5_TRIRC/15-258       AC F2SIJ5.1
#=GS U4KV42_PYROM/10-485       AC U4KV42.1
#=GS G5C9G5_HETGA/8-546        AC G5C9G5.1
#=GS S4RXV9_PETMA/26-270       AC S4RXV9.1
#=GS E9B0I0_LEIMU/10-489       AC E9B0I0.1
#=GS W4ZD29_STRPU/8-168        AC W4ZD29.1
#=GS U3JWR3_FICAL/17-297       AC U3JWR3.1
#=GS S9V024_9TRYP/1-193        AC S9V024.1
#=GS M4A9N0_XIPMA/25-267       AC M4A9N0.1
#=GS E9CCY3_CAPO3/425-628      AC E9CCY3.2
#=GS C5G8K1_AJEDR/21-504       AC C5G8K1.1
#=GS A3ABJ6_ORYSJ/88-521       AC A3ABJ6.1
#=GS G5A2L2_PHYSP/13-279       AC G5A2L2.1
#=GS L5LFY6_MYODS/67-347       AC L5LFY6.1
#=GS A4HM51_LEIBR/11-224       AC A4HM51.1
#=GS L2G8F9_COLGN/19-517       AC L2G8F9.1
#=GS G3YE86_ASPNA/17-512       AC G3YE86.1
#=GS W5N502_LEPOC/8-189        AC W5N502.1
#=GS J9JM02_ACYPI/8-528        AC J9JM02.1
#=GS S8BTX0_9LAMI/14-490       AC S8BTX0.1
#=GS R7YJT6_CONA1/15-277       AC R7YJT6.1
#=GS W2PZ14_PHYPN/13-276       AC W2PZ14.1
#=GS W5I709_WHEAT/2-365        AC W5I709.1
#=GS J9EHG3_9SPIT/1-222        AC J9EHG3.1
#=GS X6MBN3_RETFI/1-386        AC X6MBN3.1
#=GS D3BQK5_POLPA/12-309       AC D3BQK5.1
#=GS C5L571_PERM5/3-130        AC C5L571.1
#=GS A2G7G8_TRIVA/287-450      AC A2G7G8.1
#=GS I3LY14_SPETR/16-189       AC I3LY14.1
#=GS M3WUU2_FELCA/23-301       AC M3WUU2.1
#=GS F7CGT0_ORNAN/115-324      AC F7CGT0.2
#=GS W9MYJ5_FUSOX/19-520       AC W9MYJ5.1
#=GS A2G7G8_TRIVA/11-285       AC A2G7G8.1
#=GS G1SF20_RABIT/26-283       AC G1SF20.1
#=GS D4DJN3_TRIVH/15-276       AC D4DJN3.1
#=GS G1KKY1_ANOCA/253-444      AC G1KKY1.1
#=GS LMBD2_DROPS/7-540         AC Q29BL9.1
#=GS E3QCK2_COLGM/19-516       AC E3QCK2.1
#=GS A8NST7_BRUMA/26-262       AC A8NST7.1
#=GS F4P8T4_BATDJ/331-539      AC F4P8T4.1
#=GS F0YBA6_AURAN/286-817      AC F0YBA6.1
#=GS S0DWL4_GIBF5/17-255       AC S0DWL4.1
#=GS W7FR96_PLAFA/10-153       AC W7FR96.1
#=GS M2QZB3_COCSN/14-517       AC M2QZB3.1
#=GS C4LUH4_ENTHI/7-480        AC C4LUH4.1
#=GS H2U0U7_TAKRU/247-447      AC H2U0U7.1
#=GS A4I1F8_LEIIN/8-278        AC A4I1F8.1
#=GS W3X9A5_9PEZI/26-267       AC W3X9A5.1
#=GS J9HY79_9SPIT/327-434      AC J9HY79.1
#=GS C9SY77_VERA1/18-264       AC C9SY77.1
#=GS W5I732_WHEAT/1-408        AC W5I732.1
#=GS U6H622_9EIME/57-352       AC U6H622.1
#=GS M3TWQ5_ENTHI/1-171        AC M3TWQ5.1
#=GS F1L9B3_ASCSU/1-87         AC F1L9B3.1
#=GS A2YAR5_ORYSI/201-689      AC A2YAR5.1
#=GS A0A024R0Z6_HUMAN/48-268   AC A0A024R0Z6.1
#=GS F1P229_CHICK/13-271       AC F1P229.2
#=GS Q2TM95_NICSY/6-99         AC Q2TM95.1
#=GS YC8B_SCHPO/61-498         AC O94599.1
#=GS K3XVJ1_SETIT/7-494        AC K3XVJ1.1
#=GS L8I748_9CETA/4-459        AC L8I748.1
#=GS K7HF71_CAEJA/11-311       AC K7HF71.1
#=GS H9GMJ5_ANOCA/210-426      AC H9GMJ5.1
#=GS F1QUZ2_DANRE/40-584       AC F1QUZ2.1
#=GS W9Z916_9EURO/34-300       AC W9Z916.1
#=GS G6D6E7_DANPL/25-457       AC G6D6E7.1
#=GS A0A023GC12_9ACAR/1-143    AC A0A023GC12.1
#=GS B0WAG8_CULQU/6-528        AC B0WAG8.1
#=GS K4AJH4_SETIT/342-443      AC K4AJH4.1
#=GS E1FXZ4_LOALO/241-439      AC E1FXZ4.2
#=GS W5MLV2_LEPOC/344-451      AC W5MLV2.1
#=GS V7PX45_9APIC/11-282       AC V7PX45.1
#=GS V9L4U4_CALMI/16-192       AC V9L4U4.1
#=GS C9ZK11_TRYB9/11-245       AC C9ZK11.1
#=GS W5K3G8_ASTMX/231-450      AC W5K3G8.1
#=GS K1WGC1_MARBU/17-517       AC K1WGC1.1
#=GS Q4CQJ4_TRYCC/10-258       AC Q4CQJ4.1
#=GS LMBD1_ASPNC/15-256        AC A2R920.1
#=GS R7U746_CAPTE/268-455      AC R7U746.1
#=GS M1GH17_MYCPM/3-269        AC M1GH17.1
#=GS G3S2Q4_GORGO/6-425        AC G3S2Q4.1
#=GS F7C803_CALJA/26-486       AC F7C803.1
#=GS L1IJC7_GUITH/365-729      AC L1IJC7.1
#=GS H9K6A9_APIME/24-482       AC H9K6A9.1
#=GS B4K5I6_DROMO/28-497       AC B4K5I6.1
#=GS J9JKY1_ACYPI/8-524        AC J9JKY1.2
#=GS A7RTZ5_NEMVE/1-539        AC A7RTZ5.1
#=GS I1KSY6_SOYBN/33-523       AC I1KSY6.2
#=GS A0A024G716_9STRA/13-493   AC A0A024G716.1
#=GS T0KIU9_COLGC/19-517       AC T0KIU9.1
#=GS I0Z9H7_9CHLO/1-113        AC I0Z9H7.1
#=GS W4IJW9_PLAFA/5-545        AC W4IJW9.1
#=GS M7TXA2_BOTF1/15-255       AC M7TXA2.1
#=GS J9I4D2_9SPIT/64-458       AC J9I4D2.1
#=GS L1JX39_GUITH/243-378      AC L1JX39.1
#=GS M2R6W5_ENTHI/7-491        AC M2R6W5.1
#=GS B8MHN3_TALSN/15-274       AC B8MHN3.1
#=GS Q5CYA0_CRYPI/4-568        AC Q5CYA0.1
#=GS M3XJN2_LATCH/16-295       AC M3XJN2.1
#=GS W9N0K6_FUSOX/17-274       AC W9N0K6.1
#=GS A4IAR3_LEIIN/11-223       AC A4IAR3.1
#=GS E2B7S6_HARSA/24-483       AC E2B7S6.1
#=GS G3VYX5_SARHA/21-301       AC G3VYX5.1
#=GS Q4CQJ4_TRYCC/296-459      AC Q4CQJ4.1
#=GS I1H156_BRADI/14-491       AC I1H156.1
#=GS V9ESJ5_PHYPR/254-492      AC V9ESJ5.1
#=GS E1F6F8_GIAIA/14-476       AC E1F6F8.1
#=GS V5H9U6_IXORI/24-290       AC V5H9U6.1
#=GS N4TNL1_FUSC1/19-520       AC N4TNL1.1
#=GS W5QC73_SHEEP/253-468      AC W5QC73.1
#=GS H2UV37_TAKRU/21-305       AC H2UV37.1
#=GS I1RLT7_GIBZE/18-274       AC I1RLT7.1
#=GS B0EUG0_ENTDS/7-480        AC B0EUG0.1
#=GS W6ZC58_COCMI/14-517       AC W6ZC58.1
#=GS V4AC99_LOTGI/27-472       AC V4AC99.1
#=GS B4HHK5_DROSE/29-495       AC B4HHK5.1
#=GS K7MGG9_SOYBN/6-309        AC K7MGG9.1
#=GS F8VVE2_HUMAN/28-126       AC F8VVE2.2
#=GS W9IZY6_FUSOX/19-520       AC W9IZY6.1
#=GS L5MD79_MYODS/266-450      AC L5MD79.1
#=GS F0ZM84_DICPU/129-662      AC F0ZM84.1
#=GS F8VZU8_HUMAN/33-141       AC F8VZU8.1
#=GS A0A023F450_TRIIF/23-475   AC A0A023F450.1
#=GS G1S1N9_NOMLE/8-546        AC G1S1N9.1
#=GS V5IGM9_IXORI/7-547        AC V5IGM9.1
#=GS K7GH80_PELSI/225-444      AC K7GH80.1
#=GS A0A024UQP0_9STRA/10-269   AC A0A024UQP0.1
#=GS G1XB73_ARTOA/15-243       AC G1XB73.1
#=GS A0A016WZU3_9BILA/439-647  AC A0A016WZU3.1
#=GS H2M442_ORYLA/226-444      AC H2M442.1
#=GS A0A022VQS0_TRIRU/13-517   AC A0A022VQS0.1
#=GS G8YLX6_PICSO/6-497        AC G8YLX6.1
#=GS G6D6E7_DANPL/469-681      AC G6D6E7.1
#=GS N6TDQ9_DENPD/8-555        AC N6TDQ9.1
#=GS M3ZGL4_XIPMA/1-367        AC M3ZGL4.1
#=GS U3N7J7_9HYPO/6-414        AC U3N7J7.1
#=GS R1BT11_EMIHU/263-412      AC R1BT11.1
#=GS G1N0G8_MELGA/1-183        AC G1N0G8.2
#=GS L5K3Z4_PTEAL/8-411        AC L5K3Z4.1
#=GS A4I1F8_LEIIN/262-458      AC A4I1F8.1
#=GS S9YQI3_9CETA/505-742      AC S9YQI3.1
#=GS H5V8C9_DROME/7-540        AC H5V8C9.1
#=GS C5DVN0_ZYGRC/6-483        AC C5DVN0.1
#=GS W1PWU5_AMBTC/23-191       AC W1PWU5.1
#=GS A0A024VH35_PLAFA/5-545    AC A0A024VH35.1
#=GS C1E8L4_MICSR/10-513       AC C1E8L4.1
#=GS E9AEI9_LEIMA/189-424      AC E9AEI9.1
#=GS D7M717_ARALL/14-489       AC D7M717.1
#=GS A0A059JUJ5_TRIRU/15-258   AC A0A059JUJ5.1
#=GS G7YI23_CLOSI/52-547       AC G7YI23.1
#=GS W5PMV4_SHEEP/8-546        AC W5PMV4.1
#=GS T2M810_HYDVU/31-111       AC T2M810.1
#=GS R1EZC7_BOTPV/15-276       AC R1EZC7.1
#=GS J3MCH0_ORYBR/6-494        AC J3MCH0.1
#=GS K3X7A6_PYTUL/4-220        AC K3X7A6.1
#=GS F4Q3L8_DICFS/13-285       AC F4Q3L8.1
#=GS A0A016WZD7_9BILA/103-343  AC A0A016WZD7.1
#=GS G1KKY1_ANOCA/25-255       AC G1KKY1.1
#=GS W2YY79_PHYPR/254-492      AC W2YY79.1
#=GS B9SQ26_RICCO/14-490       AC B9SQ26.1
#=GS Y399_MYCPN/3-269          AC P75384.1
#=GS M8AIM6_TRIUA/296-391      AC M8AIM6.1
#=GS E4ZXE4_LEPMJ/15-260       AC E4ZXE4.1
#=GS W5PAW8_SHEEP/4-260        AC W5PAW8.1
#=GS I1Q0P9_ORYGL/6-494        AC I1Q0P9.1
#=GS Q5CN39_CRYHO/4-568        AC Q5CN39.1
#=GS J3S909_CROAD/8-548        AC J3S909.1
#=GS Q2T9Y7_BOVIN/26-183       AC Q2T9Y7.1
#=GS J9EGZ1_WUCBA/8-242        AC J9EGZ1.1
#=GS T5BRB0_AJEDE/15-447       AC T5BRB0.1
#=GS W2KQV0_PHYPR/8-540        AC W2KQV0.1
#=GS V4Z3T5_TOXGO/11-507       AC V4Z3T5.1
#=GS LMD2B_DICDI/40-556        AC Q54TM2.1
#=GS B0EHJ6_ENTDS/13-286       AC B0EHJ6.1
#=GS A4D9T4_ASPFU/19-514       AC A4D9T4.1
#=GS H2PJI5_PONAB/20-314       AC H2PJI5.1
#=GS M5W2M6_PRUPE/6-494        AC M5W2M6.1
#=GS L7LY81_9ACAR/227-430      AC L7LY81.1
#=GS E3RLL0_PYRTT/15-264       AC E3RLL0.1
#=GS I1E565_AMPQE/2-125        AC I1E565.1
#=GS A8Q3U1_BRUMA/8-205        AC A8Q3U1.2
#=GS M8AUD1_TRIUA/8-103        AC M8AUD1.1
#=GS F7BEN1_XENTR/17-306       AC F7BEN1.1
#=GS H9MAA5_PINRA/1-69         AC H9MAA5.1
#=GS B4FIN5_MAIZE/2-186        AC B4FIN5.1
#=GS A0A010RIZ0_9PEZI/18-258   AC A0A010RIZ0.1
#=GS X6NCB0_RETFI/50-218       AC X6NCB0.1
#=GS W6KT99_9TRYP/10-242       AC W6KT99.1
#=GS L1JYU1_GUITH/7-740        AC L1JYU1.1
#=GS W5L0L9_ASTMX/234-446      AC W5L0L9.1
#=GS W9VRG7_9EURO/18-289       AC W9VRG7.1
#=GS H9J596_BOMMO/8-536        AC H9J596.1
#=GS W8C6Z6_CERCA/7-511        AC W8C6Z6.1
#=GS K1P9W7_CRAGI/17-300       AC K1P9W7.1
#=GS C6LQK8_GIAIB/14-479       AC C6LQK8.1
#=GS U6NZ40_HAECO/65-315       AC U6NZ40.1
#=GS M0YVF4_HORVD/14-341       AC M0YVF4.1
#=GS C4JZG1_UNCRE/22-116       AC C4JZG1.1
#=GS A7EPQ3_SCLS1/19-518       AC A7EPQ3.1
#=GS A9URS1_MONBE/165-462      AC A9URS1.1
#=GS G0V6K5_NAUCC/9-493        AC G0V6K5.1
#=GS B4JEL2_DROGR/7-550        AC B4JEL2.1
#=GS F1KVP9_ASCSU/27-262       AC F1KVP9.1
#=GS U3JHA7_FICAL/8-540        AC U3JHA7.1
#=GS S9VTE1_9TRYP/10-254       AC S9VTE1.1
#=GS S9TV07_9TRYP/12-279       AC S9TV07.1
#=GS Q4Q9X7_LEIMA/297-458      AC Q4Q9X7.1
#=GS K7FYU6_PELSI/8-545        AC K7FYU6.1
#=GS E6ZJ06_DICLA/25-451       AC E6ZJ06.1
#=GS A0A024X2Z3_PLAFC/1-197    AC A0A024X2Z3.1
#=GS V5HT36_BYSSN/15-255       AC V5HT36.1
#=GS D2V349_NAEGR/22-307       AC D2V349.1
#=GS H2YCM9_CIOSA/1-67         AC H2YCM9.1
#=GS E9GPQ7_DAPPU/24-263       AC E9GPQ7.1
#=GS G1KHI7_ANOCA/19-296       AC G1KHI7.2
#=GS K7HM30_CAEJA/2-186        AC K7HM30.1
#=GS G1S839_NOMLE/265-450      AC G1S839.1
#=GS W4YYE7_STRPU/233-424      AC W4YYE7.1
#=GS D3AWV5_POLPA/14-258       AC D3AWV5.1
#=GS G4UPI2_NEUT9/18-521       AC G4UPI2.1
#=GS M0YVF2_HORVD/14-121       AC M0YVF2.1
#=GS T1KBK3_TETUR/8-586        AC T1KBK3.1
#=GS S7Q1C5_MYOBR/28-262       AC S7Q1C5.1
#=GS G2YPM4_BOTF4/15-255       AC G2YPM4.1
#=GS D2VMX3_NAEGR/3-463        AC D2VMX3.1
#=GS G3JQY4_CORMM/19-460       AC G3JQY4.1
#=GS L9JAB3_TUPCH/30-244       AC L9JAB3.1
#=GS A0A024R0Z8_HUMAN/28-268   AC A0A024R0Z8.1
#=GS B3S4S7_TRIAD/9-535        AC B3S4S7.1
#=GS E5QYW5_ARTGP/317-413      AC E5QYW5.1
#=GS R4GKI0_CHICK/28-261       AC R4GKI0.1
#=GS I0Z8K5_9CHLO/13-491       AC I0Z8K5.1
#=GS LMBD1_SCLS1/15-254        AC A7F2V9.1
#=GS A0A022RPH2_MIMGU/14-488   AC A0A022RPH2.1
#=GS J3PJE1_GAGT3/30-535       AC J3PJE1.1
#=GS T0QZ94_9STRA/12-520       AC T0QZ94.1
#=GS M1V9R7_CYAME/15-682       AC M1V9R7.1
#=GS W5N3Z3_LEPOC/229-444      AC W5N3Z3.1
#=GS K7CCW8_PANTR/235-450      AC K7CCW8.1
#=GS E1FXZ4_LOALO/26-259       AC E1FXZ4.2
#=GS G0QVG7_ICHMG/245-530      AC G0QVG7.1
#=GS T1PIM2_MUSDO/1-443        AC T1PIM2.1
#=GS V9DPG7_9EURO/13-508       AC V9DPG7.1
#=GS A0DVS5_PARTE/11-471       AC A0DVS5.1
#=GS A0A024V1C6_PLAFA/10-239   AC A0A024V1C6.1
#=GS K7UL18_MAIZE/6-494        AC K7UL18.1
#=GS C4Y1K6_CLAL4/6-494        AC C4Y1K6.1
#=GS E9D0E8_COCPS/22-517       AC E9D0E8.1
#=GS LMBR1_MOUSE/26-281        AC Q9JIT0.1
#=GS H2Z9D4_CIOSA/40-289       AC H2Z9D4.1
#=GS G9MIW2_HYPVG/16-269       AC G9MIW2.1
#=GS I3KCK7_ORENI/8-547        AC I3KCK7.1
#=GS U9TCG2_RHIID/14-302       AC U9TCG2.1
#=GS F7EIH1_MACMU/49-276       AC F7EIH1.1
#=GS D7TH73_VITVI/14-489       AC D7TH73.1
#=GS V5D878_TRYCR/2-452        AC V5D878.1
#=GS K1PFL4_CRAGI/143-248      AC K1PFL4.1
#=GS M8C8J6_AEGTA/82-552       AC M8C8J6.1
#=GS B6HV90_PENCW/15-265       AC B6HV90.1
#=GS I0YK80_9CHLO/244-537      AC I0YK80.1
#=GS K6VEJ7_9APIC/1-191        AC K6VEJ7.1
#=GS H0YUW3_TAEGU/8-540        AC H0YUW3.1
#=GS E0VEJ2_PEDHC/9-538        AC E0VEJ2.1
#=GS B4LWE0_DROVI/305-590      AC B4LWE0.1
#=GS Q4RGQ6_TETNG/8-265        AC Q4RGQ6.1
#=GS E4XVC8_OIKDI/42-322       AC E4XVC8.1
#=GS F7C6Z2_XENTR/26-270       AC F7C6Z2.1
#=GS F0ZJQ2_DICPU/12-497       AC F0ZJQ2.1
#=GS U1GQ66_ENDPU/38-280       AC U1GQ66.1
#=GS F7EIH1_MACMU/227-445      AC F7EIH1.1
#=GS W1PXU2_AMBTC/14-117       AC W1PXU2.1
#=GS M2M0Y9_BAUCO/15-514       AC M2M0Y9.1
#=GS F7CGT0_ORNAN/1-159        AC F7CGT0.2
#=GS S7UT01_TOXGO/15-448       AC S7UT01.1
#=GS H2UV39_TAKRU/18-302       AC H2UV39.1
#=GS R7UIG9_CAPTE/1-119        AC R7UIG9.1
#=GS T1HA65_RHOPR/34-290       AC T1HA65.1
#=GS A0A024R0Y9_HUMAN/28-268   AC A0A024R0Y9.1
#=GS G0WI06_NAUDC/66-626       AC G0WI06.1
#=GS K7U5S3_MAIZE/6-305        AC K7U5S3.1
#=GS LMBRL_MACFA/28-281        AC Q4R7X9.1
#=GS G1NWN0_MYOLU/22-304       AC G1NWN0.1
#=GS Q4DTX8_TRYCC/244-458      AC Q4DTX8.1
#=GS W1NHY3_AMBTC/6-494        AC W1NHY3.1
#=GS W9KFN4_FUSOX/17-274       AC W9KFN4.1
#=GS W1PIK5_AMBTC/14-490       AC W1PIK5.1
#=GS W2GCN3_PHYPR/8-540        AC W2GCN3.1
#=GS G2HHV9_PANTR/28-291       AC G2HHV9.1
#=GS Q6Z7V1_ORYSJ/6-495        AC Q6Z7V1.1
#=GS L8G1R0_PSED2/16-514       AC L8G1R0.1
#=GS Q57XX2_TRYB2/233-458      AC Q57XX2.1
#=GS Q00X06_OSTTA/170-429      AC Q00X06.1
#=GS A8BSX6_GIAIC/8-694        AC A8BSX6.1
#=GS A0A059LCM3_9CHLO/8-124    AC A0A059LCM3.1
#=GS A7RHN0_NEMVE/28-283       AC A7RHN0.1
#=GS J9BKW3_WUCBA/271-435      AC J9BKW3.1
#=GS L7LVG3_9ACAR/9-552        AC L7LVG3.1
#=GS H9YWQ3_MACMU/26-445       AC H9YWQ3.1
#=GS N1JIT4_BLUG1/15-257       AC N1JIT4.1
#=GS U6N0W7_9EIME/46-364       AC U6N0W7.1
#=GS E6ZJ05_DICLA/244-447      AC E6ZJ05.1
#=GS F6V418_CANFA/53-293       AC F6V418.1
#=GS K8Z7F1_9STRA/67-234       AC K8Z7F1.1
#=GS S9VHT0_9TRYP/213-439      AC S9VHT0.1
#=GS H0PQP0_MYCPM/3-269        AC H0PQP0.1
#=GS LMBRL_XENLA/26-258        AC Q7ZX75.1
#=GS K2T0A3_MACPH/15-269       AC K2T0A3.1
#=GS M3K490_CANMX/6-491        AC M3K490.1
#=GS S0DUT3_GIBF5/19-520       AC S0DUT3.1
#=GS C4M4T1_ENTHI/7-491        AC C4M4T1.1
#=GS L2FL56_COLGN/18-258       AC L2FL56.1
#=GS F4PR48_DICFS/115-316      AC F4PR48.1
#=GS K4B2C1_SOLLC/11-495       AC K4B2C1.1
#=GS A0A028JG61_TRIRU/15-258   AC A0A028JG61.1
#=GS A0A044UVD0_ONCVO/279-438  AC A0A044UVD0.1
#=GS H0V0J6_CAVPO/217-423      AC H0V0J6.1
#=GS R0H6J8_9BRAS/14-489       AC R0H6J8.1
#=GS W7EVV7_COCVI/14-517       AC W7EVV7.1
#=GS N1QLJ2_SPHMS/26-513       AC N1QLJ2.1
#=GS K1PUC8_CRAGI/26-101       AC K1PUC8.1
#=GS LMBD1_DICDI/14-284        AC Q54KD1.1
#=GS M1C483_SOLTU/14-489       AC M1C483.1
#=GS D3ZUP8_RAT/8-546          AC D3ZUP8.1
#=GS LMBR1_CHICK/227-444       AC Q7ZUA6.1
#=GS H2U0U9_TAKRU/259-466      AC H2U0U9.1
#=GS W9CUD9_9HELO/15-255       AC W9CUD9.1
#=GS S9VHT0_9TRYP/11-205       AC S9VHT0.1
#=GS X0H671_FUSOX/17-277       AC X0H671.1
#=GS A0A059D6K8_EUCGR/14-399   AC A0A059D6K8.1
#=GS F1SHV4_PIG/1-293          AC F1SHV4.2
#=GS W6L6P6_9TRYP/250-438      AC W6L6P6.1
#=GS F7C7Y6_CALJA/223-415      AC F7C7Y6.1
#=GS A0A022UQS0_9EURO/15-282   AC A0A022UQS0.1
#=GS A0A026WI55_CERBI/24-485   AC A0A026WI55.1
#=GS A0DTH3_PARTE/11-501       AC A0DTH3.1
#=GS U3FCA7_MICFL/8-548        AC U3FCA7.1
#=GS A0DFU0_PARTE/10-288       AC A0DFU0.1
#=GS J3RZV9_CROAD/235-450      AC J3RZV9.1
#=GS G3NRH6_GASAC/17-301       AC G3NRH6.1
#=GS L8IHY6_9CETA/28-264       AC L8IHY6.1
#=GS B8BZW6_THAPS/12-504       AC B8BZW6.1
#=GS H9F7W6_MACMU/25-444       AC H9F7W6.1
#=GS X0BS30_FUSOX/17-277       AC X0BS30.1
#=GS C9SV87_VERA1/149-536      AC C9SV87.1
#=GS S7N6H8_MYOBR/8-514        AC S7N6H8.1
#=GS J9JWK3_ACYPI/26-478       AC J9JWK3.2
#=GS U6CPR3_NEOVI/8-546        AC U6CPR3.1
#=GS F7HSP4_MACMU/4-241        AC F7HSP4.1
#=GS A0A059LE07_9CHLO/4-315    AC A0A059LE07.1
#=GS W2IL44_PHYPR/8-540        AC W2IL44.1
#=GS W9YIP2_9EURO/18-262       AC W9YIP2.1
#=GS L7M1X5_9ACAR/19-256       AC L7M1X5.1
#=GS J3RZV9_CROAD/28-274       AC J3RZV9.1
#=GS V5BHG9_TRYCR/9-206        AC V5BHG9.1
#=GS W7LZU1_GIBM7/19-520       AC W7LZU1.1
#=GS T1J7X6_STRMM/284-518      AC T1J7X6.1
#=GS C5GJ09_AJEDR/15-447       AC C5GJ09.1
#=GS A0A016X015_9BILA/103-343  AC A0A016X015.1
#=GS G1LJZ5_AILME/234-449      AC G1LJZ5.1
#=GS C4JIE2_UNCRE/239-455      AC C4JIE2.1
#=GS G1QH87_NOMLE/4-423        AC G1QH87.1
#=GS F1NWK3_CHICK/17-295       AC F1NWK3.2
#=GS D3B9Q3_POLPA/99-344       AC D3B9Q3.1
#=GS K0KXM8_WICCF/7-495        AC K0KXM8.1
#=GS R0KTT4_ANAPL/206-425      AC R0KTT4.1
#=GS M4AFY0_XIPMA/17-301       AC M4AFY0.1
#=GS W4Y7X6_STRPU/5-295        AC W4Y7X6.1
#=GS H2M441_ORYLA/25-271       AC H2M441.1
#=GS Q5FVK3_RAT/28-237         AC Q5FVK3.1
#=GS W7X5T3_TETTS/12-295       AC W7X5T3.1
#=GS T2M4M8_HYDVU/1-269        AC T2M4M8.1
#=GS S2KIQ2_MUCC1/14-277       AC S2KIQ2.1
#=GS H2Q5U8_PANTR/28-268       AC H2Q5U8.1
#=GS H1A3D2_TAEGU/28-254       AC H1A3D2.1
#=GS F9W5R3_TRYCI/10-485       AC F9W5R3.1
#=GS K4CQ21_SOLLC/14-489       AC K4CQ21.1
#=GS A0A058Z6B3_9EUKA/15-493   AC A0A058Z6B3.1
#=GS H9H780_MONDO/246-450      AC H9H780.1
#=GS B4GP58_DROPE/7-540        AC B4GP58.1
#=GS L7J2S2_MAGOP/16-271       AC L7J2S2.1
#=GS U6H462_9EIME/11-376       AC U6H462.1
#=GS F2URH8_SALR5/156-446      AC F2URH8.1
#=GS F7E281_XENTR/17-295       AC F7E281.1
#=GS C4M0X4_ENTHI/285-454      AC C4M0X4.1
#=GS G1NYE3_MYOLU/8-569        AC G1NYE3.1
#=GS R7YNT1_CONA1/13-510       AC R7YNT1.1
#=GS M2S4K6_ENTHI/13-283       AC M2S4K6.1
#=GS X6P3F8_RETFI/1-150        AC X6P3F8.1
#=GS CSPLI_SELML/1-184         AC D8S069.1
#=GS S8FE62_TOXGO/11-507       AC S8FE62.1
#=GS LMBD1_ASPCL/15-255        AC A1C3U0.1
#=GS F0U8X0_AJEC8/192-688      AC F0U8X0.1
#=GS C0H5F8_PLAF7/10-281       AC C0H5F8.1
#=GS W7XH58_TETTS/11-306       AC W7XH58.1
#=GS G3TX80_LOXAF/127-328      AC G3TX80.1
#=GS V9IEP2_APICE/8-533        AC V9IEP2.1
#=GS T1GSH4_MEGSC/1-68         AC T1GSH4.1
#=GS S3CLC2_OPHP1/42-545       AC S3CLC2.1
#=GS C5L8U9_PERM5/3-131        AC C5L8U9.1
#=GS J5JKH5_BEAB2/19-287       AC J5JKH5.1
#=GS G1T1A0_RABIT/8-546        AC G1T1A0.1
#=GS F7HSP9_MACMU/4-466        AC F7HSP9.1
#=GS C5JEB4_AJEDS/15-257       AC C5JEB4.1
#=GS LMBD2_MOUSE/8-546         AC Q8C561.1
#=GS V4ZM49_TOXGO/15-448       AC V4ZM49.1
#=GS W8BWP7_CERCA/7-501        AC W8BWP7.1
#=GS F8W054_HUMAN/28-112       AC F8W054.1
#=GS LMBR1_MOUSE/239-445       AC Q9JIT0.1
#=GS X6NGI6_RETFI/453-546      AC X6NGI6.1
#=GS R1DNV9_EMIHU/3-284        AC R1DNV9.1
#=GS U6CUZ7_NEOVI/249-450      AC U6CUZ7.1
#=GS Q69QA4_ORYSJ/6-494        AC Q69QA4.1
#=GS W4ISU6_PLAFP/5-545        AC W4ISU6.1
#=GS G3TX80_LOXAF/14-160       AC G3TX80.1
#=GS H2NH57_PONAB/235-450      AC H2NH57.1
#=GS Q0U8Y0_PHANO/14-516       AC Q0U8Y0.2
#=GS D5G9G4_TUBMM/12-505       AC D5G9G4.1
#=GS F2RX46_TRIT1/15-275       AC F2RX46.1
#=GS W2WIV3_PHYPR/8-540        AC W2WIV3.1
#=GS I1IF06_BRADI/6-496        AC I1IF06.1
#=GS A0A016X015_9BILA/439-647  AC A0A016X015.1
#=GS J3KC92_COCIM/22-517       AC J3KC92.1
#=GS J9J2Q7_9SPIT/11-291       AC J9J2Q7.1
#=GS A0A034VJS4_BACDO/28-495   AC A0A034VJS4.1
#=GS A0A016WPU0_9BILA/8-242    AC A0A016WPU0.1
#=GS G7JCR3_MEDTR/7-497        AC G7JCR3.1
#=GS U6JAN5_ECHGR/1-472        AC U6JAN5.1
#=GS B9HCW4_POPTR/14-489       AC B9HCW4.1
#=GS S4PXJ0_9NEOP/25-243       AC S4PXJ0.1
#=GS J3QM78_MOUSE/26-108       AC J3QM78.1
#=GS G2X7L1_VERDV/19-517       AC G2X7L1.1
#=GS M7W2G4_ENTHI/7-480        AC M7W2G4.1
#=GS W7A8S4_9APIC/11-248       AC W7A8S4.1
#=GS G3TJH4_LOXAF/222-423      AC G3TJH4.1
#=GS E4YWB0_OIKDI/42-322       AC E4YWB0.1
#=GS F0W6P9_9STRA/13-494       AC F0W6P9.1
#=GS W2GGR9_PHYPR/254-492      AC W2GGR9.1
#=GS A0A028JCN4_TRIRU/13-517   AC A0A028JCN4.1
#=GS G1X611_ARTOA/11-521       AC G1X611.1
#=GS Q4D753_TRYCC/10-486       AC Q4D753.1
#=GS B4N8W2_DROWI/7-549        AC B4N8W2.1
#=GS A4S681_OSTLU/18-509       AC A4S681.1
#=GS E0V9N5_PEDHC/24-238       AC E0V9N5.1
#=GS G3WZL9_SARHA/14-437       AC G3WZL9.1
#=GS D5ABI3_PICSI/1-138        AC D5ABI3.1
#=GS LMD2B_DANRE/8-552         AC Q6P4P2.1
#=GS V4SUI2_9ROSI/14-490       AC V4SUI2.1
#=GS Q4S4X4_TETNG/11-476       AC Q4S4X4.1
#=GS S9U7P2_9TRYP/70-287       AC S9U7P2.1
#=GS A6QRZ3_AJECN/1-297        AC A6QRZ3.1
#=GS W6KT99_9TRYP/244-441      AC W6KT99.1
#=GS U1NQR3_ASCSU/23-127       AC U1NQR3.1
#=GS N1PJW2_MYCP1/15-281       AC N1PJW2.1
#=GS G3RWF7_GORGO/235-450      AC G3RWF7.1
#=GS LMBRL_PONAB/28-271        AC Q5RBY7.1
#=GS I1PZ58_ORYGL/14-490       AC I1PZ58.1
#=GS K7J9S1_NASVI/450-880      AC K7J9S1.1
#=GS J9HWH3_9SPIT/1-414        AC J9HWH3.1
#=GS U6CUZ7_NEOVI/28-273       AC U6CUZ7.1
#=GS D8LZF9_BLAHO/1-223        AC D8LZF9.1
#=GS H3C250_TETNG/21-266       AC H3C250.1
#=GS LMBD1_XENLA/17-294        AC Q7SYR6.1
#=GS W5HVY9_WHEAT/2-365        AC W5HVY9.1
#=GS X0D412_FUSOX/19-520       AC X0D412.1
#=GS M0SVX3_MUSAM/6-495        AC M0SVX3.1
#=GS Q00XD3_OSTTA/39-530       AC Q00XD3.1
#=GS W9Z122_9EURO/13-510       AC W9Z122.1
#=GS A2RAX9_ASPNC/17-512       AC A2RAX9.1
#=GS F9XB54_MYCGM/15-259       AC F9XB54.1
#=GS S7N9J0_MYOBR/67-525       AC S7N9J0.1
#=GS K4DXE1_TRYCR/272-459      AC K4DXE1.1
#=GS U6HQW4_ECHMU/1-472        AC U6HQW4.1
#=GS C5FDI2_ARTOC/13-514       AC C5FDI2.1
#=GS LMBR1_HUMAN/26-281        AC Q8WVP7.1
#=GS W6MIP1_9ASCO/77-587       AC W6MIP1.1
#=GS M3XFR2_FELCA/1-322        AC M3XFR2.1
#=GS A4HE60_LEIBR/9-277        AC A4HE60.1
#=GS D2HRX1_AILME/2-430        AC D2HRX1.1
#=GS K9IKJ9_DESRO/265-449      AC K9IKJ9.1
#=GS F7I499_CALJA/28-276       AC F7I499.1
#=GS G3P315_GASAC/21-293       AC G3P315.1
#=GS E6ZJ05_DICLA/25-259       AC E6ZJ05.1
#=GS B6QMF9_PENMQ/15-262       AC B6QMF9.1
#=GS U3ESK3_MICFL/28-278       AC U3ESK3.1
#=GS C5Z6W6_SORBI/7-356        AC C5Z6W6.1
#=GS F0ZKX1_DICPU/39-554       AC F0ZKX1.1
#=GS U6DA23_NEOVI/17-293       AC U6DA23.1
#=GS D8TFX8_SELML/1-378        AC D8TFX8.1
#=GS D2HLZ0_AILME/8-546        AC D2HLZ0.1
#=GS A0C9K3_PARTE/11-480       AC A0C9K3.1
#=GS S4R8I7_PETMA/2-210        AC S4R8I7.1
#=GS U6MVB0_9EIME/28-339       AC U6MVB0.1
#=GS B9IG94_POPTR/14-489       AC B9IG94.1
#=GS W7LQM3_GIBM7/17-277       AC W7LQM3.1
#=GS W4W7E6_ATTCE/1-317        AC W4W7E6.1
#=GS G0QP01_ICHMG/8-493        AC G0QP01.1
#=GS LMBD1_ASPTN/15-271        AC Q0D219.1
#=GS A5K220_PLAVS/13-507       AC A5K220.1
#=GS T0K7K3_COLGC/18-258       AC T0K7K3.1
#=GS M7W3M6_ENTHI/13-283       AC M7W3M6.1
#=GS G5E7N9_MELGA/8-564        AC G5E7N9.1
#=GS A0DAS1_PARTE/126-596      AC A0DAS1.1
#=GS W5HIS2_WHEAT/1-408        AC W5HIS2.1
#=GS B8NYP2_ASPFN/15-255       AC B8NYP2.1
#=GS H2U0U7_TAKRU/25-258       AC H2U0U7.1
#=GS G3I6I7_CRIGR/265-450      AC G3I6I7.1
#=GS L9JSL5_TUPCH/8-217        AC L9JSL5.1
#=GS F1M770_RAT/26-258         AC F1M770.2
#=GS Q5B5G9_EMENI/17-513       AC Q5B5G9.1
#=GS H3EX77_PRIPA/9-176        AC H3EX77.1
#=GS M2VYM8_GALSU/12-545       AC M2VYM8.1
#=GS H0WS37_OTOGA/236-450      AC H0WS37.1
#=GS Q4RW17_TETNG/217-419      AC Q4RW17.1
#=GS A0A016P7Z4_GIBZA/18-274   AC A0A016P7Z4.1
#=GS M2RGN4_ENTHI/1-39         AC M2RGN4.1
#=GS K0RI08_THAOC/12-68        AC K0RI08.1
#=GS K2MYD4_TRYCR/245-458      AC K2MYD4.1
#=GS B1N4V5_ENTHI/1-185        AC B1N4V5.1
#=GS A0A059D690_EUCGR/14-490   AC A0A059D690.1
#=GS H1VA57_COLHI/18-257       AC H1VA57.1
#=GS G3I6I7_CRIGR/28-268       AC G3I6I7.1
#=GS V6U8T1_GIAIN/14-479       AC V6U8T1.1
#=GS G1T1K4_RABIT/264-449      AC G1T1K4.2
#=GS F6PPP6_XENTR/231-447      AC F6PPP6.1
#=GS L8Y929_TUPCH/583-801      AC L8Y929.1
#=GS C3Z9N3_BRAFL/296-480      AC C3Z9N3.1
#=GS B4GPD4_DROPE/9-138        AC B4GPD4.1
#=GS U6IMW3_HYMMI/157-338      AC U6IMW3.1
#=GS D0N4S3_PHYIT/261-491      AC D0N4S3.1
#=GS U7Q497_SPOS1/46-553       AC U7Q497.1
#=GS W6ZNR3_COCMI/15-300       AC W6ZNR3.1
#=GS H9H780_MONDO/28-286       AC H9H780.1
#=GS H8XAP3_CANO9/7-493        AC H8XAP3.1
#=GS S9U8S1_9TRYP/4-274        AC S9U8S1.1
#=GS C4JIE2_UNCRE/15-269       AC C4JIE2.1
#=GS E9F123_METAR/19-518       AC E9F123.1
#=GS B7PTY4_IXOSC/8-548        AC B7PTY4.1
#=GS H3DC77_TETNG/25-249       AC H3DC77.1
#=GS W9SI78_9ROSA/6-495        AC W9SI78.1
#=GS B4JIK8_DROGR/30-500       AC B4JIK8.1
#=GS L7LZX0_9ACAR/9-532        AC L7LZX0.1
#=GS E7F4M0_DANRE/24-273       AC E7F4M0.1
#=GS M1BED6_SOLTU/1-62         AC M1BED6.1
#=GS E3Q4D9_COLGM/18-257       AC E3Q4D9.1
#=GS G3NIH5_GASAC/25-254       AC G3NIH5.1
#=GS N1SA28_FUSC4/17-279       AC N1SA28.1
#=GS K7L196_SOYBN/1-123        AC K7L196.1
#=GS T2MBH2_HYDVU/8-543        AC T2MBH2.1
#=GS D8RS75_SELML/7-495        AC D8RS75.1
#=GS F9FVJ9_FUSOF/17-277       AC F9FVJ9.1
#=GS G3T4T8_LOXAF/249-450      AC G3T4T8.1
#=GS B3LYA8_DROAN/29-497       AC B3LYA8.1
#=GS C1G0Y5_PARBD/104-600      AC C1G0Y5.1
#=GS E9BHM4_LEIDB/8-279        AC E9BHM4.1
#=GS F6WVI3_CALJA/26-277       AC F6WVI3.1
#=GS K4C1I0_SOLLC/7-495        AC K4C1I0.1
#=GS A9UWY4_MONBE/37-570       AC A9UWY4.1
#=GS W7ASW7_PLAVN/10-424       AC W7ASW7.1
#=GS B9HF82_POPTR/306-370      AC B9HF82.2
#=GS B2G4U9_ZYGRO/6-483        AC B2G4U9.1
#=GS E2A7S2_CAMFO/8-532        AC E2A7S2.1
#=GS C7YJB3_NECH7/18-238       AC C7YJB3.1
#=GS W4YMM4_STRPU/84-473       AC W4YMM4.1
#=GS F7I499_CALJA/263-452      AC F7I499.1
#=GS J9F8D8_9SPIT/9-495        AC J9F8D8.1
#=GS W2YYJ2_PHYPR/25-269       AC W2YYJ2.1
#=GS K4DXE1_TRYCR/10-241       AC K4DXE1.1
#=GS R0GP85_9BRAS/13-419       AC R0GP85.1
#=GS B4LW16_DROVI/7-550        AC B4LW16.1
#=GS W7HHU3_9PEZI/11-521       AC W7HHU3.1
#=GS G2QED7_THIHA/19-518       AC G2QED7.1
#=GS H3BI81_LATCH/4-127        AC H3BI81.1
#=GS F2E4Y1_HORVD/7-496        AC F2E4Y1.1
#=GS G3TCT8_LOXAF/8-546        AC G3TCT8.1
#=GS G5B3E7_HETGA/26-111       AC G5B3E7.1
#=GS L7JIL2_MAGOP/27-533       AC L7JIL2.1
#=GS D3BC73_POLPA/122-427      AC D3BC73.1
#=GS F2TES0_AJEDA/15-447       AC F2TES0.1
#=GS E9IEG0_SOLIN/4-465        AC E9IEG0.1
#=GS Q86PC4_DROME/29-495       AC Q86PC4.1
#=GS LMBD1_NEMVE/16-464        AC A7RM45.1
#=GS H0YHZ2_HUMAN/2-146        AC H0YHZ2.1
#=GS A0A016TBB9_9BILA/1-98     AC A0A016TBB9.1
#=GS Q4Q9X7_LEIMA/8-287        AC Q4Q9X7.1
#=GS E9H8R7_DAPPU/24-292       AC E9H8R7.1
#=GS H2QZM6_PANTR/26-486       AC H2QZM6.1
#=GS W6QBF1_PENRO/19-513       AC W6QBF1.1
#=GS D2V0X4_NAEGR/65-606       AC D2V0X4.1
#=GS D4AMW8_ARTBC/1-396        AC D4AMW8.1
#=GS B4NGP5_DROWI/28-496       AC B4NGP5.1
#=GS F6Z2E9_HORSE/4-425        AC F6Z2E9.1
#=GS G2X8J5_VERDV/18-263       AC G2X8J5.1
#=GS Q8NDP7_HUMAN/102-284      AC Q8NDP7.1
#=GS K7V7L5_MAIZE/14-490       AC K7V7L5.1
#=GS C3ZD62_BRAFL/1-277        AC C3ZD62.1
#=GS V9KZV7_CALMI/1-180        AC V9KZV7.1
#=GS G3T4T8_LOXAF/28-264       AC G3T4T8.1
#=GS S2JDT1_MUCC1/14-268       AC S2JDT1.1
#=GS W7XA84_TETTS/6-510        AC W7XA84.1
#=GS C9SV87_VERA1/19-132       AC C9SV87.1
#=GS G4U7S0_NEUT9/24-265       AC G4U7S0.1
#=GS A0A015JBY3_9GLOM/32-499   AC A0A015JBY3.1
#=GS G0UJT5_TRYCI/297-459      AC G0UJT5.1
#=GS A0A022YC24_TRIRU/13-517   AC A0A022YC24.1
#=GS K3X740_PYTUL/5-534        AC K3X740.1
#=GS V6LJ83_9EUKA/14-499       AC V6LJ83.1
#=GS X0IML2_FUSOX/19-520       AC X0IML2.1
#=GS D8FGD7_ASHGO/9-469        AC D8FGD7.1
#=GS H0Y6V6_HUMAN/24-484       AC H0Y6V6.1
#=GS Q9FKQ8_ARATH/6-499        AC Q9FKQ8.1
#=GS F0ZYQ9_DICPU/14-281       AC F0ZYQ9.1
#=GS H2KU72_CLOSI/1-439        AC H2KU72.1
#=GS H2PP58_PONAB/26-281       AC H2PP58.2
#=GS V7CLR9_PHAVU/6-495        AC V7CLR9.1
#=GS A0A059IYG4_9EURO/15-282   AC A0A059IYG4.1
#=GS M0TXG3_MUSAM/14-490       AC M0TXG3.1
#=GS B4K4Z4_DROMO/7-549        AC B4K4Z4.1
#=GS H2ASV5_KAZAF/6-485        AC H2ASV5.1
#=GS M3VU39_FELCA/259-450      AC M3VU39.1
#=GS W1Q8D1_OGAPD/7-493        AC W1Q8D1.1
#=GS D7FRZ6_ECTSI/1-426        AC D7FRZ6.1
#=GS W7FB95_PLAF8/5-545        AC W7FB95.1
#=GS A0A016PPB4_GIBZA/25-524   AC A0A016PPB4.1
#=GS F7HSP7_MACMU/4-188        AC F7HSP7.1
#=GS E9CTW4_COCPS/15-255       AC E9CTW4.1
#=GS H2TMI7_TAKRU/25-256       AC H2TMI7.1
#=GS W5H0A5_WHEAT/4-366        AC W5H0A5.1
#=GS Q4DTX8_TRYCC/10-268       AC Q4DTX8.1
#=GS LMBD1_MACFA/20-293        AC Q4R5E3.1
#=GS I0Z9H7_9CHLO/121-435      AC I0Z9H7.1
#=GS H9WYQ5_PINTA/1-69         AC H9WYQ5.1
#=GS B4F9B7_MAIZE/14-490       AC B4F9B7.1
#=GS H0YR04_TAEGU/25-276       AC H0YR04.1
#=GS S3BZJ3_OPHP1/17-286       AC S3BZJ3.1
#=GS M2V1X6_COCH5/15-272       AC M2V1X6.1
#=GS T1EFV7_HELRO/24-484       AC T1EFV7.1
#=GS H0WL75_OTOGA/22-300       AC H0WL75.1
#=GS H2TMI5_TAKRU/25-255       AC H2TMI5.1
#=GS G9K8B8_MUSPF/53-288       AC G9K8B8.1
#=GS D2HWS1_AILME/1-204        AC D2HWS1.1
#=GS C9ZK11_TRYB9/233-458      AC C9ZK11.1
#=GS H2XUT2_CIOIN/308-428      AC H2XUT2.1
#=GS S9VB43_9TRYP/9-483        AC S9VB43.1
#=GS T1J7X6_STRMM/24-246       AC T1J7X6.1
#=GS A2I5E1_RAJEG/6-155        AC A2I5E1.1
#=GS M0XVI4_HORVD/6-495        AC M0XVI4.1
#=GS G1T1K4_RABIT/28-268       AC G1T1K4.2
#=GS R1C231_EMIHU/389-783      AC R1C231.1
#=GS B0EAX4_ENTDS/7-490        AC B0EAX4.1
#=GS X6P1E8_RETFI/1-465        AC X6P1E8.1
#=GS B3M061_DROAN/7-539        AC B3M061.1
#=GS J9IM23_9SPIT/318-427      AC J9IM23.1
#=GS S9VJG4_9TRYP/12-267       AC S9VJG4.1
#=GS B1N5T6_ENTHI/7-217        AC B1N5T6.1
#=GS V9D9R6_9EURO/18-261       AC V9D9R6.1
#=GS G5A2L2_PHYSP/247-491      AC G5A2L2.1
#=GS S9W0Y5_SCHCR/4-440        AC S9W0Y5.1
#=GS V4A048_LOTGI/16-300       AC V4A048.1
#=GS H2Q5U8_PANTR/235-450      AC H2Q5U8.1
#=GS B4QTS6_DROSI/29-495       AC B4QTS6.1
#=GS Q2UU34_ASPOR/17-512       AC Q2UU34.1
#=GS H3AWA1_LATCH/8-556        AC H3AWA1.2
#=GS K7HF72_CAEJA/9-321        AC K7HF72.1
#=GS W4W091_ATTCE/81-602       AC W4W091.1
#=GS T5BQU5_AJEDE/15-257       AC T5BQU5.1
#=GS U1NQR3_ASCSU/126-338      AC U1NQR3.1
#=GS H0WVW0_OTOGA/8-546        AC H0WVW0.1
#=GS K7IXZ4_NASVI/324-782      AC K7IXZ4.1
#=GS S9VAI4_9TRYP/12-277       AC S9VAI4.1
#=GS T0S3G9_9STRA/7-477        AC T0S3G9.1
#=GS H0WK04_OTOGA/1-345        AC H0WK04.1
#=GS B7PTH3_IXOSC/2-128        AC B7PTH3.1
#=GS I1LNI1_SOYBN/6-495        AC I1LNI1.1
#=GS A4HE60_LEIBR/253-459      AC A4HE60.1
#=GS L8GJ93_ACACA/11-275       AC L8GJ93.1
#=GS A2DZN6_TRIVA/2-370        AC A2DZN6.1
#=GS G1SF20_RABIT/255-445      AC G1SF20.1
#=GS W5KPQ5_ASTMX/18-425       AC W5KPQ5.1
#=GS Q4RT78_TETNG/206-404      AC Q4RT78.1
#=GS I8TI08_ASPO3/15-255       AC I8TI08.1
#=GS B4DTZ7_HUMAN/1-440        AC B4DTZ7.1
#=GS S9V5B0_9TRYP/11-481       AC S9V5B0.1
#=GS A0DTG9_PARTE/298-503      AC A0DTG9.1
#=GS C0NNS1_AJECG/15-258       AC C0NNS1.1
#=GS L7MFB7_9ACAR/2-223        AC L7MFB7.1
#=GS S7VZY4_TOXGO/11-507       AC S7VZY4.1
#=GS S9WZN8_9CETA/1-215        AC S9WZN8.1
#=GS G3VSI5_SARHA/236-452      AC G3VSI5.1
#=GS H1W5W2_COLHI/19-505       AC H1W5W2.1
#=GS R0KEP1_ANAPL/1-281        AC R0KEP1.1
#=GS D2VJK4_NAEGR/18-274       AC D2VJK4.1
#=GS F6SQH3_CALJA/1-440        AC F6SQH3.1
#=GS W7U3J0_9STRA/13-495       AC W7U3J0.1
#=GS U3DXH0_CALJA/28-268       AC U3DXH0.1
#=GS U3IQ77_ANAPL/212-432      AC U3IQ77.1
#=GS W3WR49_9PEZI/22-521       AC W3WR49.1
#=GS A0BSN5_PARTE/7-477        AC A0BSN5.1
#=GS LMBD1_COCIM/15-255        AC Q1E5A9.1
#=GS I1J7F8_SOYBN/1-404        AC I1J7F8.1
#=GS A7TG06_VANPO/7-491        AC A7TG06.1
#=GS U5EYB4_9DIPT/5-532        AC U5EYB4.1
#=GS G1QIG0_NOMLE/20-295       AC G1QIG0.1
#=GS A0A059D7B6_EUCGR/14-427   AC A0A059D7B6.1
#=GS H0UZU8_CAVPO/28-267       AC H0UZU8.1
#=GS F0XCH3_GROCL/16-279       AC F0XCH3.1
#=GS N1RHX6_FUSC4/19-520       AC N1RHX6.1
#=GS H2T8G9_TAKRU/8-540        AC H2T8G9.1
#=GS L5MD79_MYODS/28-271       AC L5MD79.1
#=GS A0A022TFF0_TRIRU/15-258   AC A0A022TFF0.1
#=GS K1QP66_CRAGI/13-126       AC K1QP66.1
#=GS M0TC77_MUSAM/14-490       AC M0TC77.1
#=GS S4P6I5_9NEOP/1-136        AC S4P6I5.1
#=GS V4AH51_LOTGI/8-548        AC V4AH51.1
#=GS K4AJH4_SETIT/14-108       AC K4AJH4.1
#=GS LMBD1_MAGO7/16-271        AC A4RE85.1
#=GS J9IM23_9SPIT/1-329        AC J9IM23.1
#=GS F9WXY9_MYCGM/27-527       AC F9WXY9.1
#=GS G3TJH4_LOXAF/4-252        AC G3TJH4.1
#=GS M0Z9W1_HORVD/1-388        AC M0Z9W1.1
#=GS H3GLP4_PHYRM/13-277       AC H3GLP4.1
#=GS V9KZV7_CALMI/152-341      AC V9KZV7.1
#=GS E3MI86_CAERE/73-690       AC E3MI86.1
#=GS H3AKE0_LATCH/25-253       AC H3AKE0.2
#=GS G5C8R7_HETGA/233-294      AC G5C8R7.1
#=GS LMBD1_EMENI/15-254        AC Q5BDG8.2
#=GS Q38BH4_TRYB2/11-291       AC Q38BH4.1
#=GS E1Z6S9_CHLVA/11-504       AC E1Z6S9.1
#=GS G0QVJ9_ICHMG/7-118        AC G0QVJ9.1
#=GS F2UQH2_SALR5/2-529        AC F2UQH2.1
#=GS F6PPP6_XENTR/27-274       AC F6PPP6.1
#=GS C4JZG1_UNCRE/109-487      AC C4JZG1.1
#=GS R1EZ49_BOTPV/29-530       AC R1EZ49.1
#=GS R7VWW5_COLLI/8-540        AC R7VWW5.1
#=GS LMBD1_PYRTR/15-276        AC B2WCU2.1
#=GS W5JHZ1_ANODA/6-329        AC W5JHZ1.1
#=GS A0A044QZ47_ONCVO/8-537    AC A0A044QZ47.1
#=GS F7AR89_HORSE/265-450      AC F7AR89.1
#=GS C4J9D2_MAIZE/6-494        AC C4J9D2.1
#=GS M8CPB0_AEGTA/14-492       AC M8CPB0.1
#=GS G7N6W0_MACMU/28-281       AC G7N6W0.1
#=GS R8BMY3_TOGMI/17-520       AC R8BMY3.1
#=GS C5P2W0_COCP7/15-182       AC C5P2W0.1
#=GS W7K1J5_PLAFA/5-126        AC W7K1J5.1
#=GS G3NIH5_GASAC/228-444      AC G3NIH5.1
#=GS A2X9T7_ORYSI/6-495        AC A2X9T7.1
#=GS A0A024T918_9STRA/51-288   AC A0A024T918.1
#=GS A0A023GN30_9ACAR/17-286   AC A0A023GN30.1
#=GS H2Z9D4_CIOSA/243-523      AC H2Z9D4.1
#=GS F0ZT63_DICPU/6-515        AC F0ZT63.1
#=GS F6V418_CANFA/284-475      AC F6V418.1
#=GS H3DC77_TETNG/245-447      AC H3DC77.1
#=GS A0A034WHD1_BACDO/7-542    AC A0A034WHD1.1
#=GS S9X4V7_9TRYP/11-481       AC S9X4V7.1
#=GS I1KR08_SOYBN/6-452        AC I1KR08.2
#=GS LMBD1_MOUSE/17-292        AC Q8K0B2.1
#=GS B3L8L2_PLAKH/11-278       AC B3L8L2.1
#=GS D7L7P3_ARALL/14-489       AC D7L7P3.1
#=GS A0A024WBX3_PLAFA/5-545    AC A0A024WBX3.1
#=GS Q9H3J2_HUMAN/1-82         AC Q9H3J2.1
#=GS E1BMA6_BOVIN/235-450      AC E1BMA6.1
#=GS U4U8Y8_DENPD/8-557        AC U4U8Y8.1
#=GS G7XQX0_ASPKW/15-255       AC G7XQX0.1
#=GS J5JXJ3_BEAB2/1-353        AC J5JXJ3.1
#=GS K2R4W6_MACPH/30-531       AC K2R4W6.1
#=GS E9BLF1_LEIDB/10-489       AC E9BLF1.1
#=GS G8F4J9_MACFA/8-534        AC G8F4J9.1
#=GS G7MNJ9_MACMU/4-466        AC G7MNJ9.1
#=GS F1RBD3_DANRE/8-375        AC F1RBD3.1
#=GS K0TCE0_THAOC/27-461       AC K0TCE0.1
#=GS H2PFC4_PONAB/8-546        AC H2PFC4.1
#=GS LMBR1_HUMAN/240-445       AC Q8WVP7.1
#=GS N4XSJ6_COCH4/14-517       AC N4XSJ6.1
#=GS I1G014_AMPQE/247-468      AC I1G014.1
#=GS R4XDM8_TAPDE/8-489        AC R4XDM8.1
#=GS A0A022UWY3_TRIRU/13-517   AC A0A022UWY3.1
#=GS N4XN14_COCH4/15-272       AC N4XN14.1
#=GS E9GHZ5_DAPPU/8-546        AC E9GHZ5.1
#=GS A0A023GP34_9ACAR/9-296    AC A0A023GP34.1
#=GS L8Y929_TUPCH/407-580      AC L8Y929.1
#=GS K2MYD4_TRYCR/11-258       AC K2MYD4.1
#=GS L8G4Z0_PSED2/15-256       AC L8G4Z0.1
#=GS H3FSB7_PRIPA/1-222        AC H3FSB7.1
#=GS F1SJ09_PIG/235-450        AC F1SJ09.1
#=GS B8B1Y6_ORYSI/14-490       AC B8B1Y6.1
#=GS D8MAK8_BLAHO/1-373        AC D8MAK8.1
#=GS G9N9Q6_HYPVG/19-518       AC G9N9Q6.1
#=GS G2RES6_THITE/18-262       AC G2RES6.1
#=GS W0TBH7_KLUMA/9-498        AC W0TBH7.1
#=GS J3QM78_MOUSE/107-232      AC J3QM78.1
#=GS T5C5H0_AJEDE/20-516       AC T5C5H0.1
#=GS G3RGG6_GORGO/5-465        AC G3RGG6.1
#=GS D6X3S1_TRICA/28-484       AC D6X3S1.1
#=GS L8EWD2_STRRM/2-132        AC L8EWD2.1
#=GS F2SFI0_TRIRC/13-517       AC F2SFI0.1
#=GS A1D422_NEOFI/19-514       AC A1D422.1
#=GS G0UW29_TRYCI/8-292        AC G0UW29.1
#=GS K8EQN1_9CHLO/11-511       AC K8EQN1.1
#=GS A8Q3U1_BRUMA/204-432      AC A8Q3U1.2
#=GS V5G3B1_BYSSN/17-513       AC V5G3B1.1
#=GS W9R6J3_9ROSA/14-476       AC W9R6J3.1
#=GS V9L9Q5_CALMI/1-225        AC V9L9Q5.1
#=GS K3YQB5_SETIT/6-496        AC K3YQB5.1
#=GS C0RX82_PARBP/15-270       AC C0RX82.1
#=GS I2JSG8_DEKBR/9-492        AC I2JSG8.1
#=GS K3X7A7_PYTUL/13-237       AC K3X7A7.1
#=GS A0A017SRA6_9EURO/17-513   AC A0A017SRA6.1
#=GS M4A9N0_XIPMA/255-447      AC M4A9N0.1
#=GS A9RIF8_PHYPA/10-492       AC A9RIF8.1
#=GS W5N3Z3_LEPOC/25-273       AC W5N3Z3.1
#=GS A0A024R0Z6_HUMAN/246-445  AC A0A024R0Z6.1
#=GS M2QHC5_ENTHI/352-499      AC M2QHC5.1
#=GS A0DXE9_PARTE/7-516        AC A0DXE9.1
#=GS G3S3E0_GORGO/1-488        AC G3S3E0.1
#=GS H6C8W4_EXODN/35-276       AC H6C8W4.1
#=GS Q4Q7Q1_LEIMA/10-489       AC Q4Q7Q1.1
#=GS N1QCI8_MYCFI/16-508       AC N1QCI8.1
#=GS F6PHL3_CALJA/13-220       AC F6PHL3.1
#=GS F6VRJ9_ORNAN/8-92         AC F6VRJ9.2
#=GS H3A135_LATCH/16-291       AC H3A135.1
#=GS H9KH41_APIME/8-533        AC H9KH41.1
#=GS G8YPA2_PICSO/6-497        AC G8YPA2.1
#=GS F7G846_MACMU/20-293       AC F7G846.1
#=GS A7E370_BOVIN/8-346        AC A7E370.1
#=GS M7W3M6_ENTHI/285-454      AC M7W3M6.1
#=GS A0A022ZCB5_TRIRU/15-258   AC A0A022ZCB5.1
#=GS A0A059LHM2_9CHLO/3-373    AC A0A059LHM2.1
#=GS J3MAX0_ORYBR/18-490       AC J3MAX0.1
#=GS F7GNC9_MACMU/13-224       AC F7GNC9.1
#=GS T0S7T6_9STRA/105-356      AC T0S7T6.1
#=GS U3J8Y3_ANAPL/17-300       AC U3J8Y3.1
#=GS A0A059JPV7_TRIRU/13-517   AC A0A059JPV7.1
#=GS L5K9Q0_PTEAL/542-781      AC L5K9Q0.1
#=GS N4V7J5_COLOR/19-515       AC N4V7J5.1
#=GS K4AJH4_SETIT/114-337      AC K4AJH4.1
#=GS S8ES37_TOXGO/15-448       AC S8ES37.1
#=GS Q22CC8_TETTS/11-482       AC Q22CC8.2
#=GS A4S6J9_OSTLU/44-539       AC A4S6J9.1
#=GS B4HKE2_DROSE/7-540        AC B4HKE2.1
#=GS H2RZ81_TAKRU/8-549        AC H2RZ81.1
#=GS B9T8F4_RICCO/4-417        AC B9T8F4.1
#=GS H2U0U8_TAKRU/25-239       AC H2U0U8.1
#=GS Q4RT78_TETNG/8-226        AC Q4RT78.1
#=GS X0MFV5_FUSOX/19-520       AC X0MFV5.1
#=GS I1FMC9_AMPQE/1145-1222    AC I1FMC9.1
#=GS LMBD1_BOTFB/15-255        AC A6RN41.1
#=GS I1JLF0_SOYBN/14-489       AC I1JLF0.1
#=GS G1N7P1_MELGA/4-233        AC G1N7P1.2
#=GS S3DCK7_GLAL2/17-515       AC S3DCK7.1
#=GS K4G6K2_CALMI/14-282       AC K4G6K2.1
#=GS L9JSL5_TUPCH/215-328      AC L9JSL5.1
#=GS A0A024SIC8_HYPJE/19-518   AC A0A024SIC8.1
#=GS F1N364_BOVIN/22-430       AC F1N364.1
#=GS H9EQW3_MACMU/265-450      AC H9EQW3.1
#=GS M3YEA5_MUSPF/116-322      AC M3YEA5.1
#=GS C5FXD5_ARTOC/15-257       AC C5FXD5.1
#=GS E2R581_CANFA/8-546        AC E2R581.2
#=GS S9X2V2_9CETA/16-415       AC S9X2V2.1
#=GS H2TMI5_TAKRU/257-447      AC H2TMI5.1
#=GS D3BQK5_POLPA/278-512      AC D3BQK5.1
#=GS T1PKN2_MUSDO/8-306        AC T1PKN2.1
#=GS W6L6P6_9TRYP/11-230       AC W6L6P6.1
#=GS K9FFY9_PEND1/19-513       AC K9FFY9.1
#=GS S9UNH5_9TRYP/12-294       AC S9UNH5.1
#=GS B3RQ62_TRIAD/209-422      AC B3RQ62.1
#=GS I1G014_AMPQE/42-298       AC I1G014.1
#=GS B9HF82_POPTR/6-307        AC B9HF82.2
#=GS H0ZR81_TAEGU/19-305       AC H0ZR81.1
#=GS W0VNG7_ZYGBA/1-457        AC W0VNG7.1
#=GS K7EFA9_ORNAN/8-83         AC K7EFA9.1
#=GS B4PV42_DROYA/29-495       AC B4PV42.1
#=GS N1JIG2_BLUG1/18-535       AC N1JIG2.1
#=GS C6H1L5_AJECH/188-684      AC C6H1L5.1
#=GS I1MYP5_SOYBN/6-470        AC I1MYP5.1
#=GS W5UFQ7_ICTPU/8-548        AC W5UFQ7.1
#=GS H0WS37_OTOGA/28-268       AC H0WS37.1
#=GS Q9VC35_DROME/29-495       AC Q9VC35.1
#=GS V9IF72_APICE/8-505        AC V9IF72.1
#=GS M0XVI8_HORVD/1-242        AC M0XVI8.1
#=GS C5Z6W6_SORBI/354-424      AC C5Z6W6.1
#=GS G3J5L0_CORMM/19-518       AC G3J5L0.1
#=GS W9PW81_FUSOX/17-277       AC W9PW81.1
#=GS V8PDT8_OPHHA/158-368      AC V8PDT8.1
#=GS LMBD1_NEOFI/15-255        AC A1DB12.1
#=GS V4SG42_9ROSI/6-499        AC V4SG42.1
#=GS LMBRL_MOUSE/266-450       AC Q9D1E5.1
#=GS G5E3S8_9PIPI/1-108        AC G5E3S8.1
#=GS A0A022XHP9_TRISD/13-517   AC A0A022XHP9.1
#=GS Q28FI9_XENTR/26-258       AC Q28FI9.1
#=GS E5SAB2_TRISP/209-383      AC E5SAB2.1
#=GS D2VHA5_NAEGR/59-311       AC D2VHA5.1
#=GS I3MC97_SPETR/28-268       AC I3MC97.1
#=GS E5SQ67_TRISP/8-531        AC E5SQ67.1
#=GS M0XVI3_HORVD/1-206        AC M0XVI3.1
#=GS H9IZ10_BOMMO/4-193        AC H9IZ10.1
#=GS A0A016WZU3_9BILA/103-343  AC A0A016WZU3.1
#=GS A0A016X1Q1_9BILA/1-87     AC A0A016X1Q1.1
#=GS V7ANU4_PHAVU/14-489       AC V7ANU4.1
#=GS R0I313_9BRAS/14-489       AC R0I313.1
#=GS M5WAH9_PRUPE/14-488       AC M5WAH9.1
#=GS B7Q1Z6_IXOSC/20-279       AC B7Q1Z6.1
#=GS W2T8S1_NECAM/56-296       AC W2T8S1.1
#=GS S8EK07_9LAMI/21-513       AC S8EK07.1
#=GS A0E1B8_PARTE/11-500       AC A0E1B8.1
#=GS E9IFN2_SOLIN/86-610       AC E9IFN2.1
#=GS W9WPL0_9EURO/18-260       AC W9WPL0.1
#=GS E9DSP4_METAQ/19-518       AC E9DSP4.1
#=GS A0A023EVE3_AEDAL/27-484   AC A0A023EVE3.1
#=GS D0A2E9_TRYB9/293-457      AC D0A2E9.1
#=GS LMBR1_XENTR/243-444       AC Q5U4X7.1
#=GS X1YQ46_ANODA/18-214       AC X1YQ46.1
#=GS H2WBE1_CAEJA/36-388       AC H2WBE1.2
#=GS G1NM64_MELGA/22-300       AC G1NM64.1
#=GS J3QM78_MOUSE/210-417      AC J3QM78.1
#=GS H2TMI4_TAKRU/25-253       AC H2TMI4.1
#=GS F4X5V0_ACREC/24-485       AC F4X5V0.1
#=GS E9F792_METAR/17-279       AC E9F792.1
#=GS M8AIM6_TRIUA/7-315        AC M8AIM6.1
#=GS H0UZU8_CAVPO/237-449      AC H0UZU8.1
#=GS T1GAC9_MEGSC/1-114        AC T1GAC9.1
#=GS T1GL44_MEGSC/14-98        AC T1GL44.1
#=GS X6NMA8_RETFI/1-146        AC X6NMA8.1
#=GS G2Q1Q1_THIHA/18-259       AC G2Q1Q1.1
#=GS A0A024WTF0_PLAFA/5-545    AC A0A024WTF0.1
#=GS S8B9A4_DACHA/11-522       AC S8B9A4.1
#=GS D4DI29_TRIVH/1-396        AC D4DI29.1
#=GS I3JTT0_ORENI/19-306       AC I3JTT0.1
#=GS M2U9P3_COCH5/14-517       AC M2U9P3.1
#=GS A0A022QFE1_MIMGU/14-489   AC A0A022QFE1.1
#=GS G3Y6Z2_ASPNA/15-267       AC G3Y6Z2.1
#=GS M7B2F5_CHEMY/22-228       AC M7B2F5.1
#=GS H0YR04_TAEGU/228-439      AC H0YR04.1
#=GS E9AXJ5_LEIMU/255-458      AC E9AXJ5.1
#=GS H2M442_ORYLA/25-251       AC H2M442.1
#=GS K2NSK7_TRYCR/10-486       AC K2NSK7.1
#=GS A8HPZ9_CHLRE/48-525       AC A8HPZ9.1
#=GS B8M839_TALSN/170-657      AC B8M839.1
#=GS J7RXH6_KAZNA/5-496        AC J7RXH6.1
#=GS D0N4J7_PHYIT/8-542        AC D0N4J7.1
#=GS J9MS35_FUSO4/17-274       AC J9MS35.1
#=GS W2INK9_PHYPR/301-539      AC W2INK9.1
#=GS V5GR09_ANOGL/27-483       AC V5GR09.1
#=GS U7PPJ3_SPOS1/16-278       AC U7PPJ3.1
#=GS Q7QII1_ANOGA/28-484       AC Q7QII1.3
#=GS A0A016TBE3_9BILA/33-140   AC A0A016TBE3.1
#=GS H3C250_TETNG/265-465      AC H3C250.1
#=GS F2RUB6_TRIT1/13-515       AC F2RUB6.1
#=GS Q2HA47_CHAGB/19-518       AC Q2HA47.1
#=GS G3VSI5_SARHA/28-283       AC G3VSI5.1
#=GS M3YUD5_MUSPF/8-546        AC M3YUD5.1
#=GS B7GCP5_PHATC/12-523       AC B7GCP5.1
#=GS M2QHC5_ENTHI/1-312        AC M2QHC5.1
#=GS G6CRH8_DANPL/8-536        AC G6CRH8.1
#=GS H2TMI4_TAKRU/246-448      AC H2TMI4.1
#=GS G7N6W0_MACMU/265-450      AC G7N6W0.1
#=GS D2HWS1_AILME/174-385      AC D2HWS1.1
#=GS G3B3E8_CANTC/9-487        AC G3B3E8.1
#=GS L9L4A9_TUPCH/103-282      AC L9L4A9.1
#=GS G1TAQ0_RABIT/25-302       AC G1TAQ0.2
#=GS R0KR35_SETT2/13-517       AC R0KR35.1
#=GS A0A016X0Z7_9BILA/1-87     AC A0A016X0Z7.1
#=GS G3NXX2_GASAC/8-548        AC G3NXX2.1
#=GS Q568T3_DANRE/8-376        AC Q568T3.1
#=GS A0A059D5V1_EUCGR/14-490   AC A0A059D5V1.1
#=GS LMBD1_CHICK/17-295        AC Q5ZI05.1
#=GS H0YI83_HUMAN/1-115        AC H0YI83.1
#=GS A4I583_LEIIN/10-489       AC A4I583.1
#=GS A0CD62_PARTE/10-286       AC A0CD62.1
#=GS M0Z9W0_HORVD/1-417        AC M0Z9W0.1
#=GS B2VRI6_PYRTR/14-517       AC B2VRI6.1
#=GS F7FD35_MONDO/22-302       AC F7FD35.1
#=GS A0A024JK99_GEOCN/8-491    AC A0A024JK99.1
#=GS K7GH80_PELSI/25-274       AC K7GH80.1
#=GS J0M799_LOALO/8-537        AC J0M799.1
#=GS F6XWJ1_CANFA/29-307       AC F6XWJ1.1
#=GS K7CCW8_PANTR/28-268       AC K7CCW8.1
#=GS C4M8R3_ENTHI/2-139        AC C4M8R3.1
#=GS A3LSI8_PICST/2-497        AC A3LSI8.2
#=GS E5QYW5_ARTGP/13-220       AC E5QYW5.1
#=GS R1BPF4_EMIHU/3-296        AC R1BPF4.1
#=GS L7LY81_9ACAR/24-264       AC L7LY81.1
#=GS LMBD1_RAT/17-294          AC Q6AZ61.1
#=GS U6CW57_NEOVI/26-445       AC U6CW57.1
#=GS B6U077_MAIZE/6-389        AC B6U077.1
#=GS S9W1F2_9TRYP/172-339      AC S9W1F2.1
#=GS K4FUN0_CALMI/14-284       AC K4FUN0.1
#=GS W6KJK5_9TRYP/10-489       AC W6KJK5.1
#=GS G9K8B7_MUSPF/1-186        AC G9K8B7.1
#=GS D8QQI2_SELML/14-493       AC D8QQI2.1
#=GS LMBD1_ARATH/14-489        AC Q9SR93.2
#=GS U6I0A0_ECHMU/26-484       AC U6I0A0.1
#=GS I3JF56_ORENI/25-293       AC I3JF56.1
#=GS U3IQ77_ANAPL/4-234        AC U3IQ77.1
#=GS I3M0Z9_SPETR/8-542        AC I3M0Z9.1
#=GS G1PS18_MYOLU/209-423      AC G1PS18.1
#=GS K9F7R9_PEND1/15-255       AC K9F7R9.1
#=GS E7EXH0_DANRE/8-548        AC E7EXH0.1
#=GS K7F4P0_PELSI/1-134        AC K7F4P0.1
#=GS I1FMC9_AMPQE/755-1154     AC I1FMC9.1
#=GS B3RQ62_TRIAD/4-264        AC B3RQ62.1
#=GS O73804_TAKRU/259-466      AC O73804.1
#=GS I7LVW9_TETTS/52-589       AC I7LVW9.2
#=GS V4KN21_EUTSA/6-499        AC V4KN21.1
#=GS G1N0G8_MELGA/149-342      AC G1N0G8.2
#=GS D8UFC0_VOLCA/306-513      AC D8UFC0.1
#=GS K3XWG4_SETIT/14-490       AC K3XWG4.1
#=GS CSPLK_SELML/12-162        AC D8S072.1
#=GS X0G5F1_FUSOX/17-274       AC X0G5F1.1
#=GS K7F3C0_PELSI/17-300       AC K7F3C0.1
#=GS LMBD2_DROME/7-540         AC Q8MRQ4.2
#=GS G0QSZ4_ICHMG/1357-1461    AC G0QSZ4.1
#=GS F2E6T4_HORVD/5-307        AC F2E6T4.1
#=GS X0MUB8_FUSOX/17-277       AC X0MUB8.1
#=GS M9N1P4_ASHG1/9-469        AC M9N1P4.1
#=GS H3D5G6_TETNG/235-449      AC H3D5G6.1
#=GS R7TKT9_CAPTE/2-152        AC R7TKT9.1
#=GS G0TSF7_TRYVY/12-241       AC G0TSF7.1
#=GS W6UUE0_ECHGR/26-349       AC W6UUE0.1
#=GS L8IJ80_9CETA/1-276        AC L8IJ80.1
#=GS H2QT95_PANTR/20-293       AC H2QT95.1
#=GS A5DQV4_PICGU/8-488        AC A5DQV4.2
#=GS Q4RW17_TETNG/14-223       AC Q4RW17.1
#=GS H2M441_ORYLA/229-446      AC H2M441.1
#=GS V8P5A7_OPHHA/68-581       AC V8P5A7.1
#=GS R0KDT8_SETT2/15-257       AC R0KDT8.1
#=GS H3AKE0_LATCH/217-440      AC H3AKE0.2
#=GS M4CAV7_BRARP/14-489       AC M4CAV7.1
#=GS K9IKJ9_DESRO/28-268       AC K9IKJ9.1
#=GS B3DL13_XENTR/8-563        AC B3DL13.1
#=GS F1PDI3_CANFA/26-280       AC F1PDI3.2
#=GS F7HSP6_MACMU/102-284      AC F7HSP6.1
#=GS W6QID7_PENRO/15-269       AC W6QID7.1
#=GS E5SAB2_TRISP/20-200       AC E5SAB2.1
#=GS W5PQV2_SHEEP/19-300       AC W5PQV2.1
#=GS S4P3U3_9NEOP/8-151        AC S4P3U3.1
#=GS M7T9P3_EUTLA/18-277       AC M7T9P3.1
#=GS G3P315_GASAC/249-472      AC G3P315.1
#=GS F1N242_BOVIN/8-546        AC F1N242.2
#=GS F6ST68_CALJA/20-294       AC F6ST68.1
#=GS LMBD3_SELML/1-382         AC D8TFA8.2
#=GS H2M3A9_ORYLA/26-434       AC H2M3A9.1
#=GS W5L0L8_ASTMX/234-446      AC W5L0L8.1
#=GS G0ME02_CAEBE/70-691       AC G0ME02.1
#=GS A0A059ALN0_EUCGR/6-492    AC A0A059ALN0.1
#=GS B2AVS6_PODAN/22-531       AC B2AVS6.1
#=GS E9BRP4_LEIDB/11-223       AC E9BRP4.1
#=GS G7J381_MEDTR/6-496        AC G7J381.1
#=GS K7HV65_CAEJA/2-129        AC K7HV65.1
#=GS F7EIN7_MACMU/28-274       AC F7EIN7.1
#=GS V5I8M1_ANOGL/27-483       AC V5I8M1.1
#=GS L1IJC7_GUITH/8-322        AC L1IJC7.1
#=GS W4I9X9_PLAFA/1-192        AC W4I9X9.1
#=GS M3YT49_MUSPF/28-266       AC M3YT49.1
#=GS J9IUZ8_9SPIT/1-329        AC J9IUZ8.1
#=GS I1KKE6_SOYBN/14-489       AC I1KKE6.1
#=GS F4PUU1_DICFS/12-493       AC F4PUU1.1
#=GS H0VSI2_CAVPO/16-288       AC H0VSI2.1
#=GS H2M439_ORYLA/42-249       AC H2M439.1
#=GS G0U669_TRYVY/294-459      AC G0U669.1
#=GS E1ZGP1_CHLVA/8-495        AC E1ZGP1.1
#=GS U6GHR8_EIMAC/11-415       AC U6GHR8.1
#=GS W7FM26_PLAFA/5-545        AC W7FM26.1
#=GS W5N502_LEPOC/238-562      AC W5N502.1
#=GS X0IVX2_FUSOX/17-279       AC X0IVX2.1
#=GS LMBRL_XENLA/231-448       AC Q7ZX75.1
#=GS F1SJ09_PIG/28-264         AC F1SJ09.1
#=GS F6TEM6_XENTR/4-234        AC F6TEM6.1
#=GS V9KIQ8_CALMI/8-548        AC V9KIQ8.1
#=GS G0RTI3_HYPJQ/16-276       AC G0RTI3.1
#=GS I1EIQ5_AMPQE/42-254       AC I1EIQ5.1
#=GS K3VPU8_FUSPC/18-274       AC K3VPU8.1
#=GS LMBD1_ASPOR/15-255        AC Q2TZ20.1
#=GS Q29C08_DROPS/28-491       AC Q29C08.2
#=GS W2WQZ0_PHYPR/254-492      AC W2WQZ0.1
#=GS V8PDT8_OPHHA/2-150        AC V8PDT8.1
#=GS G3RX49_GORGO/22-295       AC G3RX49.1
#=GS G8ZNA0_TORDC/5-508        AC G8ZNA0.1
#=GS W2N334_PHYPR/13-276       AC W2N334.1
#=GS LMBRL_DANRE/234-446       AC Q803C7.1
#=GS W2PZ14_PHYPN/254-492      AC W2PZ14.1
#=GS M2YNP6_MYCFI/15-262       AC M2YNP6.1
#=GS R9XEJ9_ASHAC/9-469        AC R9XEJ9.1
#=GS R7U746_CAPTE/25-263       AC R7U746.1
#=GS G3P330_GASAC/230-448      AC G3P330.1
#=GS B4PUN1_DROYA/7-540        AC B4PUN1.1
#=GS B6H1T5_PENCW/19-513       AC B6H1T5.1
#=GS F6SRG2_CALJA/8-546        AC F6SRG2.1
#=GS M4FSI9_MAGP6/31-537       AC M4FSI9.1
#=GS A0A024XC00_PLAFC/5-545    AC A0A024XC00.1
#=GS S4P1V9_9NEOP/1-71         AC S4P1V9.1
#=GS A0A022WRC2_TRIRU/15-258   AC A0A022WRC2.1
#=GS S2J6P5_MUCC1/31-527       AC S2J6P5.1
#=GS A9THA1_PHYPA/11-494       AC A9THA1.1
#=GS I2H951_TETBL/7-520        AC I2H951.1
#=GS LMBD2_SELML/181-264       AC D8S067.1
#=GS D8RQN1_SELML/13-494       AC D8RQN1.1
#=GS C6KT24_PLAF7/5-545        AC C6KT24.1
#=GS M3XAG4_FELCA/8-546        AC M3XAG4.1
#=GS F6YTE9_XENTR/241-458      AC F6YTE9.1
#=GS D3BQG9_POLPA/669-1113     AC D3BQG9.1
#=GS A0A022YGG5_TRIRU/15-258   AC A0A022YGG5.1
#=GS M2N898_BAUCO/15-274       AC M2N898.1
#=GS K7F4P0_PELSI/107-324      AC K7F4P0.1
#=GS H2U0U9_TAKRU/21-272       AC H2U0U9.1
#=GS E9H8R7_DAPPU/243-453      AC E9H8R7.1
#=GS B8CB15_THAPS/9-584        AC B8CB15.1
#=GS D8S070_SELML/148-313      AC D8S070.1
#=GS LMBD1_AJECN/15-256        AC A6QTW5.1
#=GS L5L5P9_PTEAL/91-361       AC L5L5P9.1
#=GS K1PRK7_CRAGI/50-427       AC K1PRK7.1
#=GS F4WJT5_ACREC/8-532        AC F4WJT5.1
#=GS N6T715_DENPD/12-203       AC N6T715.1
#=GS A8NST7_BRUMA/250-438      AC A8NST7.1
#=GS LMBD1_SELML/213-321       AC D8TFB0.1
#=GS W2SAP8_9EURO/13-501       AC W2SAP8.1
#=GS L5LZ65_MYODS/8-546        AC L5LZ65.1
#=GS I3L6V2_PIG/31-203         AC I3L6V2.1
#=GS I1N2X4_SOYBN/14-489       AC I1N2X4.1
#=GS LMBD1_XENTR/17-295        AC Q0VGV9.1
#=GS W8C1P1_CERCA/7-542        AC W8C1P1.1
#=GS H2TMI6_TAKRU/25-262       AC H2TMI6.1
#=GS M0XVI6_HORVD/1-99         AC M0XVI6.1
#=GS G1S839_NOMLE/28-266       AC G1S839.1
#=GS LMBD2_CAEEL/8-528         AC Q18695.1
#=GS A5K824_PLAVS/3-240        AC A5K824.1
#=GS G3VS13_SARHA/8-543        AC G3VS13.1
#=GS E3LFC1_CAERE/8-544        AC E3LFC1.1
#=GS A8I062_CHLRE/7-105        AC A8I062.1
#=GS H3D5G6_TETNG/25-262       AC H3D5G6.1
#=GS W5NKC1_LEPOC/18-295       AC W5NKC1.1
#=GS G3AJ97_SPAPN/1-447        AC G3AJ97.1
#=GS H2RZ80_TAKRU/8-562        AC H2RZ80.1
#=GS W7XH58_TETTS/265-472      AC W7XH58.1
#=GS F0V8P3_NEOCL/11-512       AC F0V8P3.1
#=GS F7AR89_HORSE/28-275       AC F7AR89.1
#=GS J9IUZ8_9SPIT/318-427      AC J9IUZ8.1
#=GS D8UFC0_VOLCA/1-254        AC D8UFC0.1
#=GS W2N334_PHYPR/254-492      AC W2N334.1
#=GS G9K8B6_MUSPF/1-143        AC G9K8B6.1
#=GS LMBD1_HUMAN/20-293        AC Q9NUN5.1
#=GS E2A3U5_CAMFO/4-468        AC E2A3U5.1
#=GS Q6CIE0_KLULA/8-490        AC Q6CIE0.1
#=GS F7A4I2_MONDO/26-275       AC F7A4I2.1
#=GS U3JWP7_FICAL/25-268       AC U3JWP7.1
#=GS S3CDR0_GLAL2/15-258       AC S3CDR0.1
#=GS F6VVU8_MACMU/8-546        AC F6VVU8.1
#=GS S9V4V8_9TRYP/11-481       AC S9V4V8.1
#=GS B0XPH0_ASPFC/19-514       AC B0XPH0.1
#=GS F6TRU8_XENTR/8-563        AC F6TRU8.1
#=GS S9UHX5_9TRYP/70-282       AC S9UHX5.1
#=GS A5E722_LODEL/7-467        AC A5E722.1
#=GS G0QVG7_ICHMG/541-714      AC G0QVG7.1
#=GS B0EGV3_ENTDS/12-180       AC B0EGV3.1
#=GS K7LXY2_SOYBN/5-440        AC K7LXY2.1
#=GS F1P229_CHICK/215-432      AC F1P229.2
#=GS W2TPY9_NECAM/39-508       AC W2TPY9.1
#=GS C5JXW4_AJEDS/93-589       AC C5JXW4.1
#=GS G8JPW9_ERECY/11-500       AC G8JPW9.1
#=GS F0VMQ1_NEOCL/269-706      AC F0VMQ1.1
#=GS C3YM55_BRAFL/6-551        AC C3YM55.1
#=GS G1PS18_MYOLU/4-262        AC G1PS18.1
#=GS R7UVW1_CAPTE/8-539        AC R7UVW1.1
#=GS G3RZN2_GORGO/4-464        AC G3RZN2.1
#=GS W2Y922_PHYPR/15-315       AC W2Y922.1
#=GS S7Q1C5_MYOBR/239-449      AC S7Q1C5.1
#=GS S9TV07_9TRYP/297-464      AC S9TV07.1
#=GS F7HAZ6_MACMU/28-272       AC F7HAZ6.1
#=GS G9K8C2_MUSPF/1-84         AC G9K8C2.1
#=GS M1VWD1_CLAP2/19-524       AC M1VWD1.1
#=GS A2DVC1_TRIVA/11-482       AC A2DVC1.1
#=GS T1J750_STRMM/17-554       AC T1J750.1
#=GS I1K4H0_SOYBN/39-108       AC I1K4H0.1
#=GS G1N7N7_MELGA/8-168        AC G1N7N7.1
#=GS W4J1K4_PLAFP/10-226       AC W4J1K4.1
#=GS B3S194_TRIAD/22-149       AC B3S194.1
#=GS B3P6Y5_DROER/29-495       AC B3P6Y5.1
#=GS K9IU82_DESRO/17-289       AC K9IU82.1
#=GS G1MA14_AILME/19-300       AC G1MA14.1
#=GS I8TEV8_ASPO3/17-512       AC I8TEV8.1
#=GS S9R0Z0_SCHOY/4-440        AC S9R0Z0.1
#=GS G9PBM0_HYPAI/17-261       AC G9PBM0.1
#=GS LMBRL_HUMAN/28-268        AC Q6UX01.2
#=GS H2RTB6_TAKRU/1-355        AC H2RTB6.1
#=GS LMBD2_CAEBR/8-528         AC Q61ZW5.1
#=GS H2NH57_PONAB/28-268       AC H2NH57.1
#=GS M8BPE8_AEGTA/81-531       AC M8BPE8.1
#=GS L5JN34_PTEAL/1-279        AC L5JN34.1
#=GS C1EEU0_MICSR/16-472       AC C1EEU0.1
#=GS W5GIV1_WHEAT/1-97         AC W5GIV1.1
#=GS K0RHA4_THAOC/9-131        AC K0RHA4.1
#=GS W0W5E1_ZYGBA/2-460        AC W0W5E1.1
#=GS W5MLV2_LEPOC/26-258       AC W5MLV2.1
#=GS H9EQW3_MACMU/28-281       AC H9EQW3.1
#=GS F1PDI3_CANFA/241-445      AC F1PDI3.2
#=GS A7TBJ7_NEMVE/1-92         AC A7TBJ7.1
#=GS E9BRP4_LEIDB/191-429      AC E9BRP4.1
#=GS H2PP58_PONAB/240-445      AC H2PP58.2
#=GS S9VAI4_9TRYP/298-464      AC S9VAI4.1
#=GS W5PAW8_SHEEP/216-423      AC W5PAW8.1
#=GS A0CGJ5_PARTE/7-475        AC A0CGJ5.1
#=GS F2CR18_HORVD/14-492       AC F2CR18.1
#=GS A0A015LE47_9GLOM/14-245   AC A0A015LE47.1
#=GS A0CND7_PARTE/32-435       AC A0CND7.1
#=GS H3GLP4_PHYRM/254-492      AC H3GLP4.1
#=GS H9GER8_ANOCA/11-516       AC H9GER8.2
#=GS D8SJB6_SELML/7-486        AC D8SJB6.1
#=GS A0E1B4_PARTE/264-477      AC A0E1B4.1
#=GS U6KYM7_EIMTE/12-394       AC U6KYM7.1
#=GS N1QEL4_SPHMS/15-260       AC N1QEL4.1
#=GS F4KHW8_ARATH/6-499        AC F4KHW8.1
#=GS W9KSJ6_FUSOX/19-520       AC W9KSJ6.1
#=GS H9GMJ5_ANOCA/4-225        AC H9GMJ5.1
#=GS C4QWM7_PICPG/7-468        AC C4QWM7.1
#=GS U6PCU6_HAECO/8-525        AC U6PCU6.1
#=GS F2QP02_PICP7/7-468        AC F2QP02.1
#=GS M4ELR2_BRARP/14-489       AC M4ELR2.1
#=GS B4QWM9_DROSI/7-540        AC B4QWM9.1
#=GS CSPLJ_SELML/4-184         AC D8RQM9.1
#=GS D5GHQ4_TUBMM/14-248       AC D5GHQ4.1
#=GS F6QP61_ORNAN/18-300       AC F6QP61.1
#=GS F1MNF0_BOVIN/26-444       AC F1MNF0.2
#=GS B6ABV5_CRYMR/8-542        AC B6ABV5.1
#=GS E9B5Q0_LEIMU/11-224       AC E9B5Q0.1
#=GS LMBD1_BOVIN/22-430        AC Q3SYY9.1
#=GS K6ZBT3_PANTR/26-281       AC K6ZBT3.1
#=GS S9V024_9TRYP/146-376      AC S9V024.1
#=GS W8CB69_CERCA/28-492       AC W8CB69.1
#=GS B7Z633_HUMAN/24-240       AC B7Z633.1
#=GS W4H1U7_9STRA/10-507       AC W4H1U7.1
#=GS D3B509_POLPA/446-519      AC D3B509.1
#=GS I3MC97_SPETR/264-449      AC I3MC97.1
#=GS M4E6H1_BRARP/6-517        AC M4E6H1.1
#=GS LMBD2_SELML/5-183         AC D8S067.1
#=GS D2V349_NAEGR/310-482      AC D2V349.1
#=GS C6HG11_AJECH/15-257       AC C6HG11.1
#=GS A0A023A718_TRIRU/15-258   AC A0A023A718.1
#=GS G4VF28_SCHMA/29-548       AC G4VF28.1
#=GS LMBD2_ARATH/14-489        AC Q9M028.1
#=GS U3IIF8_ANAPL/8-540        AC U3IIF8.1
#=GS G0MVB5_CAEBE/8-528        AC G0MVB5.1
#=GS F8MNB1_NEUT8/18-521       AC F8MNB1.1
#=GS G7MPP4_MACMU/20-297       AC G7MPP4.1
#=GS F1KV17_ASCSU/3-543        AC F1KV17.1
#=GS W5QC73_SHEEP/46-291       AC W5QC73.1
#=GS G3PJK1_GASAC/8-544        AC G3PJK1.1
#=GS M3UKL4_ENTHI/1-39         AC M3UKL4.1
#=GS M3Y2U5_MUSPF/23-300       AC M3Y2U5.1
#=GS V9KSZ6_CALMI/198-385      AC V9KSZ6.1
#=GS G1L3R5_AILME/6-263        AC G1L3R5.1
#=GS LMBD2_XENLA/8-563         AC Q7ZYA0.1
#=GS U1MHK2_ASCSU/27-284       AC U1MHK2.1
#=GS W5K7B3_ASTMX/1-72         AC W5K7B3.1
#=GS K3VUN5_FUSPC/19-518       AC K3VUN5.1
#=GS G0TSF7_TRYVY/233-456      AC G0TSF7.1
#=GS LMBD2_HUMAN/8-546         AC Q68DH5.1
#=GS U5GEL0_POPTR/6-495        AC U5GEL0.1
#=GS M2SL05_COCSN/15-272       AC M2SL05.1
#=GS A0A016WPM1_9BILA/8-240    AC A0A016WPM1.1
#=GS LMBD1_ORYSJ/14-490        AC Q658I5.1
#=GS H9IZ11_BOMMO/41-309       AC H9IZ11.1
#=GS LMBD1_CHAGB/18-259        AC Q2HDJ0.1
#=GS J3NHU8_GAGT3/16-276       AC J3NHU8.1
#=GS C9ZQL2_TRYB9/1-408        AC C9ZQL2.1
#=GS W9PWC0_FUSOX/19-520       AC W9PWC0.1
#=GS K9IMD5_DESRO/8-546        AC K9IMD5.1
#=GS T1HA65_RHOPR/303-425      AC T1HA65.1
#=GS T4ZYV6_OPHSC/24-285       AC T4ZYV6.1
#=GS A8K4S2_HUMAN/240-445      AC A8K4S2.1
#=GS A0A024JIR3_GEOCN/7-485    AC A0A024JIR3.1
#=GS V4MIX9_EUTSA/5-419        AC V4MIX9.1
#=GS F4P8T4_BATDJ/12-362       AC F4P8T4.1
#=GS W5NKC4_LEPOC/21-296       AC W5NKC4.1
#=GS W7X5T3_TETTS/307-479      AC W7X5T3.1
#=GS H0V0J6_CAVPO/4-259        AC H0V0J6.1
#=GS E4UXR9_ARTGP/15-281       AC E4UXR9.1
#=GS V6TAI1_GIAIN/14-475       AC V6TAI1.1
#=GS S4R8I7_PETMA/201-400      AC S4R8I7.1
#=GS LMBRL_MACFA/265-450       AC Q4R7X9.1
#=GS LMBR1_CHICK/25-283        AC Q7ZUA6.1
#=GS G8C0P7_TETPH/6-504        AC G8C0P7.1
#=GS U6LIJ2_9EIME/12-363       AC U6LIJ2.1
#=GS W5LBE5_ASTMX/15-150       AC W5LBE5.1
#=GS F7C7Y6_CALJA/24-261       AC F7C7Y6.1
#=GS L8GZR6_ACACA/44-249       AC L8GZR6.1
#=GS G3SNN3_LOXAF/19-294       AC G3SNN3.1
#=GS H6WB98_VAULI/4-495        AC H6WB98.1
#=GS L5K9Q0_PTEAL/846-909      AC L5K9Q0.1
#=GS H2YCN2_CIOSA/8-468        AC H2YCN2.1
#=GS C3Z9N3_BRAFL/28-318       AC C3Z9N3.1
#=GS M4EST8_BRARP/6-499        AC M4EST8.1
#=GS Q9XZ04_DROME/29-495       AC Q9XZ04.1
#=GS G9K8B8_MUSPF/268-474      AC G9K8B8.1
#=GS M3YT49_MUSPF/258-450      AC M3YT49.1
#=GS D7FY43_ECTSI/18-548       AC D7FY43.1
#=GS W7HME3_9PEZI/15-199       AC W7HME3.1
#=GS LMBD1_DANRE/18-306        AC Q5PR61.1
#=GS U1MHK2_ASCSU/302-466      AC U1MHK2.1
#=GS F4PEK0_BATDJ/13-300       AC F4PEK0.1
#=GS X0ABL4_FUSOX/19-520       AC X0ABL4.1
#=GS F7VUP2_SORMK/24-296       AC F7VUP2.1
#=GS A1CR57_ASPCL/19-514       AC A1CR57.1
#=GS G0R5W2_ICHMG/13-470       AC G0R5W2.1
#=GS F7HSP4_MACMU/232-425      AC F7HSP4.1
#=GS V4LFC8_EUTSA/14-489       AC V4LFC8.1
#=GS G0R578_ICHMG/1-123        AC G0R578.1
#=GS R0G8U5_9BRAS/6-499        AC R0G8U5.1
#=GS I1GZQ8_BRADI/5-511        AC I1GZQ8.1
#=GS D0A2E9_TRYB9/11-291       AC D0A2E9.1
#=GS B1N587_ENTHI/1-92         AC B1N587.1
#=GS F0YMP9_AURAN/136-303      AC F0YMP9.1
#=GS A0A044UVD0_ONCVO/26-265   AC A0A044UVD0.1
#=GS D8LZG0_BLAHO/1-101        AC D8LZG0.1
#=GS A0A022TCC4_TRIRU/13-517   AC A0A022TCC4.1
#=GS A0A024UQP0_9STRA/261-506  AC A0A024UQP0.1
#=GS X6NGI6_RETFI/19-454       AC X6NGI6.1
#=GS H2XUT2_CIOIN/1-203        AC H2XUT2.1
#=GS Q6BPU1_DEBHA/3-499        AC Q6BPU1.2
#=GS V5GXP4_IXORI/1-226        AC V5GXP4.1
#=GS W9CMI7_9HELO/19-518       AC W9CMI7.1
#=GS S7Z799_PENO1/15-254       AC S7Z799.1
#=GS A0A022XKP6_TRISD/15-271   AC A0A022XKP6.1
#=GS G1L3R5_AILME/232-425      AC G1L3R5.1
#=GS F6X3W7_ORNAN/3-467        AC F6X3W7.1
#=GS T5AL20_OPHSC/13-329       AC T5AL20.1
#=GS W5K3G8_ASTMX/25-285       AC W5K3G8.1
#=GS U3JBQ9_FICAL/4-234        AC U3JBQ9.1
#=GS K6UDX7_9APIC/13-563       AC K6UDX7.1
#=GS D8S070_SELML/1-148        AC D8S070.1
#=GS G7XSP7_ASPKW/17-512       AC G7XSP7.1
#=GS E7F4M0_DANRE/228-446      AC E7F4M0.1
#=GS W2YY79_PHYPR/13-276       AC W2YY79.1
#=GS C4M0X4_ENTHI/13-283       AC C4M0X4.1
#=GS F7CR58_HORSE/8-545        AC F7CR58.1
#=GS A4HI06_LEIBR/10-489       AC A4HI06.1
#=GS L5L5P9_PTEAL/321-523      AC L5L5P9.1
#=GS V7B442_PHAVU/14-489       AC V7B442.1
#=GS M4AR29_XIPMA/8-542        AC M4AR29.1
#=GS W7F2F5_COCVI/15-272       AC W7F2F5.1
#=GS E9AXJ5_LEIMU/8-286        AC E9AXJ5.1
#=GS M1W5S0_CLAP2/17-259       AC M1W5S0.1
#=GS F1M770_RAT/244-445        AC F1M770.2
#=GS W2WQZ0_PHYPR/13-276       AC W2WQZ0.1
#=GS C1MYJ1_MICPC/13-494       AC C1MYJ1.1
#=GS I3K2D5_ORENI/254-447      AC I3K2D5.1
#=GS Q4RQ90_TETNG/17-299       AC Q4RQ90.1
#=GS S8ADD6_DACHA/15-250       AC S8ADD6.1
#=GS E9AEI9_LEIMA/11-223       AC E9AEI9.1
#=GS H3DED4_TETNG/8-548        AC H3DED4.1
#=GS G5AU28_HETGA/28-273       AC G5AU28.1
#=GS W2HYM8_PHYPR/15-315       AC W2HYM8.1
#=GS W2INK9_PHYPR/60-322       AC W2INK9.1
#=GS H2RV14_TAKRU/8-126        AC H2RV14.1
#=GS W9WI40_9EURO/13-508       AC W9WI40.1
#=GS L8H6Q8_ACACA/6-496        AC L8H6Q8.1
#=GS E4YDH3_OIKDI/8-540        AC E4YDH3.1
#=GS G7PHS1_MACFA/28-281       AC G7PHS1.1
#=GS A0E1B4_PARTE/11-307       AC A0E1B4.1
#=GS I1RSW7_GIBZE/25-524       AC I1RSW7.1
#=GS D6X0Q3_TRICA/9-535        AC D6X0Q3.1
#=GS H2N1Q1_ORYLA/8-142        AC H2N1Q1.1
#=GS U3JWP7_FICAL/227-445      AC U3JWP7.1
#=GS R0KLI6_ANAPL/251-449      AC R0KLI6.1
#=GS W6YQK6_COCCA/14-517       AC W6YQK6.1
#=GS X0GE00_FUSOX/19-520       AC X0GE00.1
#=GS D8UDB0_VOLCA/21-500       AC D8UDB0.1
#=GS B6Q645_PENMQ/27-523       AC B6Q645.1
#=GS Q22WA5_TETTS/7-500        AC Q22WA5.2
#=GS W7TQL5_9STRA/1-94         AC W7TQL5.1
#=GS F4PR48_DICFS/292-482      AC F4PR48.1
#=GS Y3610_DICDI/12-493        AC Q54BI3.1
#=GS W2PXP7_PHYPN/8-540        AC W2PXP7.1
#=GS I0YK80_9CHLO/97-267       AC I0YK80.1
#=GS F1SNB8_PIG/8-546          AC F1SNB8.1
#=GS F9FB97_FUSOF/19-520       AC F9FB97.1
#=GS M3YEA5_MUSPF/1-157        AC M3YEA5.1
#=GS J9MH08_FUSO4/1-353        AC J9MH08.1
#=GS N9UU44_ENTHI/7-366        AC N9UU44.1
#=GS J9IT80_9SPIT/1-451        AC J9IT80.1
M7U7V2_BOTF1/18-517                  ............................................................................................................i-ALLVISLVVLL.I......LRHY..LPI...R...TTPA....................................................YLLVPIFFAL..WLPASIVL.LVPIDLAS..NARTED...Ags.............................................................................................................................................................rgI-----.-..WL....Y...D.....R.V.LL.VA...WRITYWLTFALTW................FI..LP.ILA.E....Y....A........D........A.......G..Y...R....D.P.KG...................................................RLL.F....SLRA..N...A...QYQA..L...I..L..GA..GL.AT..ML.........YIFI.K.-.EG.VSPE......S............................................................................................................LKSVVM..AL..AYCW.G.L.VLA....IYLMGHG.LVAI.......................................PRNLFR...................NA.SIS..GKLRRIQTR..AP..KVH...EN..MEE.A.I...QKLED...LE...AQVAQ.L.AQR.K..T.GTA...................................................................RDFK..DW.IEELADe........................................................................................................................................tHL..PE.S..RP.R.TLSRRMSE.PHA..TIP---..-NV....................................iTERYLADLS.R.QL.............................................TR.ARHSRARYLD.EWD...RLLKDA..VHTQ....................................................................................................................TVLDSAASKkieigqssph.............................................................................................................................ssafdritifTPHTRYLY.Q..YF...F...L...PYSK....IV....LG....VV.L.T.LASICIIWSEFI..KSI........................................................-NP..IF....SI.IA.V...TV..V..H.H..R.DS.EK..G.EIGFa......gQVIASF....WI.L..Y..M...C.AA.ALSSLS....EVKV....WR................G.R.ALVR...-RNTHGE..AAMWFAMQ......VAKLSV...P.LS....FNF.I..TFL.PPDVYK.......................................KTMF.YKFLG....K.lIVF........T...P-....LG..DWFD....WF...FP.IFIL.VPVFATLF...................................................................................................................................................................................................................
E9BHM4_LEIDB/298-458                 .........................................................................................................pfiv------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...-YGK....LA....LG....VV.C.I.VTAIMWCLQIFV..YN-........................................................-TF..DA....DP.FL.N...TL..L..L.R..L.NN.AF..A.LCGV........-CAYGV....LA.F..Y..L...T.WS.TFQGQI....ALGL...rLV................F.F.QIHPm.kKHDTLVN..AFLFNVSL......LLITSY...A.VI....YFV.V..HSF.QD-YAT.......................................MTAI.NGLMN....V.fVTR........L...RG....IG..-VFI....RW...AQ.FCFL.GMSLLT--li.................................................................................................................................................................................................................
A0A059LEH9_9CHLO/66-222              .........................................................................................................vsmg----LVLGIVIS.M......ISRY..AA-...P...KVSI....................................................LTLGVTTVAW..LMSLSVLA.LVPLDVWA..ALSGGA...S................................................................................................................................................................aR-----.-..--....D...E.....Q.V.LG.VL...WTVSYWSTQGLTW................AA..IP.VLQ.Y....Y....S........L........S.......G..A...F....T.I.FG...................................................RLR.H....ALFR..L...W...VFYA..V...V..L..AL..CV.AG..VL.........-VAL.G.S.GR.LRLR......T............................................................................................................LPTLLI..TL..SNTY.G.L.ICI....IVA----.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------l..................................................................................................................................................................................................................
C1H239_PARBA/15-177                  ............................................................................................................i-VVVILIAVASI.F......FYVY..QTP...R...ERSA....................................................YVTAVCIFTL..TALLATVL.LLPVDVAL..VSSTTS..sKqgr..........................................................................................................................................................rkpwATQDEV.D..KI....T...Y.....S.L.T-.VV...YYSLYSLDAVLCL................LV..VP.FTY.F....W....Y........E........E.......Y..D...E....V.A.AEeg...............................................lqTWG.K....RFRG..A...F...KYTI..A...F..I..LF..AV.TL..FL.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------vgffvpvarnreapnfdldy...............................................................................................................................................................................................
A2YAR5_ORYSI/7-220                   .....................................................................................................vslpltlg--------MVVA.T......LRYF..AG-...P...AVPL....................................................HVLATVGYAW..LCSLSFIV.LVPADIST..-VRSRR...Aiphsptdy.................................................................................................................................................clelsfccA-----.-..--....G...A.....S.C.RA.AL...WNLVTVWAFGNLFvcilgf....nrefgrSI..VP.TLQ.G....Y....E........D........A.......G..D...F....T.V.KE...................................................RLK.T....SIHK..N...L...VYYK..I...I..G..SI..GL.VG..II.........LIIT.M.R.HD.WPRSl....pStarrdatraaaa...................................................................................aaetaareiagemWAFYLL..SL..PLTV.G.M.VVA....T------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lryfag.............................................................................................................................................................................................................
U6IIN3_HYMMI/1-463                   .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.--M.S....Y....A........D........S.......G..E...F....T.V.LR...................................................KFR.S....AVVD..N...A...IIYG..T...Y..L..LI..FV.CV..MI.........YLFV.KrT.IS.FNVS......A............................................................................................................LKLLLI..TT..SNTW.G.L.FLV....ILFLGYG.LVEV.......................................PRSIYR...................FA.CPD..NRLRFAYFT..LS..KRY...LE..YIE.D.E...EELKT...VL...AEIHD.L.DQH.V..G.PDH...................................................................P-LR..SR.FNIIVAkvm....................................................................................................................................tigEI..GA.A..IR.P.NRRGNLSE.NSG..ASISA-..--Hs...................................lTLKRLVKLH.N.RL.............................................KR.AYHHCSRARA.LWI...VALQSA..ADAE....................................................................................................................DVFNNCIAGsfrvfehgptpavltsiv............................................................................................................atpkpsnmcarltgvagvrARSAEWYW.K..CK...V...E...PLLL....KI....VA....FL.L.A.AASFLIVWSECT..FFV........................................................RNP..RL....SI.IA.A...IL..-..H.S..R.PT.IL..E.YNLV........SFVCFL....FL.D..Y..L...A.FC.VCFATY....RLRF....FN................Y.Y.RVVP...NHHSDAI..SLIFYGSM......LCRLFP...S.LC....VNF.L..CLA.HLDSHVlqnstllstkiaqnst.......asdlsletlvtgsvvyETAF.TKFMG....H..LDV........V...SF....IA..NGFN....VY...FP.MVVV.VLCLVTFF...................................................................................................................................................................................................................
W5HIL5_WHEAT/2-365                   ......................................................................................................hhdwgga------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................ILGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKDIWR...................NA.DWT..RRQKILSHM..VA..KMT...VK..LDN.A.R...QEYCN...AI...TVVQA.T.SKQ.M..S.KRD...................................................................P-LR..PF.MDIIDN..........................................................................................................................................ML..AQ.M..LR.D.DPLFKLSG.GNK..LAENDM.dYDT.....................................DEKTMAALR.R.RL.............................................RI.AHEEYCRCKS.KYT...TSVMEA..LELE....................................................................................................................DTVTNYEQHdadgwkyvsdl...........................................................................................................................resrsgtlgsfLDHIEFIW.R..CI...L...L...NRLL....KV....LS....VL.L.G.CISAAILLAEAT..LLP........................................................TGV..HL....SL.FS.V...LI..-..N.A..A.GK.QE..-.-ILV........QVVAFA....PL.M..Y..M...C.IC.TYYPLF....RIGM....MV................V.Y.SLTP...-GQTSSV..SLLMICSM......VARYAP...A.IS....YNF.L..NLV.HLGGDV.......................................RTTF.EKRMG....S.iDDA........V...PF....FG..RNFN....RI...YP.LIMV.VYTI----lva................................................................................................................................................................................................................
A0A024TJW4_9STRA/7-535               ...........................................................................................................te--CIMLFLFTGA.L......LHYY..KD-...P...HVGY....................................................LVYSFVFMSW..YAGFLGLL.MLPVDISA..TLAARI..gA.................................................................................................................................................................-SSQPL.H..-V....H...T.....S.-.LL.TG...WKVLYWLTFMFSW................VV..LP.VLI.E....Y....S........Q........S.......G..A...F....T.P.QQ...................................................KLH.A....SIRY..L...L...RHYA..I...L..L..AA..GV.AL..VM.........YLIV.V.-.DH.LTLS......G............................................................................................................IVGLAM..TV..ANTY.G.L.LWL....IGLLGYG.VVNV.......................................PRNVWR...................TA.NPH..DRLRRIYFR..AI..QIH...DD..RVE.A.M...FTYDD...VI...RDVQD.L.MRR.F..Q.AIEqst............................................................iiltPDMQ..-H.IKQCLRhvaatlghdgg....................................................................................................................vadddletgssK-..--.R..AS.R.RSKHALRP.PSS..S-----..SKMlvle............................dtslpSEADVILLH.G.RV.............................................KR.ILADLRRCEQ.AWQ...DVCWSA..QRLI....................................................................................................................QWIDQTEQLhasgaptp.................................................................................................................................sttrpmsvTEWFSSWT.A..HA...M...W...TYAI....GA....AT....AC.C.V.FGSAIVLWSEVF..MGA........................................................-SP..RW....SP.LG.Q...LL..A..A.A..A.TS.SE..P.PTSGal....svQLVLLA....LL.T..Y..M...G.TC.VYQSLF....SIRG....FG................R.V.ALHG...AHNSTEL..SLLTAAIQ......QCRLQF...S.LG....YNF.C..LLL.NRHDLT......................................dYASF.HTLFT....D..MRV........I...HF....FG..TDFN....VY...LP.MCMV.VVAATTM-w..................................................................................................................................................................................................................
H2RTB5_TAKRU/1-355                   .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..--TL.G.P.VLL....VLLLGYG.LVEI.......................................PRSYWN...................AS.RHG..HLLIKTYFK..AS..KLM...TE..KAD.A.E...ENLED...VM...EEVRK.I.SES.I..K.YNH...................................................................P-LR..KY.VDTILR..........................................................................................................................................KC..PV.E..YQ.E.KMGRNMDD.YED..FDDKQN..TYP.....................................SEKSLAKLH.K.QV.............................................IY.AVQRHNRTRV.QWQ...MLLQQA..IHLE....................................................................................................................DVAKNETSLthqfvhsfpsa...........................................................................................................................epdgwftryiyTPTVEWYW.E..CL...L...K...HWFY....RL....LS....VI.L.A.LFSVAVVWSECT..FFS........................................................TRP..VL....SL.FA.V...FI..-..Q.L..A.ER.DY..N.YLYI........EMACFI....TI.F..F..L...C.TC.VYSTVF....RIRV....FN................Y.Y.YFAS...HHQTDAY..SLQFSGML......FCRLTP...P.LC....LNF.L..GLI.HMDSAIshq.................................qkeQTAY.TSIMG....S..MHV........I...SF....IA..NGFY....IY...YP.MLIV.ILCIATYF...................................................................................................................................................................................................................
R0GKZ9_9BRAS/6-499                   ....................................................................................................lislpltlg--------LVVS.T......LRYF..AG-...P...EIPR....................................................YVLITVGYTW..FCSVSVII.LAPADIWT..TLSLQP..dH.................................................................................................................................................................P-----.-..--....E...N.....G.A.IS.FL...WSWSYWSTFLLTW................AV..VP.LIQ.G....F....E........D........A.......G..D...F....T.V.SE...................................................RLK.T....SVHV..N...L...VFYL..V...L..G..FI..GL.LG..LI.........LLIM.M.H.RN.WKGS......-............................................................................................................ILGYAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKTIWK...................NA.DWT..TRQKVLSHK..IA..KIA...VK..LDN.A.H...QELSN...AI...VVAQA.T.STQ.M..S.KRD...................................................................P-MR..PY.MNVIDA..........................................................................................................................................ML..AK.M..FR.E.DPSFKPQG.GQL..GENDMD..YDT.....................................DEKSMATLR.R.HL.............................................RN.AKDEYYRYKS.EYL...TYVTEA..LVLE....................................................................................................................DTMKNYERRdatgwkyissf...........................................................................................................................rasrtgkmgdiLDTLEFMW.R..CI...L...K...KQIQ....MV....LA....VV.M.G.IMSAAILLAEAT..LLL........................................................SKL..DL....SL.FS.I...LI..-..-.-..S.SV.KS..D.ELLV........QAFAFV....PL.V..Y..M...C.VC.TYYSLF....KIGM....LM................I.Y.SLTP...-RQTSSV..NLLMICSM......IARYAP...P.IS....YNF.I..NLI.QL--HS.......................................ETIF.EKKMG....R.iDDA........V...PV....FG..QRFN....EI...YP.LIMV.IYTLL---vasnf..............................................................................................................................................................................................................
M3ZJT7_XIPMA/25-445                  .............................................................................................................LLFAVLYIVSYC.I......ITRY..KRK...S...DDHEdeda............................................vvnrISLYLCTFTL..AVSGGAVF.LLPFSIIS..------...Seil...........................................................................................................................................................lsfPRNYYI.Q..WL....N...G.....S.L.IH.GL...WNLVSLFSNLCLF................VL..MP.FAY.F....F....L........E........S.......E..G...F....A.G.SK...................................................---.K....GIKA..R...I...LETF..V...M..L..FL..LA.LL..ILg......ivWVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.G.LLL....LMCTPVG.MSRM.......................................F-T---...................--.---..-VMGQLLV-..--..---...--..KPT.I.L...EDLDE...QI...YCIHL.Q.EEA.L..Q.---...................................................................RRLN..DM.LT---N..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................SEFNLQA--.-.--.............................................-Q.LTKELDNIRN.QKS...KLERRK..----....................................................................................................................---------.................................................................................................................................................--KASGWE.K..NL...L...Y...PIVM....LI....LL....AG.T.T.ISVIMVALNILY..LLV........................................................-DE..TA....MP.KG.S...TE..R..G.I..G.NT.SL..S.TFGVi......qAVVEII....LM.F..Y..L...M.VS.SVVGFY....SLRV....--................F.E.GFTP..rKDDTTMT..TIIGCCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAVVTTLC...................................................................................................................................................................................................................
D7MTA3_ARALL/6-499                   ......................................................................................................lislplt------LGLVVF.T......LRYF..AG-...P...EIPR....................................................YVLITVGYTW..FCSVSVII.LAPADIWT..TLSLQP..dH.................................................................................................................................................................P-----.-..--....E...N.....G.A.IS.FL...WSWSYWSTFLLTW................AV..VP.LIQ.G....F....E........D........A.......G..D...F....T.V.SE...................................................RLK.T....SVHV..N...L...VFYL..V...L..G..FI..GL.LG..LI.........LLVM.M.H.RN.WKGS......-............................................................................................................ILGYAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKTLWK...................NA.DWT..TRQKVLSHK..IA..KIA...VK..LDN.A.H...QELSN...AI...VVAQA.T.STQ.M..S.KRD...................................................................P-MR..PY.MNVIDA..........................................................................................................................................ML..AK.M..FR.E.DPSFKPQG.GQL..GENDMD..YDT.....................................DEKSMATLR.R.HL.............................................RN.AKDEYYRYKS.EYL...TYVTEA..LVLE....................................................................................................................DTMKNYERRdatgwkyissf...........................................................................................................................ratrtgkmgnlLDTLEFMW.R..CI...L...K...KQIQ....MV....LA....VV.M.G.IMSAAILLAEAT..LLL........................................................SKL..DL....SL.FS.I...LI..-..-.-..S.SV.KS..D.ELLV........QAFAFV....PL.V..Y..M...C.VC.TYYSLF....KIGM....LM................I.Y.SLTP...-RQTSSV..NLLMICSM......IARYAP...P.IS....YNF.I..NLI.QL--HS.......................................ETIF.EKKMG....R.iDDA........V...PV....FG..QRFN....EI...YP.LIMV.IYTLL---vasnf..............................................................................................................................................................................................................
K0R7D7_THAOC/8-580                   ..........................................................................................................lgt----LLFAASTW.F......VLAY..AK-...R...KTPC....................................................FIILLSIASI..GLGSAAVA.LLPIDLSY..ASRAKA..aNvtsh.........................................................................................................................................................edetD-DDYI.Y..SY....S...N.....N.P.TY.IP...WKVTYWTTFFLAW................II..LP.ITR.Q....S....L........T........S.......G..Q...F....T.R.YQ...................................................RIK.D....GVSK..S...I...KGIV..L...M..M..IA..GV.VT..VI.........VSAV.K.L.RT.WHIV.....tI............................................................................................................VMPALM..AL..GNTY.G.L.VLV....ALLLGNG.LVNI.......................................PKRFWR...................EA.CPS..SVLRRSRII..AS..HIE...ES..LFE.S.V...MQLED...IE...DKIEE.VcAMA.V..Q.LDEggdeglmrnedgeltlrgqskr.......................atrcsccgvdevtefhgclevlV---..--.-----Rrknetinl.........................................................................................................................caerrtrrnD-..-S.P..TR.G.HHHRRRAS.RDD..D-----..--Gdtpe............................evntmDINYLLSLS.S.KL.............................................MD.AQENVNSAQL.RWD...TLMEHS..RLFS....................................................................................................................ALMDGEVATtggavgdrgqgsdgsn.................................................................................................................enllspssnhgscgkvCYMLRRVW.V..RY...L...R...FPTY....RV....VA....MI.T.A.VLSVFVLMSEVT..LGS........................................................-KM..NL....SP.FS.W...LV..H..G.I..E.KT.DQ..S.SHQIp......fQIAALV....PL.L..Y..M...S.LS.LYSSLF....QIFG....--................S.Y.SLRG...NRQSHGV..ALLFNAQY......LVRLQF...P.LG....YNY.L..LML.KYD-LS.......................................HCAF.GAIMD....D..MST........I...PF....LG..ASFS....VY...AP.LLIL.AVCLFTLC...................................................................................................................................................................................................................
J9HVG5_9SPIT/45-547                  ......................................................................................................ifiiisv---ILSICVLVT.I......FARY..VDS...E...KFPI....................................................SAYFNIGMTY..FYSLMSIG.ILAVDLGF..SLYNRE..tQsle...........................................................................................................................................................eqeS-----.-..--....Y...Q.....T.L.MK.VL...WNIIYWGSLTHGT................FL..NK.FFS.K....Y....W........T........S.......G..H...F....T.I.GG...................................................RIK.S....SIKNliK...M...IVAG..I...I..A..LA..IF.GC..IA.........YFAI.G.L.NG.INGV......-............................................................................................................-KAVLL..IM..ANVY.S.M.LFL....VILLAYG.LFNL.......................................PLYLWK...................CG.DNQ..HALYKELET..AD..EIR...KQ..YRA.A.L...VDFHT...KV...SQCKN.L.AAN.H..K.NEK...................................................................N--Q..AI.MDILQK..........................................................................................................................................EM..PE.K..DL.E.GQSIGHSQ.YFQ..LELKKN..--Qe...................................iTEDFIANIR.Y.QF.............................................KL.AFFMYKRKKS.KWLttyNIVDNV..-VVK....................................................................................................................PIEYSEDDIkvkpgfn...................................................................................................................................lndatldDLKLKAKP.N..SL...K...K...IILY....RI....LA....VL.S.L.LFCLLVLITEAT..VIV........................................................-DP..EK....TI.VY.F...IV..-..-.-..E.KN.KS..Q.TFLV........VIFTIL....FL.A..G..I...V.LV.CFFTIF....NLKM....SD................Y.M.QLVP...-KHTDCI..TFSSVTGM......CCKIVT...V.SC....FNY.M..TLL.GE---Iapgk..............................dkdiySTSY.VDFYS....S..MIN........V...PF....FG..KYFN....TI...MP.LFII.IFGL----lfaam..............................................................................................................................................................................................................
G3I7S0_CRIGR/6-120                   ........................................................................................................rgpgi------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..G.SA.SL..S.TFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.NFTP..kKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAIVTTLC...................................................................................................................................................................................................................
G1M126_AILME/8-546                   ............................................................................................................l-EIVFVFFLALF.L......LHRY..GDF...K...KQHR....................................................LVIVGTLLAW..YLCFLIVF.ILPLDVST..TIYNRC..kHaaanssppensni......................................................................................................................................tglyatatpvpsqhPCFKPW.S..YI....P...D.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PH.LHLEw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSYWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ETLED...VM...EEVRK.V.NES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.E..YQ.E.KMGRNMDD.YED..FDEKHN..TYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWR...ILLEQA..FYLE....................................................................................................................DVAKNETSAthqfvhtfqsp...........................................................................................................................epenkfiqyfyNPTVEWYW.E..CL...L...R...PWFY....RI....LA....VV.L.S.VFSVIVVWSECT..FFS........................................................TTP..VL....SL.FA.V...FI..-..Q.L..A.EK.TY..N.YIYI........EIACFL....SI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDSSIshq.................................ntqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
C6LRV5_GIAIB/12-681                  ...............................................................................................flftgialtytgiv------------.-......FKWF..PNS...A...TINL....................................................LDYIIVGTAL..VFGMTAFL.GFPPDIAE..SSSAS-...-.................................................................................................................................................................------.S..DF....S...T.....G.P.MV.GL...WKFLYFGWLVFNW................AI..IF.LYK.Q....L....L........K........S.......G..H...W....N.F.WG...................................................RLG.H....GMLR..T...L...TIYL..L...I..G..VP..AV.IV..VI.........VLLV.T.-.KK.FTMD......V............................................................................................................LYTVLI..SL..INTF.G.T.FQI....VLLLAYG.IVDV.......................................PRRLVI...................AA.FPS..LRLYQIYYD..AF..KTT...RT..IRKiY.K...DILFQ...RS...KQNIG.L.SII.P..R.TNH...................................................................--MY..VY.SQRLIKmqmvpneqldaltdttggckgrt............................................................................................kalssxkalssdqgpnkayqsvpVL..PD.Q..IH.S.SAQSSVYS.TKG..SKQQGA..KNAplpprs.........................hysnlqSSSTCNLFH.E.AEpknideckvssylshssrasaltedsiemsssklpggqanienssS-.----------.---...------..----....................................................................................................................--------Taeaekvtekpisyyapevrlagrlvkfpsgpttadmpfcscdchggprrtitssvkqglklve..................ksnfklkflywnamrehgamehlvvqrnyyemlvncrkkgctlqdlraqpnlnpywakmlsrarLGQMSFVY.I..KY...F...R...SFLL....ML....VA....MI.F.I.FFSVVLVLSELM..SPIas...................................................lslY--..--....SP.LL.V...LY..E..Y.V..V.DT.SS..D.STRLv.....lvYAIFGL....LV.A..Y..L...Q.C-.---ALL....NLRF....FN................I.Y.RLVK...-HSTDIM..SLLFIIAR......VPTYIF...P.LG....WNL.M..LLL.NI--QF.......................................TTAY.GTVMA....Q..MSA........I...PI....MG..MDFS....NY...FP.IVII.ALTI----ffas...............................................................................................................................................................................................................
K9KBL8_HORSE/1-92                    ............................................................................................................a------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........-ALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.NFIP..kKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..GIT.RD----.......................................----.--LLG....D..---........-...--....LA..GNFY....IV...LS.YNLL.FAIVTTLC...................................................................................................................................................................................................................
J9HY79_9SPIT/1-335                   ............................................................................................................m------------.-......----..---...-...----....................................................--------GW..FLGLSIFM.LIPLDIYT..VKTNGE...V.................................................................................................................................................................D-----.-..--....-...-.....E.F.LV.VW...WYINYWLVFGLNW................FI..LP.FLM.E....Y....L........S........A.......A..D...F....T.F.KE...................................................RMM.R....SIRN..N...V...PMLV..V...Y..L..VL..FV.VV..VI.........ILAV.T.K.SG.REALq...neG............................................................................................................IVGCII..GL..SLVF.G.L.LSI....VILLGYG.LVKI.......................................PISYFK...................FS.SNA..KKLMYYQQK..TA..EFD...SK..YRV.K.L...QKVQD...MV...NIGHM.I.KVK.H..E.MEP...................................................................--HR..KV.ILQDIE..........................................................................................................................................IF..TQ.S..ME.D.QNNLRIAY.DPR..NKLKLP..KEFkg.................................fiDYQRLVRLR.N.RF.............................................RY.QSTDLLRIAS.FRR...ESIEKA..ILMQ....................................................................................................................DIIDSQLRGdreiksmflk.............................................................................................................................drdnsqrskiIKFLIYFW.F..VY...L...K...PVGM....IL....MS....FI.C.L.SLSAIITYAELA..S--........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------li.................................................................................................................................................................................................................
W9ZWK3_FUSOX/17-274                  ...........................................................................................................av-AVVLCFAAAII.T......TFTW..QTP...R...ERSA....................................................VVSIVAIISL..TSLLATVL.LLPVDIAL..VSATAS...Atlgakkdw................................................................................................................................................atperidsiL-----.-..--....-...-.....Y.T.LK.VV...YYSLYSFDALLCL................IV..IP.FAY.F....W....H........E........E.......Y..D...E....I.E.VEee...............................................grTLS.S....RFLA..A...A...KYTL..F...F..V..AF..VV.VL..FLl.......gFFVP.A.A.GD.SSQS......Hwdldyfkk...........................................................................................lvaqnhgekALTFAL..GL..LLTL.G.T.LLY....VVYTGAG.LALL.......................................PISFIK...................AA.PSI..SAPQLHQTT..AS..QL-...EQ..NRE.R.Q...RQ---...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------iemrnagrqegmsrkdqreld..............................................................................................................................................................................................
V6TBL7_GIAIN/8-694                   ....................................................................................................ilvilffta----AALTYTGI.V......FKLF..PNS...S...TINL....................................................LDYIIVGTAL..VFGMTAFL.GFPPDIAE..SSSMVS...-.................................................................................................................................................................---SES.S..AF....S...T.....G.P.MV.GL...WKFLYFGWLAFNW................AV..IF.LYK.Q....L....L........K........S.......G..H...W....N.F.WG...................................................RLG.H....GMLR..T...L...TIYL..F...I..G..IP..AI.IV..VV.........VLIA.T.-.RK.FTMN......V............................................................................................................LYTLLI..SL..INTF.G.T.FQI....VILLAYG.IVDV.......................................PRRLIM...................AA.FPT..LRLHQIYYD..AF..KTA...RN..IRKiY.K...SILFQ...RS...NQNVG.L.SVI.P..R.SNHmyvysqrl...................................................vamqlvpnE---..--.-----Kldalveka..........................................................................................................................tvtgrssaKV..PS.S..AK.I.LYSSNRES.NKL..YQSA-P..--Vlpd...............................qvsSSSGVQNNT.R.QMknvplpprshhsniksds.........tcnlfhevkektivecrtS-.--T-------.---...------..---Qfsrlsgasansqqr........................................................................................gssaltedsiemssS-------KflggkteaentssatdahpvenpterpvsdyctpevklagrlvkfpsgpttvdmpfcscnchggprrtittsvvqglklveksnfklkflywnamrehgameylvvqrnyyemlvncrkkgstlhdlmgqpnlnpywakvlgsrcLGKMSFLY.I..KY...F...R...SLLL....ML....VA....MI.F.V.FFSVVLVLSELM..SPIea....................................................faAHS..PL....LV.LY.N...YV..T..D.T..S.SA.SA..R.LVLV........YAIFGL....LV.A..Y..L...Q.CA.----LL....NLRF....FN................I.Y.RLVK...-HSTDIM..SLLFIIAR......VPTYIF...P.LG....WNL.M..LLL.NI--QF.......................................DTAY.GTVMA....Q..MSA........I...PI....MG..MDFS....NY...FP.IVII.VLTI----lfas...............................................................................................................................................................................................................
M4G4R1_MAGP6/16-258                  ............................................................................................................v-AIAVALLAAII.T......TFTW..QTA...R...ERSA....................................................VVNVVAIVSL..TALLATVL.LLPVDIAL..VSSTTS...Vhlgak.......................................................................................................................................................rdwatP--EHV.A..SL....L...Y.....S.-.LE.VI...YYTLYSFDALLCL................LF..IP.FAY.F...wY....E........E........S.......D..E...V....E.D.EEg.................................................rSFG.S....KLWG..A...F...KYTT..I...F..I..AL..VV.IL..FL.........VGFF.V.-.PA.AGNQ......Tgrhldldyfk........................................................................................rllaankgekALTFAV..GL..LVCL.G.T.LLY....VLYTGAG.LALL.......................................PISFIKs.................aPS.ISA..PQLSETTAT..AL..---...ER..NRE.R.Q...RQL--...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------elrnsgn............................................................................................................................................................................................................
G1LJZ5_AILME/28-267                  .............................................................................................................LLFATLYILCHV.A......LTHF..KKP...A...EFITvdded..........................................atvnkIALELCTFTL..AVALGAVL.LLPFSIIS..------...Nevl...........................................................................................................................................................lslPRNYYI.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLI................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVLG..R...V...YETV..V...M..L..ML..LT.LL..VLg......mvWVAS.A.I.VD.NKAS......Resly...................................................................................................dfweyYLPYLY..SC..ISFL.G.V.LLL....LVCTPLG.LARMfsvtgkllvkprl............ledleeqlycsafeE-----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------aaltrricnptscwlhldme...............................................................................................................................................................................................
H7C1Y4_HUMAN/1-45                    ............................................................................................................g------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.-L...WNLASLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................KEG.K....MSRQ..N...L...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------v..................................................................................................................................................................................................................
A0A024R0Y9_HUMAN/235-450             .........................................................................edleeqlycsafeeaaltrricnptscwlpldmell------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.-HRQVLALQT.QRV...LLEKRR..----....................................................................................................................---------.................................................................................................................................................--KASAWQ.R..NL...G...Y...PLAM....LC....LL....VL.T.G.LSVLIVAIHILE..LLI........................................................-DE..AA....MP.RG.M...QG..T..S.L..G.QV.SF..S.KLGSf......gAVIQVV....LI.F..Y..L...M.VS.SVVGFY....SSPL....--................F.R.SLRP..rWHDTAMT..QIIGNCVC......LLVLSSa.lP.VF....SRT.L..GLT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNAA.FAGLTTLC...................................................................................................................................................................................................................
V9ESJ5_PHYPR/13-276                  ...........................................................................................................ii--AVALLICNVY.I......LVYF..QHD...D...DKNTa..................................................yFPKALVIFGL..FFAEATVL.LLPLDVAN..------...Nst.............................................................................................................................................................aiGCAEGW.N..TV....C...G.....N.InMD.LL...WLMVFLSIIIFLV................VL..LP.FAI.F....Y....Y........E........A.......D..D...G....E.D.NP...................................................--K.K....SQWG..E...A...IKME..L...G..T..VF..VA.AA..LIt......vlYLTC.A.K.SS.VPMR......Alevnsmsdsegfqpyvdgttvs................................................................stivtvasnvtvqhitltvdvsLPVYVT..GL..TSFV.G.W.FGF....SIFCGIG.LIAL.......................................PMDLIL...................AF.FHR..PK-------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------fisadvyaiqklilqrrsvellevgrsikqsm...................................................................................................................................................................................
L7LY39_9ACAR/23-232                  ..............................................................lgelvikpkflrdiqdeyqcammeeenlrrrahiisheleihrstpv------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................--------Qrngrngcatsalkr.....................................................................................................................rllqlgkvrrelalQQLASPWR.R..NL...G...Y...PLAM....LV....LL....SL.T.I.ISLLMVIHNMLQ..LLI........................................................-GI..KA....LP.IS.P...QVekF..S.L..G.IS.SL..S.ALGVv......gSSLEIV....LI.L..Y..L...W.LA.SVVGFF....SLPV....--................F.C.RLQP..kPSSATVT..QIIGNCAV......LLVLSSa.lP.VL....ART.L..G--.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------essh...............................................................................................................................................................................................................
A8XT56_CAEBR/73-686                  .............................................................................................................WLFMLLYLFAYW.L......ISRL..KRK...T...EREAlyagee........................................dyfvyrVSVWISSTAT..ATSIGSLT.LLPFSVIG..------...Veml...........................................................................................................................................................qlyDGNYYL.Q..WL....S...Y.....S.L.IG.AL...WNYVFVLSNVSLF................VL..LP.FSY.F....F....I........E........S.......Q..G...F....S.S.SN...................................................-LG.N....CTTQ..R...I...YEAM..A...I..S..FL..FA.FV..LLc......laEIVL.T.I.LD.YPVS......Flsi......................................................................................................tsvNLPLIY..SC..VSFI.G.A.VLL....LISTPYG.FAKMfslareflvvdge............vveeelasspnevtPEPSENafmi...........nskpS-.-DS..EETLSAPIS..DE..VVT...DV..VEE.F.R...KDSDS...GI...ESGST.E.EMR.L..N.TDDedeieiinpevdpsecgdvgn.........................ttptkpkrrrwrhdyasspvvRKWE..-E.PKKLPNpnfdyrnfndyvra..............................................................................................................arrqrssfsesddfWV..GS.P..TR.N.TFSNNYFS.-SR..FSRCEH.gSEMclnps...........................tslavDPFASGDSH.E.ATsseastsnqis......................pnrlskseeaiwKP.VIHTVKSSKL.YKR...AIEKQG..----....................................................................................................................---------.................................................................................................................................................--RLLKLF.M..RL...R...Y...PVAI....AI....LL....AL.T.T.CSLIMVAINTLK..LLF........................................................---..GY....RS.LP.V...YA..Q..Y.I..E.VH.TR..H.SFGLf......gACIETL....II.I..Y..V...M.LT.SFVGLY....SLPV....--................L.R.SLRP..vRKDTPMP..TIIINSSI......VLVVASa.lP.VA....VNT.I..GMT.TF----.......................................----.-DLLG....S..QSS........L...QW....LS..-SFR....VV...VA.YNTM.FVVLSVAF...................................................................................................................................................................................................................
K9FX96_PEND2/15-255                  ...........................................................................................................av--VAILLAVASV.F......IYVY..QNP...R...DRSP....................................................SVTVTCIISI..ASLLATVL.LLPVDVAL..VSSTTS...Sklgqr......................................................................................................................................................kdwatqD---LV.D..RI....T...Y.....S.-.LT.II...YYLLYSLDALLCL................LV..IP.FTY.F...wY....E........E........C.......D..E...V....A.T.EEg................................................aqTLG.Q....RLWG..A...L...KYTL..S...F..V..VV..VM.IL..FLv......gfF---.V.-.PM.SQGK......Namdldyfrh..........................................................................................lltenhgerALTFAL..GL..LMTI.G.L.CFY....VLYTSVG.LALL.......................................PISLIK...................T-.APS..ISSATLRAS..TT..QKL...NI..NQE.R.Q...RQLE-...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------grcag..............................................................................................................................................................................................................
W5GNP9_WHEAT/1-388                   ............................................................................................................m------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..N...L...LFYS..I...V..V..AI..GL.FG..LI.........LLLV.M.H.RA.WDGG......-............................................................................................................LVGFLM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PRNIWK...................NA.DWT..HRQKVLSHR..VA..KMA...VK..LDN.A.H...QDYSN...AI...VVAQA.T.SNQ.M..S.KRD...................................................................L-LR..PY.MDIIDR..........................................................................................................................................MV..AQ.M..LR.D.DPSFKPSG.GRL..GENDMD..YDT.....................................DDKTMATLR.R.QL.............................................RM.AHEEYYRCKS.EYM...TYVMEA..LDLE....................................................................................................................DTIKNYEHRdangwkyvssf...........................................................................................................................resrsgtlgslLDTMEFIW.R..CI...L...R...KQLQ....KA....LA....VI.L.G.CMSAAILLAEAT..LLP........................................................GGV..DL....SL.FS.I...LV..K..S.-..-.-V.GK..Q.EVLV........QVAAFV....PL.M..Y..M...C.IC.TYYSLF....QIGM....LM................F.Y.SLTP...-RQTSSV..SLLMICSM......VARYAP...P.IS....YNF.L..NLI.RLGGNV.......................................KTTF.EKRMG....N.iDDA........V...PF....FG..RRFN....RI...YP.LIMV.VYTLL---vasn...............................................................................................................................................................................................................
G0R0T0_ICHMG/6-515                   ............................................................................................................i-QITLLLFYLVY.L......IKKY..AA-...E...SIYF....................................................HIKAICFFSW..LLSFAFIF.LLPVDIKY..------...V.................................................................................................................................................................KKNKYL.R..FY....L...K.....I.F.KK.QI...YIYKIIKKFILCIkq...........ifvFI..LP.FFQ.E....Y....E........E........A.......G..E...F....T.K.QE...................................................KIK.K....SIIK..N...L...QIYL..I...A..F..FL..LV.GF..IV.........YLMY.Q.-.NK.ITKY......D............................................................................................................IQGLLI..SL..SNGF.G.I.LLV....VLLLGHG.LVAI.......................................PKRLWReynyqlll...eyffilifIT.FIY..LKKSYYYFK..AH..LLF...EQ..KQK.V.K...LKLED...QV...YLVFY.S.LKI.N..N.---...................................................................-QYK..EQ.INIILE..........................................................................................................................................SV..PQ.K..II.N.YCKQNKDY.ITN..------..KEE....................................fTYERLIQLN.K.QI.............................................KN.NSFQIKRIET.QLD...DIIDKA..IFYE....................................................................................................................DIINTNNSEskniksify..............................................................................................................................icsksrlgaiYDYFYYIW.N..CR...L...L...KQIK....KI....FS....II.F.F.LLSTFIFFEEIS..IFI........................................................-PS..LP....NP.FK.Y...II..N..-.N..S.II.TY..V.FFFFyifyqyikKIIIII....PL.I..Y..I...S.YC.AFYGLF....IFKF....AG................S.Y.GLYN...NKQTDAA..SLMFFSIN......FSRVSA...P.IA....YNY.I..RML.KIN---.......................................DSAF.EYVIG....K..IDE........I...PF....LE..KANM....YC...FP.FILV.LLILANIF...................................................................................................................................................................................................................
E1F7T5_GIAIA/8-693                   ....................................................................................................ilvilffta----AALTYTGI.V......FKLF..PNS...S...TINL....................................................LDYIIVGTAL..VFGMTAFL.GFPPDIAE..SSAMTS...E.................................................................................................................................................................-----S.S..AF....S...T.....G.P.MV.GL...WKFLYFGWLIFNW................AV..IF.LYK.Q....L....L........K........S.......G..H...W....N.F.WG...................................................RLG.H....GMLR..T...L...TIYL..L...I..G..IP..AI.IV..VV.........VLVA.T.-.RQ.FTMN......V............................................................................................................LYTLLI..SL..INTF.G.T.FQI....VILLAYG.TVDV.......................................PRRLIM...................AA.FPT..LRLHQIYYD..AF..KTT...RN.iRKI.Y.K...GILFQ...RS...NQNVG.I.SII.P..R.SNHmyvysqrl...................................................iamqlipnE---..--.-----Klealveaanntgrgstkvppstktlysfnq..............................................................................esskpyqsvptlpdrvssgsgvqsnthkkkDI..PL.P..PR.S.HH----SD.IKS..ASTCNL.fHEV.....................................KEKTIIECR.A.ST.............................................-Q.LSRSSGASAN.SQR...RGSSA-..-LTE....................................................................................................................DSVEMSSSKfldgrtdaenpssaadiqpvgtlpersssryytpevklagrlvrfpsgpttadmpfcscnchggprrtitssvvqglklveksnfklkflywnamrehgamehlvvqrnyyemlancrkkgstqhdlitqpnlnpywakvlrsrcLGKMSFLY.I..KY...F...R...SLVL....ML....IA....MV.F.V.FFSVVLVLSELM..SPI.......................................................gALA..PY....SP.LL.V...LY..D..Y.V..A.DT.SS..A.SARLi.....lvYAIFGL....LV.A..Y..L...Q.--.--CALL....NLRF....FN................I.Y.RLVK...-HSTDIM..SLLFIIAR......VPTYIF...P.LG....WNL.M..LLL.NI--QF.......................................DTAY.GTVMA....Q..MSA........I...PI....MG..MDFS....NY...FP.IVIIvLTVL----fas................................................................................................................................................................................................................
X6NXG2_RETFI/73-362                  .......................................................................................................ivfaia---LLILIGLIW.G......FLSY..FKS...K...SVPNes................................................wkLTLFICSTAL..LFAFLSLL.VIPVDVYF..------...A................................................................................................................................................................sSTSEYD.S..SS....N...R.....N.K.MQ.WV...YYGFDIVLMCFVF................TV..MP.FAY.F...mF....E........E........G.......Q..E...D....D.L.GSpgrr...........................................kgggSTF.A....QRAC..N...A...LKYT..F...G..F..TI..VF.VV..LI.........VIGA.F.-.IN.FNNA......Nsdsndensqwrs....................................................................................tvtnsfkshssrIVPFCL..AI..LMTV.G.L.FFS....MIYTSWG.LAYI.......................................PISIMR...................TM.AVT..YNSSNQKAS..H-..--K...KG..GSA.A.E...TDLKN...VN...RDIEF.L.DSK.Y..Y.GRE...................................................................DSWS..K-.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------pdqekkqkllrdkrqlerrakvrsygdr.......................................................................................................................................................................................
A0DFW7_PARTE/10-496                  ..........................................................................................................ieg---ILLIVYVFY.L......VWDY..SA-...K...EVPF....................................................YIKALTYFSW..ILTFSIVL.VLPIDILQqrTFLEQQ...St...............................................................................................................................................................lE-NNEK.T..QL....Q...Y.....G.L.F-.LT...WRILYWSNFLLSW................QVsqTP.YIQ.D....Y....E........D........S.......G..D...F....N.W.RE...................................................RMK.Y....SIKK..N...L...LIYT..L...G..L..VL..GT.II..II.........LLAM.N.-.-N.DSSD......Y............................................................................................................ITNSLI..GL..ANFF.G.L.FLV....VLLLGFG.LVAI.......................................PKRYIK...................ES.KEE..EVLDKCYKD..SV..YLE...EQ..RTE.K.G...YDIEE...IC...KTLLI.L.EDS.Y..S.NSE...................................................................--FF..VY.ISKIIA..........................................................................................................................................LI..PP.V..YF.E.SIKQQAIY.RKK..ELPSEY..LNL.....................................NLKQLGVLH.K.SV.............................................KQ.IVFDLRRINT.KFE...ILLNKV..KKLErq...............................................................................................................yeiDSI-----Enqsf.........................................................................................................................................vikiVIKAQYIW.V..NY...F...R...RYYN....KY....IG....YV.F.T.LLSIILMFGEFQ..VLM.......................................................kQKI..NI....NI.LS.S...VI..-..-.L..S.IS.DT..T.LTNI........--TLLI....LL.T..Y..M...M.FC.VYYGLF....SMKI....SG................L.I.SFNN...KHNTDAP..SLMFGSVN......FGRVSF...P.LC....YNF.L..QMT.AS-LDK.......................................SNQF.FNFFK....R..LDE........F...SV....FD..STFT....II...LP.LMLI.IMSLCNFF...................................................................................................................................................................................................................
Q7RYT2_NEUCR/18-521                  ............................................................................................................v-ALFVISVIVLL.I......LRHY..LPL...R...TTPA....................................................YLLVPIFFAL..CLPASMVL.LVPIDLAS..SAMVDD..iDa..............................................................................................................................................................rgI-----.-..WL....E...R.....G.P.LR.VC...WRIAYWLTFCLTW................FI..IP.ILG.E....Y....S........D........S.......G..Y...R....D.P.QA...................................................KFR.D....SLRA..N...A...QYYA..I...V..F..GS..GI.LG..LL.........YVLW.S.-.YG.GFSE......S............................................................................................................LKSTVM..AL..AYCW.G.L.VLA....IYLMGHG.LVAI.......................................PRRLFR...................NA.DIS..GRLRRIQTQ..AP..KVY...DQ..MED.A.Q...MNLDD...LE...MQVAE.L.SKR.S..K.TGT..................................................................aKTFQ..DW.IEELVD..........................................................................................................................................LT..NI.P..ES.Q.LASTSGAV.RGS..GEYVRT.kLPTv...................................iTEKYMADLT.R.QL.............................................IR.AKHARSRYLN.DWN...RLLHDA..VRTQ....................................................................................................................AIIDSVASKrldfgtpspg.............................................................................................................................sgfwdrhsllTPYTRFLY.H..YY...V...L...PYFN....LA....FG....GL.L.A.LASVCIVWSEVV..KGI........................................................-FP..VL....SV.IR.Y...SV..V..H.H..N.VG.NK..G.QIGLa......gQVIAAL....WM.V..Y..M...C.AA.ALISIT....EVKV....WR................G.R.ALVR...-RNTAPE..SAFWYASQ......VARLSV...P.LT....YNF.M..TFL.GV-VYK.......................................DTVF.YDFLG....Q.lINL........T...P-....LG..KWFD....YL...FP.ALIL.VPVCFTLF...................................................................................................................................................................................................................
J9EUJ9_WUCBA/96-218                  .....................................................................................................vlykrtll------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........KIYATV....II.S..Y..L...C.IC.AYYTVF....KLQI....YR................Y.Y.HLDP...HHMTDEN..SLLFSAIL......LCRLTP...P.IC....LNV.L..GMI.HLDSHItsdt...............................efgvETQF.TKLMG....H..LDL........I...PV....LA..KGIN....IY...LP.ILIV.LLALGTWF...................................................................................................................................................................................................................
W6KQQ3_9TRYP/9-286                   .........................................................................................................viii-LTLVFITLAAY.I......VLYF..QSP...E...DGKSt..................................................yCGKVIFGLSL..LLSLGGTL.LVTYDVAD..------...Apdp...........................................................................................................................................................tvlN-----.-..TF....S...K.....T.LnTV.LM...WEIVLWIIIVKAI................VI..CP.FMM.F....L....Y........A........F.......R..D...P....E.H.PK...................................................-T-.T....KAII..Q...A...TLTT..L...V..A..VS..VF.AL..IVg......tcYATV.G.V.SK.ISFQ......Tyeasgqlmftsqsgv.............................................................................slnqtyttvepeikvsFTTYCV..GM..LSLL.G.W.FVL....LFYCGLG.FISF.......................................PINGFF...................NF.KNR..I----KRIN..AA..DFS...ER..MYV.I.L...AK---...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------adallelgkelqrearsyvplavknkihilrnevylleneqey........................................................................................................................................................................
F2PKR0_TRIEC/1-232                   ............................................................................................................m------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................-----AGLT.R.DL.............................................YR.ARHKHARYAD.AWS...RLVREA..LDCQ....................................................................................................................TILDAATSKqlvfdsrsssl..........................................................................................................................ssslsagfgpllTPYLRYLL.Y..TH...L...L...PAVY....IC....LA....AV.F.A.CLSVCILWSELV..RTF........................................................-FP..FL....SI.VA.L...TT..-..-.-..-.-P.SS..E.PVGFp......sQLLASV....WL.L..Y..L...C.AA.AGTGIS....DAQV....WG................N.R.ALVP...-RNTYHE..SACWYAGQ......VARLTV...P.LA....YNF.L..TLL.PTDLQL.......................................RTTF.YDFLG....K.gINL........T...L-....IG..EGFD....LF...FP.LFIL.LPVAATAF...................................................................................................................................................................................................................
M4AGX1_XIPMA/1-110                   ............................................................................................................l-EIVLVFFLALF.L......LHRY..GDF...R...KQQR....................................................MVLFGTLLAW..YLCFLIVF.ILPLDVST..TIYRQC..iEdheehlpvstvsptnrtgp...........................................................................................................................ggpnppnasmaptrrtvpsPCHRPW.S..FI....P...E.....G.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------i..................................................................................................................................................................................................................
G0TWL5_TRYVY/11-482                  ............................................................................................................v-FAILVLVATLS.L......FWHY..TKV...S...VKSVp..................................................lLCSVCTIVSV..YVSILPFP.LLVVDISA..ASEAKG...D.................................................................................................................................................................P-EK--.-..--....E...A.....R.W.LT.CL...WYIIMAITYIMGW................VL..LP.VSQ.C....Y....T........E........L.......G..Q...F....T.S.RR...................................................KLV.Y....AIKT..N...I...KLYA..I...M..F..IV..AI.VF..FA.........YLAFlK.G.VG.DSFS......G............................................................................................................IVKLGT..GL..ANAW.G.L.LLL....VLFMSAG.LVGV.......................................PRVLWR...................RS.CAA..RMLRYAYFA..AV..DIQ...ED..LES.A.L...TDLAA...VK...EELMS.I.RPL.V..A.VEH...................................................................N-AH..-W.VHMIKL..........................................................................................................................................I-..--.-..--.D.DARIEASQ.YSS..ISRCHS.kKSGvvh...............................sdvSLGHLEELH.E.RV.............................................LR.RIKITRRMSF.MWR...STLKNC..QFYE....................................................................................................................SVLYGVDES.................................................................................................................................................VNGFTRFW.I..-Y...V...R...EGVY....KM....AS....VC.A.A.VLTAMLLLSELA..VPL........................................................KSF..AT....FQ.LS.I...VA..-..I.V..V.GN.GF..E.LVGS........----MV....FL.F..Y..M...A.QC.SYWAIV....QLKV....FD................I.Y.VIMP...-SISDNA..SLCFYAIF......LTRLIM...P.LC....FNF.L..LMA.DVD--V.......................................EVQY.GNVYE....R.nMDV........T...FI....FG..KAFN....QF...LP.TFIS.IVSLLYY-v..................................................................................................................................................................................................................
G8BKC2_CANPC/7-493                   ...........................................................................................................ic--YVLILLLSLL.G......IRYH..INI...F...KYPV....................................................YLTLPLTLGI..YIPLSIVF.TLPLDYVS..--HNTQ...S.................................................................................................................................................................TQEITW.F..GL....P...D.....T.V.IL.YI...WKSNYWITFLLTW................II..LP.VLL.E....F....Y........R........S.......G..H...H....D.A.YS...................................................KLK.D....AIRE..N...L...KFQV..I...M..I..SV..SL.VG..LI.........YMLI.E.-.VG.LNLN......H............................................................................................................LKLMII..AI..SHVY.S.L.ILA....TWLMGHG.LISI.......................................PRNKWV...................QG.SVV..NDLNHHYLK..LP..KLV...DD..LED.V.R...ISFRE...DV...LKVIV.L.KQN.Y..T.SESi................................................................edFKYR..DW.ILNLYD..........................................................................................................................................SI..PG.E..IR.E.QVEKQYLH.DTT..T---ID.rDQL.....................................NDQFMTSLN.S.SF.............................................SS.NLNRLIGYQS.EFN...RMISKI..LRLE....................................................................................................................DVLTAVSSRelifrv....................................................................................................................................dnhrvlwSPKFNFIY.W..YY...L...R...PISN....KI....AA....AV.L.G.VASLVILQSEFF..HST........................................................---..KI....SL.MN.V...FV..Y..S.T..D.IH.NH..S.FLQF........-AISCI....VF.S..Y..M...L.FA.ALHSLT....QLKI....FN................M.Y.HLVP...-RNSDPV..SACWYAMY......IARLTI...P.LS....YNF.I..TLF.VSR---.......................................DSIF.EKWYG....Q.sVHL........T...G-....LF..NLLN....NW...IP.RLIL.VPVLLAMF...................................................................................................................................................................................................................
M7B8G2_CHEMY/4-383                   ............................................................................................................g------------.-......----..---...-...----....................................................----------..--------.--------..TIYNRC...Klavnssppesssss....................................................................................................................................niingsyptsaprkhKCFKPW.S..YI....P...N.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PN.FNLQw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSHWN...................GA.KKG..YLLMKTYFK..VA..KLM...TE..KAD.A.E...ENLED...IM...EEVRK.V.NEG.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.E..YQ.E.RMGRNMDD.YED..FDDRQN..NYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWR...ILLEQA..FYLE....................................................................................................................DVAKNETSTtrqfvhtfqfq...........................................................................................................................epenritryfyTPAVEWYW.E..CL...L...R...PWFY....RI....LA....IV.L.A.TFSVIVVWSECT..FFS........................................................TKP..VL....SL.FA.V...FI..-..Q.L..A.ER.TY..N.YIYI........EI----....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------m..................................................................................................................................................................................................................
Q178R5_AEDAE/6-528                   ..........................................................................................................vfs--ICLALLLASI.S......LYRY..GCI...Q...RQHP....................................................VVTFSVLTAW..SFSFLIVF.TIPLDVTS..TVYRNCi.lEhnetskn..................................................................................................................................................ippgsansSCQRPW.G..MV....E...E.....E.V.FP.NL...WRIIYWSSQFLTW................LI..MP.LMQ.S....Y....L........K........A.......G..D...F....T.I.KG...................................................KLK.S....ALVD..N...A...IYYG..S...Y..L..FI..CG.IL..LI.........YLAL.Q.-.PG.ISLDw....qK............................................................................................................LKAIAS..SA..SNTW.G.L.FLL....VLLLGYA.LVEV.......................................PRGLWN...................NS.KPG..FTLQYAYFK..LS..KLS...SE..KAE.A.E...EHVDD...VL...ESLQS.A.SRA.V..P.SRH...................................................................-ELR..PA.LETIIR..........................................................................................................................................KV..PT.E..LM.E.RA------.-RR..ISRDDG..SPVa..................................vpSEKALVRLH.R.QV.............................................IK.SLQTLQRTEA.LWN...VQVNKV..LHLE....................................................................................................................DVAKNAVSLdhrfktefpk.............................................................................................................................hragfaratySPTLEWYW.E..CV...V...K...APFL....KA....LA....VI.T.A.FLSFVVVWSELT..FFN........................................................REP..VL....SI.FA.N...VL..-..E.I..A.KR.NY..D.FVTI........EIFSMM....TL.C..Y..L...C.YC.AYSTVF....RIKF....LN................L.Y.YLAA...HHQTNEY..SLIFSGML......LCRLTP...P.MC....LNF.L..GMI.HMDSHIikq.................................rilETHY.TQIMG....H..MDV........L...GI....IS..DGFN....IY...FP.MVML.AFCLATWF...................................................................................................................................................................................................................
F0XPR6_GROCL/23-515                  ............................................................................................................l-ALFVLSLVVLL.V......LRYY..LPL...R...TTPA....................................................YLLVPVFFAL..WLPANIIL.LVPIDLAS..SARTDD...Eat.............................................................................................................................................................rgI-----.-..WL....P...E.....S.V.LR.VA...WRITYWLTFALTW................TI..LP.ILA.E....Y....S........D........A.......G..F...R....E.P.KD...................................................RLL.Y....SLRQ..N...G...QYHL..M...V..C..GL..GL.AG..LV.........YVFV.T.-.SG.ASFM......A............................................................................................................LKSLVM..AL..SYCW.G.L.VLA....IYLMGHG.LVAI.......................................PRRLLR...................TA.TPS..RRLRRLQTQ..AP..SLY...EK..LEE.A.E...MDLED...IE...LQVSE.L.SRR.K..T.GSA...................................................................LEFR..DW.IDELAE..........................................................................................................................................TV..GQ.P..G-.A.HLRPSLAA.SAP..AETRT-..--Ipa.................................viTKKYMADVT.R.QL.............................................VR.SRHARSRYQS.EWT...RLLQRY..AETQ....................................................................................................................VVLSSVTSQrldrgs.....................................................................................................................................gngsvlTPYTRFVL.H..YH...V...I...PYVR....TA....LG....VV.L.A.LASAAIVWSELV..KAA........................................................-LP..AA....SV.VN.L...SV..V..H.H..W.TG.DK..G.QVGFa......gQLIAAG....WI.L..Y..M...C.TA.ALASVT....EVRV....WR................G.R.ALVR...-RNTAHE..SAFWYASQ......VARLSI...P.LS....YNF.M..TFV.SPGVYK.......................................KTVF.YDFLG....R.lINL........T...P-....LG..EWFD....YV...FP.AFLL.LPVLATL-l..................................................................................................................................................................................................................
U6MA57_EIMMA/11-376                  .........................................................................................................aasa-----ACMLPLL.L......YYHF..VDR...K...KDTP....................................................IAALSFCSTL..TFALLLAL.LVPIDIMQ..-ASTV-...Nfatlqnadipqelqqppsvaeaaaaahas......................................................................................................ntaaaaftpagaaaaaaaaagwaalkraslP-----.-..-L....T...P.....D.V.LQ.QL...YLGLGIAVFLCCF................IL..TP.AAI.F....Y....A........K........E.......S..D...R....R.R.LQdide...........................................leafSYK.A....SFAA..L...K...KTVL..F...V..V..AA..CV.LL..LL.........LLAV.R.-.PG.MPPP......Aflrpeepvappqrlqqeqqgvspderssaglmaaaaaaas...........................aaaatasaaaaaaaaaaqrvdsdavqlytaqllgvhkagvdS--LLY..LG..ACFLcG.AqGVW....IIFGAFG.VACL.......................................PLAWLK..................rRP.STE..QQQQQLEHA..IA..AIR...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------eqqrllqnkyaggrkmspldtetfqhlraq.....................................................................................................................................................................................
G0RD09_HYPJQ/19-518                  ............................................................................................................i-ALLLVSLAVLL.I......LRHY..LPL...R...TTPA....................................................FYIVPIFFAL..WLPSVLVL.LVPIDLAS..SAITDD..vAs..............................................................................................................................................................rgI-----.-..WL....P...Q.....R.V.VL.VL...WRITYWLTFCLTW................FI..LP.ILA.E....Y....S........D........T.......G..Y...R....E.P.YD...................................................KLM.Y....SLRA..N...A...QFYA..M...I..L..GA..GV.VG..LV.........YIFI.S.-.YE.FSFT......A............................................................................................................LKALLM..AL..SYCW.G.L.ILA....IYLMGHG.LVSI.......................................PRHLLR...................SG.SIS..GRLRSLQIK..AP..RVY...EK..MED.S.L...TAVEE...VE...QQVSE.L.SRR.K..T.GTA...................................................................AAFQ..DW.IEELQE..........................................................................................................................................MA..NV.P..ES.Q.PRSSLLDP.TAP..R---Q-..--Avp................................hviTEKYLADLT.R.KL.............................................VR.ARHSRSQYVG.EWT...RLVHEA..AKLQ....................................................................................................................MILDSVASKkldfgdvsph.............................................................................................................................agfwdrvkilTPYSRYLC.Y..YY...V...F...PYVR....MG....FG....AL.L.G.FASACIVWSEIV..KFP........................................................-FP..KL....SI.IR.V...SV..V..H.H..W.VG.DK..A.QVGFa......gQVIAAL....WI.C..Y..M...C.AA.ALSSMT....EIKA....WR................G.R.ALVK...-RNTGHE..AAFWFASQ......VAKLSV...P.LS....YNF.L..TFL.SKEVYE.......................................KTIF.YHFLG....Q.yVDV........T...P-....LG..KWFD....NF...FP.IALV.IPILATLF...................................................................................................................................................................................................................
N1Q3H6_MYCP1/21-515                  ...........................................................................................................ts--IIAIALLALL.V......IRHY..LPL...R...STPG....................................................YLLVPVFLAL..ALPCSIIL.LVPIDLAS..AAGDEE..tRv..............................................................................................................................................................rgV-----.-..WL....P...E.....R.V.LL.VA...WRVTYWLTFMLTW................FI..LP.LLG.E....Y....C........D........S.......G..Y...R....D.T.RS...................................................RII.Y....SLRA..N...A...RYQL..I...V..L..GT..AV.AG..LV.........YFIW.E.-.NG.LHLA......S............................................................................................................IKGLVM..AL..AYSW.G.L.ILG....LALMGHG.LVAL.......................................PRKIYR...................NA.SVS..ERLRRLQAQ..AP..KVN...DG..LEE.A.T...DKLNE...LE...RTVMQ.L.KRH.K..G.GAS...................................................................SAQQ..EW.IDELAD..........................................................................................................................................TA..IL.P..IS.R.PGTTAAIQ.---..ATNPSI..--Pa..................................vvTDRYLADLT.R.KL.............................................KR.ARHRKGRFQD.EWT...NLCTQA..QDTQ....................................................................................................................TILDSVSSRkldfgrkqpg............................................................................................................................vggitdrlillTPSTRYYL.H..AS...I...L...PYLR....VG....VA....GI.L.G.LASILIVWSELV..KSL........................................................-AP..SL....SV.IG.L...TV..-..-.-..V.HA.SK..V.NFGG........QLIAAT....WL.L..Y..M...D.AS.ALYAIS....DVKV....WG................N.R.ALVK...-RQTYAE..SATWYSLQ......VAKLTV...P.LS....YNF.I..TMM.PPAIYK.......................................ETMF.FKFLG....Q.lINL........T...P-....LG..QEFS....AF...FP.CFLI.IPVLATLF...................................................................................................................................................................................................................
A0A010QUR7_9PEZI/19-514              ............................................................................................................l-ALLIISVIVLL.I......LRHF..LPL...R...TTPA....................................................FYLVPIFFAL..WLPACMVL.LVPIDLAS..SARTDD...Eat.............................................................................................................................................................rgI-----.-..WL....P...Q.....R.L.LL.VS...WRITYWLTFALTW................FI..LP.ILG.E....Y....S........D........S.......G..Y...R....E.P.QD...................................................SLK.Y....SLRQ..N...A...QYHG..M...V..F..GT..AA.IG..LT.........YLFA.R.-.YG.VGAF......E............................................................................................................FKASFM..AL..AYFY.G.L.VFA....IYLMGHG.LVSV.......................................PRRLLR...................YA.SIS..GRLRRLQIR..AP..KLY...EK..MED.S.L...LNLED...VE...LQVSE.L.GRR.K..T.GSA...................................................................VKFS..EW.IDELVE..........................................................................................................................................SA..NM.P..E-.-.S-----QP.RTV..VGDTRA..LPTv...................................iTEKFMADLS.R.KL.............................................MR.ARHTRSRYVN.EWN...DLLKDA..SDTQ....................................................................................................................AILDSAASKkltfaapsph.............................................................................................................................agfwdrftvhTPYSRYIY.Y..YH...F...E...PYAC....IA....LG....VF.L.A.AASVLIIWSELV..KAA........................................................-FP..QL....SV.IR.L...TV..V..H.H..W.VG.EK..G.QVGFa......gQLISVL....WL.L..Y..M...C.AA.TFITMT....EVKT....WR................G.R.ALVK...-RNTAYE..SAFWYSGQ......VAKLSV...P.LS....YNF.V..TFL.SGEIYK.......................................KTRF.YGFLG....T.lVNF........T...P-....LG..RWAD....YL...FP.VFVL.LPVAATLF...................................................................................................................................................................................................................
A8B830_GIAIC/14-475                  ...........................................................................................................aa---AIVLAMSIY.I......LLYW..SRP...S...DKWVe..................................................lPSRILVVFSL..FFLFMLPV.MIPLDRAN..SSTFNA...T................................................................................................................................................................sP-----.V..GI....N...P.....T.I.MS.YI...WVGLMLFAIFLAT................FL..LP.LCY.F....Y....I........S........S.......RnaG...E....T.I.GR...................................................SLL.G....GLWK..A...A...VIIA..S...T..L..LL..SA.FL..WWl.......lEVRN.T.C.PK.QTTN......Alaaperil...........................................................................................kastsstmpIYIYFI..VF..ACFL.G.S.IIF....VLFLSVG.LFIY.......................................PVSYII...................RF.IKR..PHSM-NKDE..LL..TFK...QR..YKQ.R.S...LNLLK...EY...DRIYE.L.LIK.E..Y.SR-...................................................................----..DH.VERMIK..........................................................................................................................................R-..--.-..--.-.-----NER.SA-..------..--L....................................fSRSSLRKEA.R.NF.............................................EK.LERDLEEMER.EYT...DTLAMN..----....................................................................................................................---------.................................................................................................................................................----IKET.A..NP...L...K...YYLL....LV....LG....IF.F.L.IVSVLWYIQIIA..AAL........................................................PKP..FY....IL.DK.A...FA..A..M.D..S.AL.PF..P.ILSI........-IFYSS....LA.I..Y..I...L.FC.FVNGVT....ILGLk..fVF................F.M.KIYPm.eRNNTPLV..GFVFNSMM......MCVGAL..pS.LL....FLI.V..MMS.EYTN--.......................................----.-----....-..---........-...--....--..----....--...--.----.--------asgvyklfkdtvanackfdawflnmywaivalspvaval............................................................................................................................................................................
U3FZM7_MICFL/19-257                  ............................................................................................................l-ALLVILVFCWV.Y......VRKY..QCR...R...ESEV....................................................ISTITSIFAL..AIALITSA.LLPVDIFL..VSYVKN..qNgtfkd......................................................................................................................................................wadanvT-----.R..QI....-...E.....D.T.VL.YA...YYTLYSIILFCVF................LW..IP.FVY.F....Y....Y........E........E.......K..D...E....D.D.GN...................................................--A.C....SVKT..A...V...KYTL..G...F..L..LV..CT.VL..LM.........IGAF.V.P.LE.IPNK......Knstewekikll......................................................................................feelgsshglaALSFSI..SS..LTLI.G.M.VAA....ITYTAYG.MSAL.......................................PLNLIKg................trN-.-AS..Y--------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------erlentediedveqniqriqskcrdgr........................................................................................................................................................................................
C7YNK4_NECH7/19-518                  ............................................................................................................l-ALLVISLVVLL.I......LRYY..LPL...R...TTPA....................................................FYLLPIFFAL..WLPSIVVI.LVPIDLAS..SATTGD...Eat.............................................................................................................................................................rgI-----.-..WL....P...E.....R.V.LL.VS...WRITYWLTFALTW................FI..LP.ILA.E....Y....A........D........A.......G..Y...R....E.P.YD...................................................KFM.Y....SVRS..N...A...MFHA..I...V..L..SL..GS.VG..LI.........YVFV.Y.-.YG.FNFT......S............................................................................................................VKALVM..AL..AYCW.G.L.ILA....IYLMGHG.LVSI.......................................PRRLMR...................GA.SIS..GRLRRLQSK..AP..KVY...EQ..MED.S.I...ANLED...IE...VQVVE.L.GRR.K..T.GSA...................................................................LAFR..DW.IEELQE..........................................................................................................................................MA..NI.P..ES.Q.P---RPSR.FGT..GTDSA-..--Iip................................hviTEKYLADLT.R.KY.............................................VR.ARHTRSRYVN.AWS...ELVQEA..AETQ....................................................................................................................NILDSAGSKklelgdvsph.............................................................................................................................agfwekmvilTPYTRYLY.Y..YH...L...L...PYGQ....VL....LG....LF.L.A.AASACIVWSEFV..KIA........................................................-FP..KL....SV.IR.L...TV..V..H.H..W.VG.DK..A.EVGFa......gQVISSL....WI.C..Y..M...C.AA.ALISMT....EVKV....WR................G.R.ALVR...-RNTAHE..SAFWYAMQ......VAKLTI...P.IS....YNF.V..TFL.SKDVYN.......................................KTTF.YKFLG....V.lVDF........T...P-....LG..RYFD....DL...FP.VLVL.FPVFATLF...................................................................................................................................................................................................................
H2TMI6_TAKRU/242-446                 ......................................................................................lqeealqrrlndrsnckiplpgk------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................-T.LNKELDNVRN.QRN...KLERR-..----....................................................................................................................---------.................................................................................................................................................-KKASGWE.K..NV...L...Y...PMVM....LI....LL....AG.T.T.ISVFMVAFNILY..LLV........................................................-DE..TA....MP.KG.S...TD..R..G.I..G.NT.TL..S.TFGVa......qAVLQIV....LM.F..Y..L...M.VS.SVVGFY....SLRA....--................F.A.QLTP..rKDDTTMT..TIIGCCVS......ILVLSSa.lP.VM....SRT.L..GIT.TF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAVVTTLC...................................................................................................................................................................................................................
Q8NDP7_HUMAN/1-127                   ............................................................................................................m------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...---L..L...L..L..AL..LI.LG..IV.........WVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRMftvmg.............................qllvkP-----...................--.---..TILEDLDEQ..IY..IIT...LE..EEA.L.Q...RRLNG...LS...SSVEY.N.IME.L..E.QEL...................................................................---E..-N.VK----..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------tlktkl.............................................................................................................................................................................................................
G0U669_TRYVY/11-294                  .........................................................................................................avaa----FVVALVLY.F......VSIF..GCD...T...DSNDt..................................................wLPKLVVVTSL..SFACYNVL.LLPFDVAI..-MRSGS...Sv...............................................................................................................................................................aH-----.-..--....N...E.....L.L.VE.IL...LVLTVAVIIIHCF................FM..CP.FAM.V....Y....Y........E........Ti....dpD..Y...T....T.V.WK...................................................KVR.R....AATL..T...S...ILAL..S...F..C..LL..FV.AL..WLs......igYSVF.D.-.--.YDLY......Tiktspqgniskied...............................................................................fedayapavlrfhvsPFLYLV..AF..TCVV.G.W.SLF....FVFGGVG.FVNI.......................................PADLLT...................SF.---..-LHRPKPIT..AA..EYA...ER..RSE.I.A...EESQN...LI...EEGRA.L.EME.G..D.SGKddvkyrrk...................................................vllfkrkvS---..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------elekyynkietsyhkqgg.................................................................................................................................................................................................
W2MWK9_PHYPR/8-540                   .........................................................................................................lamc----GLLGFTWW.L......LTHY..KD-...A...KVPT....................................................VVHAAVFSTW..VLGFLGLI.LLPMDLAT..------...Nglvassq...................................................................................................................................................sagnvaeE-----.-..KA....S...F.....R.E.YL.AV...WRLLYWATFLMSW................VG..LP.FLV.E....F....R........Q........N.......G..E...F....E.L.DK...................................................RIL.S....SFRH..L...V...FHWT..V...L..A..GG..LF.IV..AL.........YLIL.V.-.DH.LSLY......G............................................................................................................VLGLAM..AA..SNTY.G.L.LWV....IALLGYG.LVEI.......................................PRGFWI...................RR.LDG..AQLQILHFE..AV..QLQ...DE..RME.A.R...FEYDD...VV...ADVHD.A.YQR.M..V.QAEsdaii.........................................................ltsemQ---..-Y.VKTCLLqvvaaiekskpaf................................................................................................................rrldtsndtkrgsKS..VS.F..SD.S.KMKR----.---..------..--Gvsnigr.........................asrkapTLTETIELH.R.RV.............................................RI.AQLELRRCDQ.AFL...ELCINV..----....................................................................................................................DILQDRSAQralpagslyp............................................................................................................................etsalnrlhniFLNMRHQL.R..QW...V...T...SPVA....IV....CA....VV.T.G.FLSLCVVWGELT..MGW........................................................RRS..SL....SL.FR.F...MI..A..V.E..A.ME.TS..S.SLRSa......tELISAL....VL.V..Y..L...A.LC.CYRSLF....TLRL....PG................K.Y.VLRA...HGNSTEL..CLLKTSIY......QCRLQF...A.LG....QNA.L..LLL.RGGGLA......................................eGTAF.NALLA....N..TRV........V...HV....FG..RGFA....VY...AP.LAMI.ALAVFT--lt.................................................................................................................................................................................................................
F7AVT2_HORSE/1-274                   ............................................................................................................v-LFQAILAFCWI.Y......VRKY..QSQ...R...ESEV....................................................VSTITAIFSL..AIALITSA.LLPVDIFL..VSYMKN..qNgtfk........................................................................................................................................................dwanaN----V.S..RQ....I...E.....D.T.VL.YG...YYTLYSVILFCVF................FW..IP.FVY.F....Y....Y........E........E.......K..D...D....D.D.TG...................................................KC-.T....QVKT..A...L...KYTV..G...F..A..VI..CA.LL..LL.........VGAF.V.P.LS.VPNS......Rnstewekvkfl......................................................................................feelgsshglaALSFSI..SS..LTLI.G.M.LAA....ITYTAYG.MSAL.......................................PLNLIKgtrs...........aayeRL.ENT..EDIEEVEQH..IQ..TIK...SK..SKD.G.R...PLPAR...DK...RALKQ.F.EER.L..R.TLR...................................................................K---..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------rerhlefiensw.......................................................................................................................................................................................................
W9YJK0_9EURO/13-509                  ............................................................................................................v-AFSTISIAVLV.L......LRRY..LPL...R...TTPA....................................................FLLVPIFFSL..VLPASAIL.LVPIDLAS..SARESE...Hgg.............................................................................................................................................................kgI-----.-..WL....P...K.....R.A.VL.VS...WRIVYWLTFVLTW................VV..LP.LLG.E....Y....V........D........A.......G..Y...R....D.P.RS...................................................RMI.Y....SLRA..N...A...RYQL..I...V..L..GC..AV.AG..LV.........YMIF.S.-.YG.FDFT......A............................................................................................................IRGLVM..AL..AYVW.G.L.ILA....IYLMGHG.LVAI.......................................PRKMFR...................KA.NIS..DSLRRVQAQ..AP..PVH...EK..LED.A.I...LALEE...LG...AQVMQ.L.KQR.K..T.GTA...................................................................RDFQ..EW.IEELVD..........................................................................................................................................M-..TG.Q..LE.S.RVFANPIT.VDA..---SAK.vP-Av...................................vTERYLADLT.R.RL.............................................VR.ARHRRARYIR.EWD...NIVQTA..ADLQ....................................................................................................................AILDSKASKkldfgraps...............................................................................................................................slfgrvsflTPFMRYHL.Y..VH...V...V...PALR....IA....LG....GL.F.S.LASVAIIWSEMI..KFP........................................................-AP..HL....SA.VS.L...TV..I..H.H..P.SN.HN..Y.QIGFg......gQLVSSM....WI.T..Y..M...C.VC.ALSSFS....DVPT....WR................Q.R.ALVK...-RNTYPE..SACWYSGQ......IAKLTV...P.LA....YNF.L..TFL.PKDIQQ.......................................TSTF.YNFLG....R.lINL........T...P-....LG..TWFD....YL...FP.MFIL.VPVCATLF...................................................................................................................................................................................................................
H2LTX9_ORYLA/25-270                  .............................................................................................................LLFTCLYMVCYL.V......LTHF..KKT...A...E--Fltddie........................................datvnkIALWLCTFTL..SVAVCAVL.LLPISILS..------...Nevl...........................................................................................................................................................ltfPHSYYM.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SK...................................................---.K....GVMA..R...V...YEAV..V...L..L..LL..LA.LL..VLg......ivWVAS.A.L.LH.DNIA......Rksly...................................................................................................dlweyYLPYLY..SG..ISLF.G.V.LML....LLCTPFG.LSRMfsvtg.............................sllvkPRL---...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lediedtlscsmfeenslrrklncgnkscwsklnmealrqe..........................................................................................................................................................................
Q584V8_TRYB2/12-486                  ...........................................................................................................fs---ITTFFVTLG.L......QWHY..TRV...S...YKTMp..................................................fLCPVFIVIAV..YASLMPFP.LLVVDIGA..AIESMN..gGd...............................................................................................................................................................aP-----.-..--....K...E.....E.W.MI.PV...WYTIMIVTYVMGW................VV..LP.ISQ.S....Y....T........E........V.......G..G...F....T.V.RR...................................................KLV.S....SIKV..N...A...KLYA..I...Y..T..CI..FA.VL..FA........yVVVL.K.G.AY.TSLT......S............................................................................................................IGNLAT..AL..ANAW.G.L.LLL....VLFMSTG.IVGV.......................................PKVLWR...................KS.NPI..RMLREVYYS..AV..EIQ...ED..LDI.A.V...LDLTE...VR...TELMA.I.SSA.V..P.EEH...................................................................R---..PY.WTRMIElides................................................................................................................................dgrssQF..PM.P..TS.-.--------.--R..TNAVGK.rTEId...................................vSLEHLEQLH.E.RV.............................................KG.SIKIAQRMTY.RWD...ATVRDA..KFYE....................................................................................................................MLARGSKAT.................................................................................................................................................NNGFKKVW.F..PM...R...G...-IIL....KL....LA....LL.C.G.VITLLILWSEVT..LPF........................................................R--..PL....TE.KS.I...SV..V.aI.M..A.NS.GW..E.L--P........--ASVI....FL.F..Y..M...A.YC.SYWAIF....QLKV....FD................I.Y.VILP...-EISDNS..SLCFGATF......LSRLIM...P.LC....FNF.L..LMA.DMANGA......................................vDVMY.GHVYR....D.nMDA........S...YI....LG..DWLN....RF...LP.AIIV.LVSLLV--fv.................................................................................................................................................................................................................
W2FS91_PHYPR/15-310                  ..................................................................................llyasvalvllllstglvlyaqpknga------------.-......----..---...-...---Ssslaafagtst..............................lsaapltvssrFVNIVCILAL..YVALLCLF.TAPVDVYL..------...-.................................................................................................................................................................-LENAL.P..HV....P...Sn...vR.A.LR.VM...YQVYFAALALYSF................VG..AP.LAF.N....Y....A........K........Q.......T..E...I....A.H.LTlkf............................................sardRLY.A....AIKR..T...S...CFLL..G...L..S..FL..LV.IL..MV.........VLLC.G.K.PA.S---......Sdidwlrpl...........................................................................................lkfssdletFLRLLV..GI..LALT.G.M.YLW....LFVCSRG.LASV.......................................PLVGLLmed.............hsiDE.NMT..TFEDLLQEN..AM..---...--..ETQ.A.T...KQTRE...TI...LQRYV.V.EQQ.M..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sgadqerlsqlktreklleerrevlkanlqrfa..................................................................................................................................................................................
F1SHV3_PIG/12-93                     .............................................................................................................LLFAILYVVSYF.I......ITRY..KRK...S...DEQEdeda............................................ivnrISLFLSTFTL..AVSAGAVL.LLPFSIIS..------...Neil...........................................................................................................................................................lsfPQNYYI.Q..WL....N...G.....S.L.IH.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------g..................................................................................................................................................................................................................
A8K4S2_HUMAN/26-281                  .............................................................................................................LLFAILYVVSYF.I......ITRY..KRK...S...DEQEdeda............................................ivnrISLFLSTFTL..AVSAGAVL.LLPFSIIS..------...Neil...........................................................................................................................................................lsfPQNYYI.Q..WL....N...G.....S.L.IH.GL...WNLASLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................---.K....GIRA..R...I...LETL..V...M..L..LL..LA.LL..ILg......ivWVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRMftvmg.............................qllvkP-----...................--.---..TILEDLDEQ..IY..IIT...LE..EEA.L.Q...RRLNG...LS...SSVEY.N.IME.L..E.QEL...................................................................---E..-N.VKT---..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lktkler............................................................................................................................................................................................................
G3VS14_SARHA/8-520                   ............................................................................................................l-EIVFVFFLALL.I......LHRY..GDF...K...KQHR....................................................LVIVATLLAW..YLCFLIVF.ILPLDVST..TIYNRC..kQaansspsennnit.......................................................................................................................................gsysaaapvtgkhPCFKPW.S..YI....P...D.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PN.LHLEw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSHWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...IM...ECPTE.Y.QEK.M..G.RNM...................................................................DDYE..--.------..........................................................................................................................................--..--.-..--.-.--------.--D..FDEKH-..-NTy...................................pSEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWR...ILLEQA..FYLE....................................................................................................................DVAKNETSAtrqfvhtfqpq...........................................................................................................................epenrfiqyfySPTIEWYW.E..CL...L...R...PWFY....RI....LA....VV.L.A.IFSVIVVWSECT..FFS........................................................TKP..VL....SL.FA.V...FI..-..Q.L..A.ER.TY..N.YIYI........EIACFL....SI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDSTIshq.................................dtqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
G3IKM4_CRIGR/1-410                   .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PR.LHLEw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSYWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...VM...EEVRK.V.NES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.D..YQ.E.KMGRNMDD.YED..FDEKRN..TYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWQ...ILLEQA..FYLE....................................................................................................................DVAKNETSAthqfvhtfqsp...........................................................................................................................epenrfiqyfyNPTVEWYW.E..CL...L...R...PWFH....RI....LA....VV.L.S.VFSVIVVWSECT..FFS........................................................TTP..VL....SL.FA.V...FI..-..Q.L..A.EK.TY..N.YIYI........EIACFL....SI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDSSIshq.................................ntqPTAY.TS---....-..---........-...--....--..----....--...--.----.--------vs.................................................................................................................................................................................................................
F6Y2U7_CIOIN/8-550                   ............................................................................................................f-ELIVVFCVAVF.L......LHHY..GRI...T...KQHP....................................................AVTVATLVAW..YFSMIIVF.ILPLDVSS..TFYREC..lQssrvienvtdssdv.....................................................................................................................................iadndsnkiiyvanTCEKPW.S..YV....K...K.....D.T.LP.AM...WHIVYWTSQFLTW................LV..LP.FMQ.S....Y....V........C........A.......G..D...F....S.T.LG...................................................KMK.R....AVIE..N...A...VYYG..S...Y..L..FI..FG.CL..LI.........YVAA.A.-.PD.LSLDl....kQ............................................................................................................LKVILI..TA..SNTW.G.L.FLL....VLLLGYG.LVEV.......................................PRGLWH...................AA.DNA..ISMAQTYFK..LS..KLS...TE..KQE.A.L...EDLED...VL...EEVKK.V.SSI.V..R.YNH...................................................................P-VR..KY.VSEIIL..........................................................................................................................................KC..PE.D..LR.S.QMSQGMDD.YED..YENSGR.sRNEv...................................pSENSLVKLH.R.KL.............................................IR.AVHTKKRTAV.QWR...ILMERG..LHLE....................................................................................................................NIAKNEISIdrywreefptt...........................................................................................................................eprnavskfmcTPGTKWWW.Y..CK...I...Q...PLAR....RI....LA....VC.L.I.LLSIMVVWSECT..FFN........................................................EKP..VL....SL.FA.I...FI..-..N.L..A.KK.NY..D.YYYI........ELASCL....TI.S..Y..L...C.VC.AYYTVF....RLKV....FN................F.Y.YIAG...HHQTDET..SLLFVGIS......LCRLTA...P.LC....LNF.L..GMI.HLDTHItad.................................tgvETAY.TQIMG....H..LDV........I...SF....IS..DGFN....IY...FP.ILVC.VLCVGTYF...................................................................................................................................................................................................................
H3DN30_TETNG/8-553                   ............................................................................................................i-EIVVVFFLALF.L......LHRY..GDF...K...KQQR....................................................MVLFGTLLAW..YLCFLIVF.ILPLDVST..TIYNQCk.iDqkqksvstlapspan..................................................................................................................................httanvttaptksvptPCYKPW.S..YI....P...D.....G.I.MP.VF...WRVVYWTSQCLTW................LL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.SL..LI.........YVAV.H.-.PA.WHLSw....yE............................................................................................................LQTIGI..TA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSYWN...................AS.RHG..HLLIKTYFK..AS..KLM...TE..KAD.A.E...ENLED...VM...EEVRK.I.SES.I..K.YNH...................................................................P-LR..KY.VDTILR..........................................................................................................................................KC..PV.E..YQ.E.KMGRNMDD.YED..FDDKQN..TYP.....................................SEKSLAKLH.K.QV.............................................IY.AVQRHNRTRV.QWQ...MLLQQA..-IHE....................................................................................................................DVAKNETSLthqfvhsfpsfe........................................................................................................................pagwftrfvytptVGLTEWYW.E..CL...L...K...RWFY....RL....LS....VT.L.T.LFSVAVVWSECT..FFS........................................................TRP..VL....SL.FA.V...FI..-..Q.L..A.EK.DY..N.YLYI........EMACFI....TI.F..F..L...C.TC.VYSTVF....RIRV....FN................Y.Y.YFAS...HHQTDAY..SLQFSGML......FCRLTP...P.LC....LNF.L..GLI.HMDSAIshq.................................qkeQTAY.TSIMG....S..MRV........L...SF....IA..NGFY....IY...YP.MLIV.ILCIATYF...................................................................................................................................................................................................................
F1QF10_DANRE/18-303                  ..........................................................................................................ftv-VLLVILAFCWV.Y......IRKY..QSR...Q...ESEV....................................................ISTITAICAL..AIALITSA.LLPVDIFL..VSFMKH..pNgtyk.........................................................................................................................................................ewaaN-NETR.V..QI....E...D.....T.V.-L.YG...YYTLYSIILFCVF................LW..IP.FVY.F....Y....Y........E........E.......K..D...E....D.N.NN...................................................--K.C....LQVK..N...A...LKYT..I...G..F..VI..VC.SA..LLli.....gtFVPL.A.S.PP.NQNS......Tqwqkvqylf.........................................................................................eelgsshglaALSFSI..SS..LTLI.G.M.LAV....ITYTAYG.MSVL.......................................PLNLIKgtrsvly....erlentedTE.EVE..HQIDKLKAK..CA..DGR...PL..SMR.D.R...RNLQD...LE...DKLQL.L.HRR.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------grhleiaernccnkvgsalr...............................................................................................................................................................................................
LMBD1_ASPFC/15-253                   ............................................................................................................i-VIFVLIVVASV.F......IHVY..QTP...R...DRSS....................................................FVTFICVFSI..AALLATVM.LLPVDVAL..VSSTI-...Ssalg........................................................................................................................................................qreewATQEEV.D..KI....T...Y.....S.L.-T.II...YYSLYFLDALLCF................VG..IP.FAY.FwheeY....D........E........V.......A..F...E....A.G.DQ...................................................TAC.K....RFWA..A...T...KYTL..T...F..I..AV..VI.AL..VL.........VGFF.A.-.PM.MESQ......Pghdlgywrg..........................................................................................ylienqgehAFTFLL..GF..VTII.G.S.CLY....AFYTPSG.LAML.......................................PALFLR...................KS.S--..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sfatqtlggstamelnfnrerqrqlegrc......................................................................................................................................................................................
M0SFK9_MUSAM/65-541                  ............................................................................................................v-VSALVLLVSVY.L......LVNY..QHP...D...DHNQa..................................................yFPKLVVVLGI..SIAAISIL.MLPADVAN..--RQAC...Rhaiyng.....................................................................................................................................................acsltlP-----.-..--....-...-.....-.-.MK.QL...WLAVYIADAILVF................FV..IP.FAM.F....Y....Y........E........G.......D..Q...D....K.G.IG...................................................---.-....KRLK..S...A...LLWV..V...T..S..AI..VC.GL..LLg......ilYGLV.G.K.VD.FTVR......Hlsssaesfpsswtgfsrsqpcis..............................................................ssrlcdayiapatsektwtmrtsFPEYVV..AL..ATIV.G.S.VLF....TIFGGVG.IACL.......................................PLGLIF...................S-.---..---FIRRPK..AV..ITR...SQ..YIK.G.A...TDLGK...KA...RELKK.T.IET.L..H.QEErsg.............................................................skgRKWR..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................--KNLKEAE.K.EL.............................................FL.LEDDMKALEE.MYP...QGEQA-..----....................................................................................................................---------.................................................................................................................................................---ETVWA.L..TV...L...G...YLAK....FV....LG....VV.G.L.IVSVAWVAHIVI..YLL........................................................INP..PL....SP.FL.N...EV..F..I.K..L.DS.VW..G.LLGT........-AAFAI....FC.F..Y..L...L.LA.VIAGEM....MLGL...kLV................F.F.TIHPm.kWGGTLMN..SFLFNVGL......ILLCS-...-.--....---.I..SVI.QFCASAfay.................................ysqATAA.QEIFG....H.tLQS........L...RG....IK..YLYK...yNV...FQ.YGFVgFAVLTL--fy.................................................................................................................................................................................................................
LMBRL_PONAB/263-450                  ....................................................................................................lpldmellh------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.--RQVLALQT.QRV...LLEKRR..----....................................................................................................................---------.................................................................................................................................................--KASAWQ.R..NL...G...Y...PLAM....LC....LL....VL.T.G.LSVLIVAIHILE..LLI........................................................-DE..AA....MP.RG.M...QD..A..S.L..G.QV.SF..S.RLGSf......gAVIQVA....LI.F..Y..L...M.VS.SVVGFY....SSPL....--................F.R.SLRP..rWHDTAMT..QIIGNCVC......LLVLSSa.lP.VF....SRT.L..GLT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNAA.FAGLTTLC...................................................................................................................................................................................................................
Y3707_DICDI/12-493                   .........................................................................................................vipa----LVVLASLY.L......IAYF..QHP...D...DKNVa..................................................yFPKIIVILGL..TLAATSIL.MLPLDVAN..------...Dggs...........................................................................................................................................................ggfP-----.-..--....-...-.....-.-.MD.IL...WIIIYIAVAVFAV................VI..CP.FAM.F....F....Y........E........S.......E..E...A....D.P.GA...................................................--G.S....QIAG..A...F...KGTF..A...I..L..FA..FT.AL..TIv.......lYVFF.G.V.AE.IPTI......Vvlgrfqvlnypfmsdisnityalpeiaaiiggnd........................................erirfdpgnpdllgdgseyveyrldkeflqfrvsIALFII..TM..VAFF.G.W.LLF....IIFGGIG.LVAL.......................................PFDMIG...................D-.---..---FKNRPQ..RI..P-Y...DK..YLE.R.K...KKIGE...RA...TELVE.I.GKT.I..Q.SRT...................................................................---S..--.------..........................................................................................................................................--..G-.G..I-.-.-----MSK.---..------..--R.....................................DRKNYNRFR.Q.AI.............................................FL.LEEDYERLKI.SYK...RQGGKV..----....................................................................................................................---------.................................................................................................................................................--------.-..--...I...F...YYAQ....FF....GG....FV.A.L.GVSLGWLLHIII..YMI........................................................TAP.ePF....HP.FL.N...SL..V..I.A..L.NN.AW..G.FLGV........-IVYGL....LS.F..Y..L...L.FC.VVKGNF....KFGLr..lFF................L.F.PIHPm.rVGNTMMN..AFLFNVGL......ILITS-...-.--....---.V..SIT.HFCTMAfsq.................................ftsTTAI.NSLFE....T.aVKN........L...KI....LK..WFWV....VY...IF.GVFV.MAVLTAIF...................................................................................................................................................................................................................
V4RXD8_9ROSI/1-365                   ......................................................................................................mhkirsr------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......G............................................................................................................VLGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKSCWK...................NA.DWT..TRQKVLSHK..IA..KMA...VK..LDD.A.H...QDLSN...AI...VVAQA.T.SNQ.M..S.KRD...................................................................P-LR..PY.MNVIDD..........................................................................................................................................ML..TQ.M..FK.E.DPFFKPQG.GRL..GENDMD..YDT.....................................DEKSMATLR.R.HL.............................................RR.AREEYYRYKS.EYM...TYVMEA..LELE....................................................................................................................DTIKNYDRRsstgwkyissf...........................................................................................................................rpartgkigalLDTVEFVW.K..CI...L...R...KQIQ....KL....LA....II.L.G.TMSAAILLAEAT..LLP........................................................SGV..DL....SL.FS.I...LV..-..-.-..N.SV.KS..E.EVFV........QLFAFV....PL.M..Y..M...C.IC.TYYSLF....KVGM....LM................F.Y.SLTP...-RQTSSV..NLLMICSM......IARYAA...P.IS....FNF.L..NLI.SLKEGR.......................................RTIF.EKRMG....N.iDSA........V...PF....FG..EGFN....KI...YP.LIMV.IYTLL---vas................................................................................................................................................................................................................
E1QCE6_MYCPB/3-269                   .........................................................................................................lfin------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................--RFAK..TI..ILFF.G.M.LVF....LVLLGLG.GAALyfkdnaakl....................yidtrksidsSFDSSQ...................AF.IDT..YNGSSSKFS..VE..SIN...KQ..IEE.V.K...KKVEE...ST...KKLEE.Y.EKQ.I..N.QAKglngylvspek.............................................lkelqeakkslQATK..SQ.IEKYAN..........................................................................................................................................TL..KT.A..NN.G.KTGQNGTS.SST..------..--Ipitk............................isgstISVSTRDTN.G.KT.............................................NS.ALKDIQEFST.QAN...DIIKQY..----....................................................................................................................---KEIKNK.................................................................................................................................................IPTEK-QF.N..EY...Y...T...IGAI....TL....VS....VS.G.G.VLAVLIVSTVMT..FLG........................................................-SK..KL....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------glrtfsrltstdqiadhvnd...............................................................................................................................................................................................
G9K8B9_MUSPF/1-274                   ............................................................................................................a-----ILAFCWI.Y......VRKY..QSQ...R...ESEV....................................................VSTITAIFSL..AIALITSA.LLPVDIFL..VSYMKN..qNgtfk........................................................................................................................................................dwanaN----V.S..RQ....I...E.....D.T.VL.YG...YYTLYSVILFCVF................FW..IP.FVY.F....Y....Y........E........E.......K..D...D....D.D.TS...................................................K-C.T....QIKT..A...F...KYTL..G...F..A..VI..CA.LL..LL.........VGAF.V.P.LN.VPNN......Knstewekvkfl......................................................................................feelgsshglaALSFSI..SS..LTLI.G.M.LAA....ITYTAYG.MSAL.......................................PLNLIKgtrs...........aayeRL.ENT..EDIEEVEQH..IQ..TIK...SK..SKD.G.R...PLTAR...DK...RALKQ.F.EER.L..R.TLR...................................................................K-RE..RH.LEYI--..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------enswwtkf...........................................................................................................................................................................................................
X6P0L6_RETFI/8-216                   ....................................................................................................krdeqkgcw------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................--S.S....QICE..G...V...KWAI..G...F..L..GV..FS.LV..LIl.......mWAFL.H.Q.AD.LPVT......Yrgfawnspdlrvhhsitenikdg.............................................................tsfgycvtaegcgkkhltlhvqvtIGVFLM..AM..LSFL.G.W.FLF....CVFAGIG.LVAL.......................................PIDLFN...................S-.---..---WKHRPK..PI..PL-...DK..YAE.E.K...RKIGQ...RA...AMLRE.A.GNE.I..R.KDElnal..........................................................grktsRKEK..RE.LTET--..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------fhrfenvlflcskkkkkkttkqp............................................................................................................................................................................................
D8S065_SELML/5-111                   ...............................................................................ndfsslnakasclvsagfslfsnvtlmlic------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.LD.LWLK......L............................................................................................................SVTYVI..TL..NTII.G.S.ILF....MLFGGVG.MATL.......................................PVSLIF...................A-.---..---FKNRPK..CV..ITR...VM..ALQ.E.A...TDLAK...RS...NELKT.A.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------tlgl...............................................................................................................................................................................................................
H2QQR9_PANTR/8-546                   ............................................................................................................l-EIVFVFFLALF.L......LHRY..GDF...K...KQHR....................................................LVIIGTLLAW..YLCFLIVF.ILPLDVST..TIYNRC..kHaaanssppensni......................................................................................................................................tglyatanpvpsqhPCFKPW.S..YI....P...D.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PH.LHLEw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSYWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...AM...EEVRK.V.NES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.E..YQ.E.KMGRNMDD.YED..FDEKHN..--Iy...................................pSEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWQ...ILLEQA..FYLE....................................................................................................................DVAKNETSAthqfvhtfqsp...........................................................................................................................epenrfiqyfyNPTFEWYW.E..CL...L...R...PWFY....KI....LA....VV.L.S.IFSVIVVWSECT..FFS........................................................TTP..VL....SL.FA.V...FI..-..Q.L..A.EK.TY..N.YIYI........EIACFL....SI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDSSIshk.................................ntqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
G0S5B5_CHATD/16-511                  ............................................................................................................l-ALAAISIIVVL.I......LRHY..LPL...R...TTPA....................................................YLLVPVFFAL..ALPASMVL.LVPIDLAS..ATKSP-...-.................................................................................................................................................................--ETSA.I..IL....P...H.....R.A.IL.VA...WRIAYWLTFALTW................FI..LP.VLG.E....Y....S........D........S.......G..Y...R....E.P.RE...................................................KLE.D....SLRA..N...A...QYYA..I...M..F..GL..GI.VG..LF.........YVFL.S.Y.GH.FSTS......-............................................................................................................LKSTVM..AL..AYCW.G.L.ALA....IYLMGHG.LVAI.......................................PKRLVR...................WA.DVR..GRLRRIYAR..AP..KVY...DK..LKD.A.E...MALEE...LE...AQVAE.L.SRR.K..G.GSA...................................................................SLFQ..DW.IEELVD..........................................................................................................................................LT..NL.P..ES.Q.PGRVAPVA.--P..VSASSS.aLPNv...................................iTAKFLASLT.Q.RL.............................................LH.ARHSRTRYAA.EWS...RLLRSA..VRTQ....................................................................................................................AIVESAASKrlvftndps...............................................................................................................................tlwsrisplTPYTRHLL.H..FY...L...L...PFLS....LA....LG....AV.L.A.LASFVIVSSELL..KPF........................................................-FP..HA....AP.IR.L...TV..-..L.S..S.GN.KI..A.LFPG........QAISSL....CL.S..Y..M...S.LA.TLYSLT....ELPLt..iWR................G.R.ALVR...-RNTSHE..SAFWYASQ......IARLGV...P.LT....YNF.A..TLL.GDEVYH.......................................RTVF.YNFLG....S.gINL........T...P-....LS..SWFD....WL...FP.VFIL.FPVG----mal................................................................................................................................................................................................................
F1RTT5_PIG/23-297                    ............................................................................................................l-LLLAILAFCWI.Y......VRKY..QSQ...R...ESEV....................................................VSTITAIFSL..AIALITSA.LLPVDIFL..VSYMKN..qNgtfk........................................................................................................................................................dwanaN----V.S..RQ....I...E.....D.T.VL.YG...YYTLYSVILFCVF................FW..IP.FVY.F....Y....Y........E........E.......K..D...D....D.D.TG...................................................KC-.T....QIKT..A...L...KYTL..G...F..V..MI..CA.LL..LL.........VGAF.V.P.LN.VPNN......Knstewekvkfl......................................................................................fqelgsshglaALSFSI..SS..LTLI.G.M.LAA....ITYTAYG.MSAL.......................................PLNLIKgtrs...........aayeRL.ENT..EDIEEVEQH..IQ..TIK...SK..SKD.G.R...PLPIR...DR...RALKQ.F.EER.L..R.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------tlrkrerhlefiensww..................................................................................................................................................................................................
M7WYQ9_ENTHI/7-491                   .............................................................................................................LIFILAGIMALG.I......LFKY..INP...L...KTRW....................................................YVVLCSFVGW..YLAFLSPL.LMPLDIVS..TFRS--...-.................................................................................................................................................................--EKDF.L..YI....N...Q.....N.V.LI.VI...WWIIYILQFGLCY................LI..FP.IVQ.T....Y....S........I........V.......G..D...F....T.F.IR...................................................KLI.R....SIKR..N...V...IFYG..T...L..I..ML..LI.IF..FI........lFWFF.K.G.DE.LITSg....qE............................................................................................................YFGFAL..TL..SNAW.G.L.ILA....IGLMGNG.YIMY.......................................IYDTIR...................TF.TNK..LELRKNICD..VG..LCN...IR..MTE.S.K...KVLEE...QI...KVIKG.Y.DEI.I..N.EED...................................................................P-LR..PY.VNKCVN..........................................................................................................................................DI..KR.Y..YN.E.KYETSPSN.KVK..N-----..---.....................................NYTELAISN.E.KL.............................................QD.SLRKIIRDEK.LYE...KTITKT..-KQL....................................................................................................................FLIENETDIpel...........................................................................................................................................iqeIPKIKYYY.Y..KY...G...R...WFTN....IF....KT....LL.I.L.IFWIFIIQPELT..MIG........................................................KLK..TI....NP.TI.N...IT..S..S.L.lN.ND.LS..G.WVGV........E--TLI....IL.S..L..M...I.FF.AFSSFI....NIEM....IS................F.F.RITK...HQLSDSY..SIIFAGNY......LSRVGP...A.LA....MNF.I..HMI.NFTSNQysn.................................iqtQTAF.QIVNK....G..MEK........V...PF....FG.rNSFN....DT...FP.MCIFcIMVLSALF...................................................................................................................................................................................................................
G3P330_GASAC/25-251                  .............................................................................................................LLFTCLYMVSYL.I......LTHF..KKT...A...EFVTedied..........................................atvnkIALWLCTFTL..SVAVCAVL.LLPISILS..------...Nevl...........................................................................................................................................................ltfPQSYYM.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVMA..R...V...YEAV..V...L..L..LL..LA.LL..VLg......ivWVAS.A.L.LH.DNIA......Rksly...................................................................................................dlweyYLPYLY..SG..ISLF.G.V.LLL....LLCTPFG.LSRMfsvtg.............................kllvkPR----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lledvedtlsctsfeedslcrkl............................................................................................................................................................................................
I3N7B2_SPETR/8-542                   ............................................................................................................l-EIVFVFFLALF.L......LHRY..GDF...K...KQHR....................................................LVIVGTLLAW..YLCFLIVF.ILPLDVST..TIYNRC..rHaaanssppenn..........................................................................................................................................stavvtpvpsqhPCFKPW.S..YI....P...D.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PR.LHLEw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSYWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...VM...EEVRK.V.NES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.E..YQ.E.KMGRNMDD.YED..FDEKRN..TYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWQ...ILLEQA..FYLE....................................................................................................................DVAKNETSAthqfvhtfqsp...........................................................................................................................epenrfiqyfyNPTVEWYW.E..CL...L...R...PWFY....RI....LA....VV.L.S.IFSVIVVWSECT..FFS........................................................TTP..VL....SL.FA.V...FI..-..Q.L..A.ER.TY..N.YIYI........EIACFL....SI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDSSIshk.................................ntqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
E4XQV6_OIKDI/8-523                   ........................................................................................................felag-----AFLLAAG.M......LWKY..GNL...K...KSTP....................................................GVVLAVFIAW..YFSLCIVT.VLPNDVSA..TFYRQC..lSdksvans...................................................................................................................................................fpydpssLCIKPV.S..YV....D...G.....T.V.IP.RL...YRVVYWTTQLFTW................LL..IP.FLS.A....Y....V........Q........A.......G..E...F....S.V.LA...................................................KAK.T....ALID..N...A...IYYG..I...Y..V..LI..II.VL..LI.........YALA.A.G.LF.QD-Qg...asA............................................................................................................LKQMAI..QA..ANTW.G.L.FLL....VLLLGYG.LVEL.......................................PRSYWH...................RS.SIQ..HQLEWEYFS..LA..KVT...ED..KHE.A.T...EELNL...IL...IEVKK.A.SKG.V..P.FGH...................................................................V-LR..KH.VNTILK..........................................................................................................................................KC..PA.A..FQ.E.EVAREEAQ.NGP..N---ED..LMP.....................................SERSLIRLH.K.KL.............................................NT.ALQRENRTQT.QFK...LFLQRA..LYSE....................................................................................................................DVIKNRLSAdrtwkcny.................................................................................................................................stddntwlPASFKWWW.R..CI...F...R...SHVM....KA....LS....IL.F.A.LFSAMVIWSECT..FSL........................................................QNP..TL....SI.FA.I...LV..-..R.H..W.AS.VK..N.YFNL........ELFCFI....TI.A..Y..L...C.LC.AYWTLF....QIKL....FN................I.Y.YIAP...NHHTDDY..SLLFIGMF......LCRLTP...P.LC....LNF.L..CLI.HMDSGVtdg................................aelvDVAY.TDLSG....H..LSL........I...S-....--..DRFF....IY...FP.ILIV.LLCTGTYF...................................................................................................................................................................................................................
YNC2_CAEEL/74-693                    .............................................................................................................WLFMLLYLFAYW.L......ISRL..KRK...T...EREAlyagee........................................dyfvyrVSVWISSTAT..ATSIGSLT.LLPFSVIG..------...Vell...........................................................................................................................................................qlyDGNYYL.Q..WL....S...Y.....S.L.IG.AL...WNYVFVLSNVSLF................VL..LP.FSY.F....F....I........E........S.......Q..G...F....S.T.SK...................................................-IG.N....DMTQ..R...I...YEAM..A...I..S..FL..FA.FV..LLc......laEVVL.T.I.LD.YPVS......Flsi......................................................................................................tsvNLPLIY..SC..VSFI.G.A.VLL....LISTPYG.FAKMfslardflvteeta..........dieeenseqsedvtePKNSSSdet............ihqvDR.SDT..PHLEDVVND..IT..ENV...DA..DGE.F.R...KDSDS...GI...ESGST.E.EMR.L..N.TDDeemgindsddksafgddgdlgnstptknkkk.....rrkhdyaattpivrkwdkdvpkkpknpnfdyR---..--.-----Nlkeyvkearr.....................................................................................................................qrsslsesddyWF..GS.P..PR.S.SFSANYYS.-SR..FSRWKH.nSETglnps...........................ssllvDPFASGDFH.E.ASsseasstplsp.......................arrtkseeaiwKP.VLHTVKSSKL.YKR...AIEKQG..----....................................................................................................................---------.................................................................................................................................................--RLVKLF.M..SL...R...F...PVAA....AA....LL....VL.T.T.CSLIMVATNTLK..LLF........................................................---..GY....RS.LP.V...YA..Q..Y.I..E.VH.TR..H.SFGLf......gACIETL....LI.I..Y..V...M.IT.SFVGLY....SLPV....--................L.R.SLRP..vRKDTPMP..TIIINSSI......VLVVASa.lP.VA....VNT.V..GMT.TF----.......................................----.-DLLG....S..HSS........L...QW....LG..-SFR....VV...VA.YNTL.FVVLSVAF...................................................................................................................................................................................................................
A0A022V014_TRIRU/15-258              ............................................................................................................v-VVAILIAIASV.F......VYVY..QAP...R...ERSG....................................................LVSAVCILTV..SALLATVL.LLPVDIAL..-ISSTN..sRrlgqrkd...................................................................................................................................................watpdavA-----.-..SI....V...Q.....S.-.LT.IV...YYSLYSLDTILCL................LV..IP.FTY.F....W....Y........Eey...delA.......E..Q...Q....D.W.NA...................................................-FG.K....RFWG..A...F...RYTI..A...F..L..VV..TV.IL..FL.........VGFF.V.-.PV.ARNR......Agagldldyfk........................................................................................hlltenngerALTFAL..GL..LTMI.G.I.IVY....VLYTSAG.LALF.......................................PVSFIK...................T-.APS..VSSPSLYAT..TA..SRL...EE..NVE.R.Q...RQLEG...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------rcggn..............................................................................................................................................................................................................
U1NQR3_ASCSU/324-460                 .......................................................................................walrlwyrsqfawhiigkrpaf------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........KTVALC....LI.S..Y..L...C.IC.VYYAVF....KLRI....YR................Y.Y.RLDP...NHMTDEN..SLLFSAIL......LCRLTP...A.LC....LNV.L..GMV.HLDSHItsqa...............................kfpvETQF.TKLMG....H..LDV........I...PI....LA..KGLN....IY...LP.TCIL.LLCLATYF...................................................................................................................................................................................................................
F7FJY9_MONDO/8-545                   ............................................................................................................l-EIVFVFFLALL.I......LHRY..GDF...K...KQHR....................................................LVIVATLLAW..YLCFLIVF.ILPLDVST..TIYNRC..kQaansspsennsit.......................................................................................................................................gsysavvpdrgkhPCFKPW.S..YI....P...D.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PN.LHLEw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSHWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...IM...EEVRK.V.NES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.E..YQ.E.KMGRNMDD.YED..FDEKHN..TYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWR...ILLEQA..FYLE....................................................................................................................DVAKNETSAtrqfvhtfqpq...........................................................................................................................epenrfiqyfySPTVEWYW.E..CL...L...R...PWFY....RI....LA....VV.L.A.IFSVIVVWSECT..FFS........................................................TKP..VL....SL.FA.V...FI..-..Q.L..A.EK.TY..N.YIYI........EIACFL....SI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDSTIshq.................................ntqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
Q00X06_OSTTA/9-159                   ......................................................................................................laplvtv-----AAVVALV.G......VRAF..AD-...V...SVPV....................................................VARAHVALAW..MLSLAIVF.TVPVDVRA..TVGARA..gV.................................................................................................................................................................P-----.-..--....-...-.....R.G.LE.RA...WEVMYWSTYVATF................VA..LP.VHA.S....Y....E........D........A.......G..D...F....S.T.RA...................................................RLR.R....AARE..N...G...AYLG..V...M..I..AA..CA.IG..AF.........AMMA.T.-.ET.LSAE......T............................................................................................................MRAYGI..VL..ANVW.G.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------yr.................................................................................................................................................................................................................
G5C8R7_HETGA/2-156                   ...................................................................................................ghirtthgsn------------.-......----..---...-...----....................................................IWLFLSTFTL..AVSAGAVL.LLPFSIIS..------...Neil...........................................................................................................................................................lsfPQNYYI.Q..WL....N...G.....S.L.IH.GL...WNLASLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................---.K....GIRA..R...V...LETL..V...M..L..LL..LA.LL..ILg......ivWVAS.A.L.ID.NDAA......S............................................................................................................MES---..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lyvctpvglsrmftvmgqllvk.............................................................................................................................................................................................
H2LTX9_ORYLA/226-447                 ......................................................................kprllediedtlscsmfeenslrrklncgnkscwsklnm------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................EA.LRQEYQT---.---...------..----....................................................................................................................--------Vrtkr........................................................................................................................................valemRRKASPWQ.R..NL...G...Y...PLVM....MA....LL....AL.T.V.MCVLMVCFNVLE..LLL........................................................-DE..TA....LP.RG.M...ED..P..H.L..G.MA.SF..S.MFGSl......gAAVQVV....LI.L..Y..L...M.LS.SVVGFY....SSSL....--................F.S.GLLP..rAKDTNLT..QIIANCVS......LLILSSa.lP.VF....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........Y...NW....LG..-NFY....VV...FL.YNMM.FAGLTS--as.................................................................................................................................................................................................................
W4FYA9_9STRA/40-273                  .................................................................................vlvwlvsylvvisleirplaaheglvss------------.-......----..---...-...---Qp.................................................dtVSRIMSISSL..FFALLCVL.TPPVDVYV..ATTHHL...N.................................................................................................................................................................Q-----.-..--....-...A.....K.A.IG.TF...YNVLFVVLLLYSF................LL..SP.FAY.F....Y....A........K........Q.......S..E...I....H.H.IT...................................................--R.Y....STSQ..R...V...ASAL..K...R..T..AC..FL.CF..MLili..lvvlVIVV.G.-.GK.PK--......Tsdidwlkpl..........................................................................................ldlqtdatlTLHVFL..GL..ILSM.G.M.ILW....IWLGCRA.MATV.......................................PVDGFLrpr.............hndRA.ALS..YLMEEI---..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------eleahsierarqavlrkftv...............................................................................................................................................................................................
D8LWX9_BLAHO/2-220                   .....................................................................................pkerfneekkgiavriqeliaqge------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................SITQMMEGT.K.NS.............................................SL.GWKEKRRLKK.EAK...KALDQY.rAECK....................................................................................................................--------Eldnd........................................................................................................................................ylklrAEHLNYKE.N..NP...L...L...PVAK....LI....LG....IL.S.I.IISILWLLQLIF..YVFpk....................................................qfTGV..SL....FP.FL.N...SM..F..I.G..L.ND.YF..P.ILAS........-VLLLV....FA.L..Y..F...M.FC.TINGGF....SFGL...rMF................L.M.NVHEm.ePHDTLIT..SLVFNGGL......ILMTV-...-.--....---.L..PLL.QF----.......................................----.-----....-..---........-...--....--..----....--...--.----.--------cskafgdyaaqsevidil.................................................................................................................................................................................................
Q38BH4_TRYB2/290-457                 ........................................................................................................qqggk------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..-V...L...Q...GYLC....LL....AG....LV.F.T.FLSIRWILYITL..SNV........................................................-SD..TH....PM.YG.G...ML..R..Q.L..S.DT.SL..T.LCVT........--VYSC....FA.F..Y..L...L.CC.TIKGCI....KLGG...nLA................L.Y.HIYPv.eVSKTLTT..SFLFNAIL......CIITSSavlN.LC....ADS.F..PVY.AVNSDV.......................................SVLF.SVFVA....N..LAV........V...KY....VV..-SYT....--...-P.YFLVvVSCLA---lmwl...............................................................................................................................................................................................................
C5M8D4_CANTT/4-466                   .........................................................................................................tvii--YILILLSSIA.G......INYH..INV...F...KYPA....................................................YLMVPLTLAV..FIPLSLVY.LLPIDWTQ..------...K................................................................................................................................................................tSEGDLW.L..SL....P...D.....N.V.IL.NN...WKVNYWITFALTW................FI..LP.MLQ.E....F....Y........R........S.......G..Y...S....S.T.MG...................................................KIQ.D....AFKQ..N...L...KFQA..M...M..L..GV..SV.LG..IL.........YLML.E.-.AG.LSFN......H............................................................................................................LKLMVI..AL..SHIY.S.L.ILA....TWLMGHG.MISI.......................................PRNCWI...................KG.STA..SELRHNYLR..LL..RLS...DD..LED.T.K...VSFKD...DV...LQVLR.L.KLN.F..T.SDAv................................................................edFEFR..DT.ILGMYS..........................................................................................................................................KI..PE.D..IR.E.QVERQYMH.DNT..IIE--R..DQV.....................................TPTYMSKLQ.S.GF.............................................NN.NLHKYVGYES.AFN...SMISRI..VELE....................................................................................................................KPRTNE---.................................................................................................................................................-------L.K..NW...I...K...PVAN....RV....GA....VI.L.A.MVSFIILESEFF..HST........................................................---..RL....SL.LN.V...CI..F..T.S..G.AF.KN..G.TAQF........-LLAAA....FF.A..Y..M...L.FA.ALSSLT....QLKI....FN................M.Y.HLVP...-RNSDPV..SACWYTMY......TARMAI...P.LS....YNF.I..TLA.VDR---.......................................SCIF.ETWYG....Q.sIKL........T...G-....LF..NLLN....NW...IP.RLIL.IPVFLNMF...................................................................................................................................................................................................................
A0A022VW65_TRIRU/15-258              ............................................................................................................v-VVAILIAIASV.F......VYVY..QAP...R...ERSG....................................................LVSAVCILTV..SALLATVL.LLPVDIAL..-ISSTN..sRrlgqrkd...................................................................................................................................................watpdavA-----.-..SI....V...Q.....S.-.LT.IV...YYSLYSLDTILCL................LV..IP.FTY.F....W....Y........Eey...delA.......E..Q...Q....D.W.NA...................................................-FG.K....RFWG..A...F...RYTI..A...F..L..VV..TV.IL..FL.........VGFF.V.-.PV.ARNR......Agagldldyfk........................................................................................hlltenngerALTFAL..GL..LTMI.G.I.IVY....VLYTSAG.LALF.......................................PVSFIK...................T-.APS..VSSPSLYAT..TA..SRL...EE..NVE.R.Q...RQLEG...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------rcggn..............................................................................................................................................................................................................
D4AQ78_ARTBC/15-268                  ...........................................................................................................av--VAILIAIASV.F......VYVY..QAP...R...ERSG....................................................LVSAVCILTV..SALLATVL.LLPVDIAL..-ISSTN..sRklgqrkd...................................................................................................................................................watpdavA-----.-..SI....V...Q.....S.-.LT.IV...YYSLYSLDTILCL................LV..IP.FTY.F....W....Y........Eey...delA.......E..Q...Q....D.W.NA...................................................-FG.K....RFWG..A...F...RYTI..A...F..L..VV..TV.IL..FL.........VGFF.V.-.PV.ARNR......Agagldldyfk........................................................................................hlltenngerALTFAL..GL..LTMI.G.I.IVY....VLYTSAG.LALF.......................................PVSFIK...................T-.APS..VSSPSLYAT..TA..SRL...EE..NVE.R.Q...RQLEG...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------rcggnldhlsskerr....................................................................................................................................................................................................
V7CR22_PHAVU/7-495                   .....................................................................................................islpltag--------MVLF.T......LRYY..AA-...P...RVPS....................................................YVLFTVGYTW..LSSLSIIV.LVPADIWT..TISSYH...E.................................................................................................................................................................------.-..--....-...N.....G.G.IS.FF...WSWSYWSTFLLTW................VV..VP.LIQ.G....F....E........D........A.......G..D...F....T.V.SE...................................................RLK.T....SLHV..N...L...IFYV..I...V..G..SI..GV.FG..II.........LLIM.M.R.RQ.WSGG......-............................................................................................................LLGLAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKGIWK...................NA.DWT..IRQKVLSHK..IA..KMA...VK..LDD.A.H...QELSN...AI...VIAQA.T.SNQ.M..S.KRD...................................................................P-LR..PY.MNVIDD..........................................................................................................................................ML..IQ.M..SR.E.DPSFKPQG.GQL..GESDMD..YDT.....................................DEKSMATLR.R.HL.............................................RG.ATEEYYRYKS.EYI...TYVLEA..LELE....................................................................................................................DTIKNYDRRnssgwkyissf...........................................................................................................................kaartgkfgslCDALEFFW.R..CI...L...R...KQVQ....KG....LA....VI.L.G.VMSVTILLAEAT..LLP........................................................-SL..DL....SL.FS.I...LI..-..-.-..K.SV.GT..E.EVLV........QAFAFV....PL.M..Y..M...C.IC.TYYSLF....KIGT....LV................F.Y.SLTP...-RQTSSV..SLLMICSM......IARYAP...P.IS....YNF.L..NLI.RLGSDK.......................................TTIF.EQRMG....N.iDNA........V...PF....FG..DKFN....KI...YP.LIMV.VYTLL---vas................................................................................................................................................................................................................
G0UW29_TRYCI/265-456                 ................................................................................rkvlafrqavreleayhttievsyhqqgg------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..TV...L...N...NYLC....LL....EG....IV.F.T.FLSIMWSLHVVV..FNV........................................................-SH..VH....TL.LS.S...TL..R..S.I..N.EL.SV..T.LCVT........--VYSC....LA.F..Y..L...V.LC.TLKGCI....KLGG...nLA................L.Y.HIYPi.dINSTSTA..SLLFNAIL......FLATS-...-.--....---.T..TVL.QFCVYSfrd.................................yavNTWT.NVLFS....V.fVLR........L...DG....IK..YVI-....FY...SQ.YLLVvVACLAL--mw.................................................................................................................................................................................................................
A0A026W6A3_CERBI/8-532               ...........................................................................................................te--IIVAFLLAGT.L......LFKY..GNV...F...RHHI....................................................IVTVSVLIAW..YFSLLIIF.ILPLDVSS..TVFRQC..vEqnihnstki..............................................................................................................................................sdnttvvpfvMCREPW.P..NV....P...D.....N.V.FP.NL...WRIVYWTSQCLTW................LI..LP.LMQ.S....Y....I........K........A.......G..D...F....T.V.RG...................................................KLK.S....ALID..N...A...IYYG..S...Y..L..FI..CG.IL..LI.........YIAL.K.-.PG.LDLDg....qK............................................................................................................LKAIAS..SA..SNTW.G.L.FLL....VLLLGYA.LVEV.......................................PRGLWN...................AS.KPG..YTLNYSYFK..IA..KLS...LD..KCE.A.E...ETVDD...IL...ESLHI.A.TIS.I..G.PGH...................................................................P-FH..CN.LETIFQ..........................................................................................................................................KI..PA.E..LK.D.RMNRRQLP.D--..----DT.pTDT....................................pTEKSLIRLH.R.QT.............................................IK.ALQTLQRIET.QWG...ILVDKI..FSLE....................................................................................................................DVAKNQVSHdrrfkpsfpk.............................................................................................................................hrslpfriiyNPIVEWYW.K..CI...V...Q...SHVL....KV....AA....VC.A.G.CLSVAVVWSEVT..FFN........................................................KSP..VL....SL.FA.Q...FL..-..N.L..A.KR.NY..D.YFTI........EVLSTL....II.A..Y..L...C.YC.AYSTVL....KIRV....LN................L.Y.YLAP...HHQTNEY..SLIFSGMM......LCRLTP...P.MC....LNF.L..GLI.HMDSHIikt.................................hilETHY.TQVMG....H..MDV........I...SI....IS..DGFN....VY...FP.MAIL.AFCLATYF...................................................................................................................................................................................................................
A0A024RZY7_HYPJE/16-276              ..........................................................................................................ava--VLLCLGAAIV.T......TFTW..QTP...I...DRSA....................................................MVSIVAIVSL..TSLLATVL.LLPVDIAL..VSSTAS...Salgakkdwa...............................................................................................................................................tpkrvadilF-----.-..--....-...-.....-.T.LK.VV...YYSLYSWDALLCL................IV..IP.FAY.F....W....Y........Eey...devA.......F..E...E....E.G.R-...................................................TWK.N....RFWA..A...T...KYTL..F...F..V..AL..TI.VL..FLlg.....ffVPAA.G.G.SK.G---......Hwdldyyks...........................................................................................llsqnhgekALTFAV..GL..LMTL.G.T.FLY....VLYTSAG.LALM.......................................PISLIK...................SA.PP-..ISAPQLSAT..TA..SQL...EQ..NRE.R.Q...RQLE-...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lrnagreegmsrkdrreldalir............................................................................................................................................................................................
E5AAE6_LEPMJ/13-512                  ...........................................................................................................vl-ALLTIIGLVLL.L......LRYY..LPL...R...TTPA....................................................YVVVPVFLAI..ALPASIVV.LLPVDLAS..SAGIAT...Dga.............................................................................................................................................................rgI-----.-..WL....P...D.....T.V.VY.KS...WRIVYWLTFALTW................AI..LP.MLG.E....Y....C........D........S.......G..Y...R....E.P.KA...................................................RML.Y....ALRS..N...G...RYWL..I...M..L..GI..GL.VG..SI.........YLIW.W.-.NG.FERD......T............................................................................................................FKSLVM..AL..AYTW.G.L.ILG....IYLMGHG.LVAF.......................................PRSLFR...................YA.SVS..ARLKRIQSS..AP..KIH...EK..LHD.A.L...EMLEQ...YE...YQVVQ.L.KQR.K..N.AIP...................................................................RDFQ..EW.IDELAE..........................................................................................................................................KS..NL.P..E-.-.---SRVGA.FAR..TNATT-..--Ipp.................................vvTERYLADLT.R.KL.............................................KR.ARHAKARFEN.EWD...HVVRRA..LRTQ....................................................................................................................AILDSKASKrlefiasqa...............................................................................................................................glfdrlklhTPYTRYHL.H..VH...I...I...PALT....YL....TW....II.A.V.LASISIVWSECV..REAq.....................................................dfGGQ..KL....SI.IG.W...TV..V..H.R..V.ES.GR..S.SIGFn......sQIIAAA....WL.C..Y..M...C.IC.AFYSLT....EIKI....WG................N.R.ALVR...-RNTYQE..SATWYGLQ......VAKLTV...P.LS....YNF.L..TMT.DKTIWK.......................................GTMF.YKFLG....R..LIV........L...TP....LG..EGFS....AF...FP.IFIL.VPVFATAF...................................................................................................................................................................................................................
W2GGR9_PHYPR/13-276                  ...........................................................................................................ii--AVALLICNVY.I......LVYF..QHD...D...DKNTa..................................................yFPKALVIFGL..FFAEATVL.LLPLDVAN..------...Nst.............................................................................................................................................................aiGCAEGW.N..TV....C...G.....N.InMD.LL...WLMVFLSIIIFLV................VL..LP.FAI.F....Y....Y........E........A.......D..D...G....E.D.NP...................................................--K.K....SQWG..E...A...IKME..L...G..T..VF..VA.AA..LIt......vlYLTC.A.K.SS.VPMR......Alevnsmsdsegfqpyvdgttvs................................................................stivtvasnvtvqhitltvdvsLPVYVT..GL..TSFV.G.W.FGF....SIFCGIG.LIAL.......................................PMDLIL...................AF.FHR..PK-------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------fisadvyaiqklilqrrsvellevgrsikqsm...................................................................................................................................................................................
B0E7E1_ENTDS/1-91                    .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....-MKL....FD................Y.Y.QLFN...NRLSDPG..SMLFSAAY......LCRLCA...P.LA....LNI.L..HMI.KFDGIHfn...................................gtQTAF.QSVMS....S..MED........I...PF....FG.qNSFN....DF...FP.VCIV.IVSAF---sll................................................................................................................................................................................................................
B8NSQ9_ASPFN/5-418                   .........................................................................................................fdql------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................AI..LP.LLG.E....Y....V........D........S.......G..Y...R....E.P.KG...................................................RIE.Y....SLRS..N...A...RYQL..I...V..L..CC..AV.VG..LI.........YISI.Q.-.NG.FEFT......S............................................................................................................IKALVM..AL..AYVW.G.L.VLA....IYLMGHG.LVSI.......................................PRTLFR...................NA.NVS..GRLRRIQAY..AP..RLH...DR..LMD.A.I...TDLES...LE...SQVSQ.L.QRR.K..T.GSA...................................................................LEFK..DW.IEDLAE..........................................................................................................................................TS..NS.S..EQ.R.TALLEPSD.VSS..------..--Tip................................sviTERYMADLT.R.RL.............................................QR.ARHLKARFID.EWD...RLVLTA..ADLQ....................................................................................................................AIINSSASKklefghaphr.............................................................................................................................atfftrqkilNPYMRHHL.Y..VH...V...I...PSVR....LL....FG....VI.F.A.AASLCVIWSELI..KSW........................................................-AP..RL....SV.VT.L...SI..-..V.S..Y.HK.DP..A.PVGFg......rQVTASA....WL.L..Y..M...C.WA.ALVGVN....DAKV....WG................N.R.ALVR...-RNTYGE..SACWYAGL......VARLTV...P.IA....YNF.V..TFL.PMSARE.......................................NTTF.YRFLG....R.sIDL........T...P-....LG..KGFD....YF...FP.IFIL.AP------fptsl..............................................................................................................................................................................................................
T1DML7_CROHD/8-548                   ............................................................................................................i-EIVVVFFLALI.I......LQRY..GDF...K...KQHK....................................................LVIVATLLAW..YLCFLIVF.ILPLDVTT..TIYNRC..kHdlndsynyptssgs.....................................................................................................................................eaqhqdinptqskpKCFKPW.S..YI....P...D.....R.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAI.N.-.PN.ISLQw....sQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSHWN...................GA.KKG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...VM...EEVRK.V.NES.I..K.YNH...................................................................P-LR..KC.VDTVLK..........................................................................................................................................KC..PT.E..YQ.E.RMGRNMDD.YED..FEERSN..TYP.....................................TEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWQ...ILLEQA..FYLE....................................................................................................................DVAKNESSAthqfvhtfqsq...........................................................................................................................eaenkiiqylyTPTLEWYW.E..CL...L...R...PWFH....RI....LA....II.L.A.IFSIIVVWSECT..FFS........................................................PKP..VL....SL.FA.I...FI..-..R.L..A.EK.NY..N.YFYI........EMACFF....TI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDAAIsqr................................tteqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
G0SCW1_CHATD/17-260                  ............................................................................................................v-AVVLVLLVAVI.T......TYTW..QSP...H...ERSI....................................................VTNLVSTVSI..TALLATVF.LLPVDIAL..VSSTGS...Vhlgakkew................................................................................................................................................atpervegiL-----.-..--....-...-.....R.T.LE.IV...YYTLYSFDALLCL................IF..IP.FAY.F....W....Y........Eeh....deV.......E..E...E....E.G.TT...................................................TKV.T....RFWH..A...L...RYTL..A...F..A..FM..VV.IL..FL.........IGFF.V.-.PA.AGNS......Hrphmdldyfk........................................................................................rllaanngekALTFGV..GL..LMTL.G.T.LLY....ILYTGAG.MALL.......................................PVSAIK...................S-.APS..ISAPQLSAT..TA..TAL...ER..NRE.R.Q...RQLE-...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------mrntgr.............................................................................................................................................................................................................
E0V9N5_PEDHC/205-462                 ........................................................................................................kpqfl------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...RDINE...EY...NLTKL.E.EDC.I..R.RRL...................................................................ENVQ..KN.GKAYIS..........................................................................................................................................--..PP.P..IF.P.SMFESVT-.---..-GEDDI.lENT....................................pKKKKLFSLQ.N.GAl...........................................qMG.LKLMLSKVEK.KTK...LLDVQ-..----....................................................................................................................---------.................................................................................................................................................-RRASLIQ.R..NF...V...Y...PGCM....LL....LF....AL.T.G.IAVLIVVQNTLE..LLI........................................................-GI..KA....LP.LS.T...RQ..F..S.L..G.IS.SL..S.KLGPf......gAAIEIV....LI.L..Y..M...Q.AT.SSVGLY....TLPF....--................I.K.KFQP..kLNNTPLS..HTIANCAL......LLILSSa.lP.LI....SRI.L..GIT.NF----.......................................----.-DLMG....D..FGK........I...VW....LG..-NFK....IV...LM.YNVL.FAGAATLC...................................................................................................................................................................................................................
K4E5L5_TRYCR/10-486                  ............................................................................................................v-FFFFLSLVATL.L......IFRY..YTK...I...SAKDm.................................................pvLCRVFIIIAL..FSSILPFP.LLVVDINA..AIDAKA...D.................................................................................................................................................................P-----.S..MP....K...E.....T.W.LI.GV...WYAIVSATYIMGW................AV..LP.VSQ.S....Y....T........E........V.......G..D...F....A.P.TR...................................................KIK.H....AIRN..N...V...KLYA..I...S..L..II..IV.VL..FG.........YVVFlK.G.AY.NSIA......D............................................................................................................ILKLAI..SL..ANAW.G.L.ILL....VLFMSAG.LVGV.......................................PKMLWR...................SS.DAV..RMLRRAYFR..AV..DIQ...ED..LDM.A.S...MDLAE...VK...AELMT.I.HPL.V..A.EEH...................................................................-KVYwtHM.MEEITK..........................................................................................................................................-A..DR.E..IL.Q.HHSAGALV.RPV..TGE---..NQTd...................................vSLKHLEELH.A.RV.............................................KY.SIKIVRRMNH.LWD...STIRDC..LAYD....................................................................................................................EFILGVKST.................................................................................................................................................NNPFKRVW.F..PV...-...R...GMVY....RG....AA....VC.T.S.ILTLLVLWSELL..LPF........................................................QPL..TT....RQ.LS.V...IA..-..L.A..M.GS.EF..Q.LVGS........----MV....FM.F..Y..M...A.YC.SYWAIL....QLKV....FD................I.Y.VILP...-GVSDNA..SMCFGATF......LARLIM...P.LG....FNF.L..LIA.DLVMND......................................tDVMY.GHVYR....R.nMDV........S...LV....LG..SWLN....QF...IP.MFIP.FVSIMV--ll.................................................................................................................................................................................................................
Q22W34_TETTS/48-572                  ..........................................................................................................ssv---ILSFSGSLI.M......LVSF..CSI...Q...SFEW....................................................DTYLTVFLGY..FISFSTIC.IIPLDAAL..ITYDKNs.rNinl..........................................................................................................................................................skidS-----.-..--....S...T.....D.S.FK.TY...WIVIYWTIFFLSN................LV..YT.LQS.F....F....H........N........N.......G..Y...I....G.F.KQ...................................................KMR.A....AFKQ..F...F...KLVI..A...C..V..AL..FI.IL..SIi.......cLFWF.K.I.KG.FDN-......-............................................................................................................ILAVIV..VI..SNVY.G.I.SVL....AFLFGYG.LVKV.......................................PFYLWN...................KS.QRE..DYLIELLCK..TH..ELF...KE..YQS.S.Y...WKYSD...IC...YISSS.Y.QKK.I..A.NIP...................................................................I-YL..DY.LKLIQKe.......................................................................................................................................tpNL..NE.P..IG.Y.RFQKNI--.--L..YKPDEK.iTEFviklk...........................tngqiSEQVLASLR.Q.EI.............................................RI.RKFNYERHIQ.KWK...RISTSV..FSIIt.................................................................................................................keS------IEeidqslniprsstsv...................................................................................................................ssrnssreevhqnakPVKVKAIK.M..NI...F...L...SAGF....KL....AA....II.A.G.LFSILIIFCEAT..IVF........................................................-GS..QN....KA.LA.F...YQ..-..-.M..I.KS.TN..N.IPGI........ISLIIL....VL.L..Y..V...I.FC.TYFALG....KLKV....FG................S.F.ELFI...-YFTHRD..VFIQNLSM......CLFLTF...P.IC....YNV.M..LLF.GIIDQNtedd...............................gkvyQSGF.DKFYD....P..MKE........I...PF....FG..YYYN....AV...VC.FLIS.VIA-----ivssf..............................................................................................................................................................................................................
G5A514_PHYSP/8-543                   ........................................................................................................lavsg-----LLGFTWW.L......LAHY..KD-...A...KVPT....................................................VVHAAVFTSW..ALGFLGLL.LLPMDLAT..------...Ngltassqs.................................................................................................................................................iggtaedkA-----.-..--....N...F.....N.E.YL.TG...WRLLYWLTFSMSW................VG..LP.FLV.E....F....S........Q........N.......G..E...F....E.L.EK...................................................RVI.S....SLRH..L...V...FHWS..V...L..A..GG..LF.IV..AL.........YLIL.V.-.DH.LSLY......G............................................................................................................VLGLAM..AA..SNTY.G.L.LWV....IALLGYG.LVEI.......................................PRSCWM...................RR.LDG..AQLQKLHFQ..AV..QLQ...DE..RME.A.R...FEYDE...VV...ADVRE.A.YQR.M..M.QAEsdaii.........................................................ltgemQ---..-Y.VKTCLLkvlalvekskpafssl..........................................................................................................dpaneakrasksasftD-..--.-..VS.S.K-------.---..------..--Mkrafsgig.....................rvsarkapTLPEVVQLH.R.RV.............................................RI.AQLELRRCDQ.AFL...ELCINV..----....................................................................................................................DVLEDRNAQralsagslyp............................................................................................................................etsalnrlhnlFLDTRHQI.R..RW...V...T...SPVA....IA....CA....VI.T.G.FLSLCVAWGELT..MGW........................................................HGS..SL....SL.FR.F...LI..A..A.E..A.EE.TS..S.SLRSa......tELVSAL....LL.V..Y..L...A.LC.CYTSLF....TLRL....PG................K.Y.ALRA...HGNSTEL..CLLKTSIH......QCRLQF...A.LG....QNA.L..LLL.RGGGLA......................................eGTAF.SALLA....N..TRV........V...HL....FG..RGFA....VY...AP.LAMI.ALAVFT--lt.................................................................................................................................................................................................................
A0A024WJM5_PLAFA/10-239              ............................................................................................................v-AFILLIFISSW.I.....fYNYF..VNY...H...ESTI....................................................LAALTFIISL..STCFILVL.FIPIDIYL..-VSNGN..lEis.............................................................................................................................................................hlE-----.-..-I....T...Q.....K.V.IS.KF...YHSMFWVLIFEAY................VL..VP.FSY.F....Y....L........K........N.......K..K...S....Y.K.NEfddn..........................................vvpfeNTI.E....SLKK..T...I...YFIL..L...L..I..VL..SI.IG..LI.........YRPG.H.K.LA.MEKG......Keleyisdl...........................................................................................fdvkhtgesAIIFLM..GC..VVLM.G.V.SFW....ATYTSYG.IACL.......................................PLSLLQ...................QR.NID..HDKKEIENR..FM..SLK...EK..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------eimikv.............................................................................................................................................................................................................
C5P9K0_COCP7/22-517                  ............................................................................................................f-AVVSIFFLVLL.L......LRHY..LPL...R...STPA....................................................YLALPVFLAL..ALPASVIL.LVPIDLTS..STSGSS...-.................................................................................................................................................................---PSG.I..WL....P...S.....R.V.ML.VS...WRITYWLTFVLTW................LI..LP.LLG.E....Y....V........D........S.......G..H...R....T.P.KA...................................................RIA.Y....SLRS..N...A...RYQL..L...M..L..SC..GI.VG..LV.........YVLI.Q.-.NG.FRFS......S............................................................................................................LKSLVM..AL..AYVW.G.L.VLA....IYLMGHG.LVAI.......................................PRGLWR...................NV.NPG..NRLRRLQSR..AP..LIY...DR..LID.A.K...SSLED...IR...AQVSQ.L.ERR.K..T.SVP...................................................................LDLQ..DW.IDDLVEgad....................................................................................................................................fpgA-..--.-..--.R.PPQLALAD.ASR..S-----..--Tgp................................vviTERYLAELT.R.NL.............................................NR.ARHKNARFTD.AWS...RLVQEA..ADCQ....................................................................................................................AIIDSSTSKhlefsrytsh.............................................................................................................................stlshrrsllTPYLRHVL.H..FH...V...L...PAVR....IV....CA....GL.F.S.IASACIVWSEFV..KSF........................................................-AP..SI....SI.VS.L...SV..-..T.H..A.YH.GT..A.TVSFl......gQMVASG....WL.L..Y..M...C.SA.AFAGVT....DTKV....WG................N.R.ALVR...-RNTYGE..SACWYAGL......IARLTV...P.LA....YNF.L..TLL.SRDVQH.......................................QTTF.YDFLG....R.fIDL........T...P-....LG..KGFD....YF...FP.IFIL.VPVAATLF...................................................................................................................................................................................................................
I7MIP6_TETTS/74-574                  .........................................................................................................aelg----CLCIFILW.F......IQHH..SN-...K...EVSL....................................................FVKLVVFIDW..FLSFGQIL.LLPVDVYL..KIYSQQ..nNipq...........................................................................................................................................................ediP-----.-..--....E...F.....F.T.LK.LV...HGIYFWLVMLLCW................II..IP.LME.D....Y....Q........E........C.......G..Y...L....D.H.ER...................................................KWQ.Y....TLKK..N...T...QFFG..I...V..G..GL..TI.VS..VV.........ILES.T.-.DM.MNGY......G............................................................................................................LITFLK..SL..ANCW.G.I.FQI....MILLGYS.LVTV.......................................PRSHFR...................TT.NDK..LQMKYLCFR..AA..QIK...KE..QEE.S.F...LELIS...NL...KDVLE.I.KRI.E..K.SSK...................................................................-DIL..FY.CDNIIH..........................................................................................................................................LV..PA.K..II.K.LAQQEPDI.EDK..DSQRSY.sQKKni.................................hyTFDSVVELR.K.QV.............................................KH.NWSEFRRSGS.NWK...SLLKKA..FWLQ....................................................................................................................DIISNQDNEskkviestlr.............................................................................................................................kprtgfqaelRNKVEWYW.Y..MS...T...K...KQIK....AI....WS....VF.L.S.AMSIIVLLSEIS..LFW........................................................-DK..DL....SI.LG.W...FV..Q..A.L..L.SF.EL..S.VFGV........QIVTLI....PL.L..F..M...I.FN.VYYGLF....RLKI....SG................F.F.GLYP...NKHTDAA..SLLFASVN......FSRVAA...P.LC....YNY.L..EMI.NIT---.......................................DTAF.NKVLG....N..VNI........V...PV....LG..SDFT....NF...FP.SLLV.LFCLFNLF...................................................................................................................................................................................................................
S4PVR4_9NEOP/1-103                   .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..M...F.YC.AYSTVL....KIRL....LN................L.Y.YLAP...HHQTNEY..SLIFSGMM......VCRLTP...A.MC....LNF.L..SLV.HMDSHVike.................................rvrETFY.TQIMG....H..MDV........L...GI....IA..EGFN....IY...FP.MLVV.ILCLATY-l..................................................................................................................................................................................................................
V9KSZ6_CALMI/1-193                   .............................................................................................................------------.-......----..---...-...----....................................................----MCTFTL..AASVSAVF.LLPFSIIS..------...Neil...........................................................................................................................................................lsfPENYYM.Q..WL....N...G.....S.L.VH.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SK...................................................---.K....GVMA..R...V...YETF..V...V..L..FL..LS.LL..VL........gIVWV.A.S.AI.VDND......Sacresl................................................................................................ydlweySVPYLY..SC..ISLF.G.V.LLL....LVCTPLG.LSRMftvtg.............................qllvkPRLL--...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------edldeqlhctqfeeaamlhklngqt..........................................................................................................................................................................................
H2RSU8_TAKRU/1-55                    .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........-MACFI....TI.F..F..L...C.TC.VYSTVF....RIRV....FN................Y.Y.YFAS...HHQTDAY..SLQFSGMI......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------tainllnlv..........................................................................................................................................................................................................
S4RXV9_PETMA/289-448                 ............................................................................................prcvglplslfflfslr------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....CS.K.G.VSVLIVSIHILE..LLF........................................................-DE..TA....MP.KG.A...QR..-..D.P..G.AK.NA..R.VCSFg.....cqATVQLM....KE.I..Y..L...M.LS.SVLGFY....SLPT....--................F.M.PLTP..kSQDTPMT..KIIGNCVS......LLILSSa.lP.VL....SRT.L..GIT.NF----.......................................----.-DLLG....D..YGR........F...NW....LG..-NFY....IV...LL.YNLL.FAGLTTLC...................................................................................................................................................................................................................
W6XTG0_COCCA/15-260                  ..........................................................................................................vav---GLLFLIAST.F......VYVY..QKP...R...DRAA....................................................AVTIVCIFTT..LALLATVL.LIPVDVAL..VSSTSR...Sslgrkkdw................................................................................................................................................atpdkvdsiL-----.-..--....-...-.....Y.T.LR.IV...YYSLYSLDAVLCL................LV..IP.FTY.F....W....Y........E........E.......Y..D...E....D.A.AEh................................................geQTA.G....QRIG..G...A...IKWT..L...G..F..LV..FV.VA..IFlv.....gfFVPF.A.-.--.----......Kqakddkrldldy....................................................................................fkhllsenhgerALSFAL..GL..LITV.G.T.VLY....VLYTGSG.MALL.......................................PVAMIK...................S-.APS..ISAPTLAAN..TA..SQL...ES..NRE.R.Q...RQ---...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------legrsqgre..........................................................................................................................................................................................................
D7TRM2_VITVI/6-492                   .....................................................................................................lislpltl--------GMVV.L......TLKY..FAG...P...GIPR....................................................YVFFTVGYAW..FCSLSIII.IVPADIWT..AITEH-...-.................................................................................................................................................................------.-..--....P...N.....G.V.IS.FF...WSWSYWSTFLLTW................AV..AP.LIQ.G....F....E........D........A.......G..D...F....T.V.TE...................................................RLK.T....SIRV..N...L...VFYL..V...V..G..SI..GL.LG..LV.........LLII.M.-.HG.LRIG......S............................................................................................................VLGLAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKSIWK...................NA.DWT..TRQKVLSHK..IA..KMA...VK..LDD.A.H...QELSN...AI...VVAQA.T.SNQ.M..S.KRD...................................................................P-LR..PY.MDVIDN..........................................................................................................................................ML..IQ.M..FR.E.DPSFKPQG.GRL..GENDMD..YDT.....................................DEKSMATLR.R.HL.............................................RG.AREEYYRYKS.EYM...TYVMEA..IELE....................................................................................................................DTIKNYERRestgwkyvstl...........................................................................................................................rpsrtgrlgsfFDTMELIW.L..CI...V...R...KQLE....KL....LA....II.L.G.CMSAAILLAEAT..LLP........................................................-SV..HL....SL.FS.I...VI..N..S.V..G.--.-Q..Q.EVLV........QVFAFI....PL.M..Y..M...C.IC.TYYSLF....KVGM....LM................F.Y.SLTP...-RQTSSV..NLLMICSM......VARYAP...P.IS....YNF.L..NCI.RLQ--K.......................................ETIF.EKRMG....R.iDAA........V...PF....FG..TGFN....KI...YP.LIMV.VYTLL---vas................................................................................................................................................................................................................
B6K3S4_SCHJY/6-444                   ......................................................................................................lavgapa-------LFVFF.W......LLRL..TRI...R...DLAP....................................................VVGTVVFVGF..YVPFFMFF.VLPIDVVW..T-----...-.................................................................................................................................................................------.-..--....-...-.....-.V.PS.LV...WRITYWTSFVLTW................FF..VP.FIQ.E....Y....V........A........S.......P..F...K....T.P.RM...................................................KIR.D....SIHS..N...L...KYSA..L...L..S..VI..TL.VM..LV.........YLRF.V.L.RS.MTFK......G............................................................................................................FTNLII..SL..TYFY.G.L.IFA....IFLLGHG.LVTV.......................................PRDCWR...................RA.FLS..KRMAQLECY..AV..KVY...DK..IQD.R.M...DELSD...LS...NATPG.T.GFD.R..S.TFH...................................................................Q---..--.------..........................................................................................................................................--..--.-..--.S.DF------.---..------..SHT.....................................HLSDSEAVT.A.EV.............................................AD.ASLRLHPLKI.QWN...ETVREY..AKLK....................................................................................................................ALQTCREKHsywlrl....................................................................................................................................ppgsfrtHPLLDYVL.Y..SY...V...Y...PLLR....LI....LA....VI.F.G.ALSVLVVVSELF..LGS........................................................---..KY....SV.TG.I...VL..-..E.K..A.AT.IS..P.MFHL........-LATAV....VF.W..Y..M...C.MC.TCSSLL....RSRS...sFN................YlT.ALLP...KQATHPL..ALLAFLVQ......SCRLVI...P.LS....YNF.V..SLQ.FS----.......................................QTRF.HLLFG....N.sIDL........L...P-....LG..YYIS....KR...YP.MIVL.LPVFSSIF...................................................................................................................................................................................................................
N4UPY0_COLOR/18-258                  ........................................................................................................vavgf-----CLLAAII.T......TFTW..QTP...R...DRSA....................................................IVSVVAIVSL..TALLATVL.LLPVDIAL..ISSTTH...Aslgikkdw.................................................................................................................................................ateqrihdI-----.-..--....-...L.....Q.T.LR.IV...YYSLYSFDALLCL................LV..IP.FAY.F...wY....E........E........Y.......D..E...I....E.V.EE...................................................--G.R....SFGS..R...L...VSAL..K...Y..T..LV..FV.VL..VV.........ILFL.V.G.FF.VPAA......Gsdsganwdldy.....................................................................................fkrilvqnngqkALAFAL..GL..LVTL.G.T.LLY....IIYTAAG.LALL.......................................PMSFIKs................apSI.S-A..PQLTEN---..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------taaalgqnrerqrqlemrna...............................................................................................................................................................................................
S9YQI3_9CETA/347-495                 ............................................................................................................f------------.-......----..---...-...----....................................................-----STFTL..AVALGAVL.LLPFSIIS..------...Nevl...........................................................................................................................................................lslPRNYYI.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLI................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVLA..R...V...YETV..V...M..L..IL..LT.LL..VLg......mvWVAS.A.I.VD.NNKA......Sresly..................................................................................................dfweyYLPYLY..SC..ISFL.G.V.LLL....LGL----.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------arm................................................................................................................................................................................................................
D8RQM8_SELML/2-114                   ......................................................................................................hmcssiq------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.EL.............................................VF.LEDDVQALNE.AFP...QGEK--..----....................................................................................................................---------.................................................................................................................................................--ADTSWA.V..TV...L...F...YLAK....LV....FG....IL.G.L.ALSIIWLLHIIV..FML........................................................VNP..PA....FP.FL.N...QV..F..I.Q..L.DS.AW..G.LLGT........-TAFAI....FC.Y..Y..L...V.MS.VISGEM....H---....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------si.................................................................................................................................................................................................................
J3LH96_ORYBR/6-495                   ...................................................................................................lislpltlgm----------VT.V......TLRY..FAG...P...GVPR....................................................YVIATVGYAW..FCSLSFII.LVPADIWT..TLTGRE...-.................................................................................................................................................................------.-..--....-...K.....S.G.IG.FF...WSWSYWSTFILTW................AV..VP.TIQ.G....Y....E........D........A.......G..D...F....T.V.KE...................................................RLK.T....SVHM..N...L...LFYS..I...V..G..AI..GL.FG..LI.........LLLV.M.H.RA.WDGG......-............................................................................................................IVGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PRNIWK...................NA.DWT..HRQKVLSHR..VA..KMA...LK..LDN.A.H...QEYSN...AI...VVAQA.T.SNQ.M..S.KRD...................................................................L-LR..PY.MDIIDK..........................................................................................................................................ML..SQ.M..LQ.D.DPSFKPSG.GRL..GENDMD..YDT.....................................DDKTMATLR.R.QL.............................................RR.AHEEYYRCKS.EYM...TYVMEA..LELE....................................................................................................................DTIKNYERRdangwkfvssf...........................................................................................................................resrpgtlgslLDTMEFIW.R..CV...L...R...KQLQ....KG....FA....IV.L.G.CMSAAILLAEAT..LLP........................................................SGV..DL....SL.FS.I...LI..K..S.-..-.-V.GK..Q.EVLV........QVAAFV....PL.M..Y..M...C.IC.TYYSLF....QIGM....LM................F.Y.SLTP...-RQTSSV..SLLMICSM......VARYAP...P.IS....YNF.L..NLI.RLGGDA.......................................KTTF.EKRMG....N.iDDA........V...PF....FG..RGFN....RI...YP.LFMV.VYTLL---vas................................................................................................................................................................................................................
F0UMR6_AJEC8/15-257                  ............................................................................................................i-VFFLLVAVASI.F......IYIY..QTP...S...ERST....................................................YVTTVCIFTL..TALLATVL.LLPVDVAL..VSSTTS..sRegrrk.......................................................................................................................................................swatqD---EV.D..KI....T...F.....S.-.LT.VA...YYFLYSLDAVLCL................LV..VP.FTY.F....W....Y........E........E.......Y..D...E....V.A.SEdg...............................................sqTFR.K....RFWG..A...F...KYTV..A...F..I..LL..TV.IL..FL.........VGFF.V.P.VG.----......Rrkdepnldldy.....................................................................................frrlltenhgerALTFAL..GL..LITI.G.I.LVY....VLYTSTG.LALL.......................................PVTFIK...................S-.APA..ISSPTLSAN..TA..SRL...EE..NIE.R.Q...RQLE-...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------grcgg..............................................................................................................................................................................................................
D8S063_SELML/13-503                  .............................................................................................................LLTLLVFAINIY.I......LIRY..QHP...D...DSNQa..................................................yLPKIIVVIGL..SIAQLSIL.MLPADVAN..--RHSC...Eknlyvg.....................................................................................................................................................ackltlP-----.-..--....-...-.....-.-.MK.QL...WWAVYIIDTVLVY................LV..IP.FAI.F....F....Y........E........S.......D..Q...E....K.T.VT...................................................---.-....QRIK..N...A...LLWV..V...I..L..LT..VF.CL..LLg......ilYAVI.G.Y.AD.FTVR......Rlssttlaftndfsslnakapclfpagf.....................................................slssnvtlmcaaytsgslvkttwsvrapFPTYVI..AL..NTII.G.S.ILF....TMFGGVG.MATL.......................................PVSLIF...................AF.KNR..PKCVITRVQ..YV..KV-...-M..ALQ.E.A...TDLAK...RS...NELKK.V.TLG.L..Q.REE...................................................................RGGK..--.------..........................................................................................................................................-K..GR.K..--.-.--------.---..------..---.....................................LRKNVKKVQ.Q.EL.............................................VF.LEDDVQALNE.AFP...QGEK-A..----....................................................................................................................---------.................................................................................................................................................---DTSWA.L..TV...L...F...YLAK....LV....FG....IL.G.L.ALSIIWLLHIIV..FML........................................................VNP..PA....FP.FL.N...QV..F..I.Q..L.DS.AW..G.LLGT........-TAFAI....FC.Y..Y..L...V.MS.VISGEM....HLGM...rLL................F.L.SIHPm.kYQGTLMN..SFLFNVAI......ILLCS-...-.--....---.T..SVI.QFCTKAfsl.................................yaeATAA.QEIFG....H.sLES........L...RG....LK..YLFI...fNV...FQ.IAFIvFAFLSFL-c..................................................................................................................................................................................................................
N4U2D5_FUSC1/17-274                  ...........................................................................................................av-AVVLCFAAAII.T......TFTW..QTP...R...ERSA....................................................VVSIVAIISL..TSLLATVL.LLPVDIAL..VSATAS...Atlgakkdw................................................................................................................................................atperidsiL-----.-..--....-...-.....Y.T.LK.VV...YYSLYSFDALLCL................IV..IP.FAY.F....W....H........E........E.......Y..D...E....I.E.VEee...............................................grTLS.S....RFLA..A...A...KYTL..F...F..V..AF..VV.VL..FLl.......gFFVP.A.A.GD.SSQS......Hwdldyfkk...........................................................................................lvaqnhgekALTFAL..GL..LLTL.G.T.LLY....VVYTGAG.LALL.......................................PISFIK...................AA.PSI..SAPQLHQTT..AS..QL-...EQ..NRE.R.Q...RQ---...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------iemrnagrqegmsrkdqreld..............................................................................................................................................................................................
F6YTE9_XENTR/34-268                  .............................................................................................................LLFSTLYLLSYI.V......ITKF..KKH...A...DFATvdved..........................................aavnrIALWMCTFTL..AVSVGAVL.LLPFSIIS..------...Nevl...........................................................................................................................................................lsvPHNYYI.Q..WL....N...G.....S.L.VH.GL...WNLVFLFSNLSLV................FL..MP.FAY.L....F....T........E........A.......E..G...F....A.G.SK...................................................---.K....GVMS..R...V...YETS..V...V..L..LL..LT.LL..VFg......ivWVAS.A.I.FD.DDSA......Gresly..................................................................................................dlweyYLPYLY..SG..ISLF.G.V.LLL....LLCTPFG.LSRMfsvtg.............................kllvkPRLLENldeh...........lsctA-.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------feeaaisrkistkascw..................................................................................................................................................................................................
M8AX40_TRIUA/8-426                   .........................................................................................................lert------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...---------LLRW................AI..IP.TIK.G....Y....E........D........A.......G..D...F....T.V.KE...................................................RLK.T....SIRA..N...L...LYYE..I...V..G..SI..GF.FG..IV.........LIII.M.H.HD.WGGA......-............................................................................................................ILGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKDIWR...................NA.DWT..RRQKILSHM..VA..KMT...VK..LDN.A.R...QEYCN...TI...TVVQA.T.SKQ.M..S.KRD...................................................................P-LR..PF.MDIIDN..........................................................................................................................................ML..AQ.M..LR.D.DPLFKLSG.GNK..LAENDM.dYDT.....................................DEKTMAALR.R.RL.............................................RI.AHEEYCRCKS.KYT...TSVMEA..LELE....................................................................................................................DTVTNYEQHdadgwkyvs..............................................................................................................................dlresrsgtlGSFLDHIA.H..IK...T...Y...FIMK....RC....KH....VV.Y.IpIYMSAILLAEAT..LLP........................................................TGV..HL....SL.FS.V...LI..-..N.A..A.GK.QE..-.-ILV........QVVAFA....PL.M..Y..M...C.IC.TYYPLF....RIGM....MV................V.Y.SLTP...-GQTSSV..SLLMICSM......VARYAP...A.IS....YNF.L..NLV.HLGGDV.......................................RTTF.EKRMG....S.iDDA........V...PF....FG..RNFN....RI...YP.LIMV.VYTI----lva................................................................................................................................................................................................................
H3EX74_PRIPA/1-226                   .............................................................................................................------------.-......----..---...-...----....................................................----MCTTSL..AGSIGCIM.LLPFSVLG..AELLQS...Dffivl......................................................................................................................................................idcaryPSSYYL.Q..WL....S...W.....S.L.LH.SL...WNYVFFLCNISLF................VL..LP.FAY.F....F....I........E........S.......Q..G...F....N.K.KR...................................................---.T....GVLQ..R...A...YETG..A...V..C..AI..LV.VL..LLc......lsDLVF.T.-.LI.LPTG......Agggggf...............................................................................................afglsslSVPLLY..SI..VSLG.G.V.VLL....LVSTPLG.FTKMfgivs............................elaqarP-----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------ppaddvsverlelccrstpqrppaataaregeyglrsraagvggvrh....................................................................................................................................................................
Q4RGQ6_TETNG/278-349                 ..........................................................................................................ivs------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...-L...QEVRK.I.SES.I..K.YNH...................................................................P-LR..KY.VDTILR..........................................................................................................................................KC..PV.E..YQ.E.KMGRNMDD.YED..FDDKQN..TYP.....................................SEKSLAKLH.K.QV.............................................S-.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------va.................................................................................................................................................................................................................
U6PKA3_HAECO/77-579                  ............................................................................................................i-IFISLYLLSYW.I......ISLF..KSK...S...DNDSlyagde........................................dyivyrISVWMCSASL..AVSIGSIA.LLPFSVVS..SELLQR...Y.................................................................................................................................................................PDNYYL.Q..WM....S...W.....S.L.IN.SL...WNYVFALSNLSLF................VL..LP.FSY.F....F....I........E........S.......Q..G...F....S.K.NK...................................................---.N....GIMQ..R...V...YETL..A...V..C..AL..LI.VV..ILclv...dvvLTLV.S.S.SP.LQVS......Lisi......................................................................................................tsvNLPLIY..SF..VSFA.G.V.MLL....LLSTPIG.FAKMfg...................................ivG-----...................--.---..----EMTMN..SI..SIP...DQ..DDI.I.V...DRLER...YC...EARKA.G.KYG.T..N.NNIhknsfeamspfy...........................................spashgyspvrlRSFR..--.----MT..........................................................................................................................................PI..GF.N..TR.S.DCSEKCYL.FSS..S---IY.gFASe..................................snTSSASNGWS.E.NT.............................................QI.SSEESRSV-S.-YG...RAVRPQ..IVAG....................................................................................................................QILNPLHQK................................................................................................................................................sLRFCKHFI.R..IV...K...Y...PAIV....IS....LL....AL.T.G.ISLLMVVINSLK..LVF........................................................---..GF....RS.LP.A...YA..Q..Y.M..E.VH.TR..H.SLGIv......gVIIESI....TI.M..Y..V...M.ST.SLTGLY....SMPF....--................V.R.ALRP..qRARTSLT..VIIINCSL......VLVLSSa.lP.VL....ANT.L..GIT.SF----.......................................----.-DLLG....A..YSS........L...KW....LS..-NFK....LV...LA.YNVL.FAAATIVC...................................................................................................................................................................................................................
H2N1Q2_ORYLA/1-49                    .......................................................................................................mdsais------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.-HQQKE.......................................QTAY.TSIMG....S..MRV........L...SF....IA..DGFY....IY...YP.MLIV.ILCIATYF...................................................................................................................................................................................................................
G4N3S8_MAGO7/27-533                  ...........................................................................................................vs--LLVVSFLVLL.L......LRYY..LPL...R...TTPA....................................................YLLVPVFFAI..WLPACIVL.LVPIDLAS..SAATDD...Eas.............................................................................................................................................................rgI-----.-..WL....P...D.....R.L.LL.VS...WRITYWLTFVLTW................FI..LP.VLG.E....Y....S........D........A.......G..Y...R....E.P.KD...................................................RLI.Y....SLHQ..N...A...QYYA..I...V..L..GS..SL.VG..LV.........YVIW.S.-.YG.MKLD......A............................................................................................................LKSLVM..AL..AYFW.G.L.ALA....IYLMGHG.LVAI.......................................PRSLIR...................AL.SIS..GQLRRIHTR..AP..KIY...ER..MED.A.E...ADLAD...LE...AQVTE.L.AKR.A..KtGSA...................................................................RDFQ..DW.IEELVEl........................................................................................................................................aCL..PD.G..IP.G.QIASNRAS.L--..---SSR.aLPTv...................................iTAKYMADLT.R.QL.............................................VR.ARHARSRYVS.EWN...YLLQDA..RETQ....................................................................................................................IILDSAASKkldfgtatpg.............................................................................................................................agfwdritilTPHTRYIY.Y..YY...V...L...PYAK....AC....LG....GL.L.A.LASACIIWSEMI..KLA........................................................-FP..SL....SL.IR.L...SV..V..H.H..W.IT.DS..E.GKPVgqv.gfagQMAASF....WI.L..Y..M...M.AA.AFISIT....EVKV....WR................G.R.ALVR...-RNTAHE..SAFWYASQ......VARLSV...P.LS....YNF.V..TFM.SPEVYK.......................................RTVF.FKFLG....Q.lINL........T...P-....LG..SWFD....YL...FP.VLVL.IPVCATLF...................................................................................................................................................................................................................
E9BYP7_CAPO3/8-628                   ............................................................................................................l-ALIVIAVVVAA.F......YRQY..ANW...R...MAPW....................................................YSTLTVTLTW..FLSMSIVV.LIPMDISA..TYYHHC..lDehtprpnasasafpsasssassfaptftsdlgsatpsassfaettldglspsds....................................................llftatasilepaatatsealvtfltslsdaaptpsstgfvpasgqadqvvdptmFCEQPW.T..YV....S...P.....D.V.FP.VI...WKIVYWTSQLLTW................II..LP.FMQ.S....Y....V........D........A.......G..D...F....T.F.WG...................................................KLK.T....SIRE..N...L...IVYG..S...L..G..VL..VV.GL..FL.........YIAI.K.-.AS.LSVD......A............................................................................................................LLGIAM..AA..SNTW.G.L.FLL....IGLLGVG.LVET.......................................PRSTWN...................ES.RAD..WVTRHLQFK..AS..KLR...TE..LDD.A.E...DDLSE...TL...TDVKA.V.TQK.I..N.FTH...................................................................-HLR..PY.VDEILF..........................................................................................................................................KC..PT.N..AA.D.DLANRPNK.HSR..STASES.rLEGlt.................................diTLSSLAKLH.R.RV.............................................IR.RSLAVRRTQA.LYE...RCMDEA..LEFE....................................................................................................................EMVEQKDIAwthfqsnls..............................................................................................................................ssysgpfkkfVHKFTFLW.R..FR...L...R...RLLF....AF....AA....FV.F.L.FFSLAIIWSECS..FFK........................................................TDP..TL....SL.YA.I...IM..-..N.S..A.GT.SY..Q.YTNV........EVFSFI....SL.T..Y..M...A.IC.AYAVIF....RIRF....FN................F.Y.YLAK...HQQTDDS..SLLFSALF......LSRLTA...P.LC....LNF.L..SMS.HLDGHVvst.................................isqETAF.TQIMG....H..MDV........V...GF....IQ..DGFN....VY...FP.IFIV.LIAVLAWF...................................................................................................................................................................................................................
M3VU39_FELCA/28-268                  .............................................................................................................LLFATLYILCHI.A......LTHF..KKP...A...EFTTvdded..........................................atvnkIALELCTFTL..AVALGAVL.LLPFSIIS..------...Nevl...........................................................................................................................................................lslPRNYYI.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLI................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVLG..R...V...YETV..V...M..L..ML..LT.LL..VLg......mvWVAS.A.I.VD.NNKA......Sresly..................................................................................................dfweyYLPYLY..SC..ISFL.G.V.LLL....LVCTPLG.LARMfsvtgkllvkprl............ledleeqlycsafeE-----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------aaltrricnptscwlhldme...............................................................................................................................................................................................
W4FRF3_9STRA/8-519                   ............................................................................................................e--CLVLLLFTGY.M......LHYY..KD-...A...HVGY....................................................LVYSFVFVSW..YAGFLGLV.LLPVDISA..TVAASS...S.................................................................................................................................................................T-----.-..--....-...H.....A.S.LL.TG...WKLLYWLTFILSW................VI..LP.VLI.E....Y....S........Q........S.......G..A...F....T.P.QQ...................................................KLR.A....SVQY..L...L...RHYA..V...L..L..AT..GV.AL..LT.........YLVV.V.-.DH.FTLS......G............................................................................................................LVGLAM..TL..SNTY.G.L.LWL....IGLLGFG.LVNV.......................................PRSVWR...................SA.SPH..DQLRRIYFR..AI..QIH...DD..RVE.A.M...FTYED...VV...RDVQD.T.VRR.F..H.AVEqst............................................................iiltPDVQ..-Y.IKQCLRhvtdtlgldnn....................................................................................................................deetggrmkrvHK..PK.P..LR.P.--------.---..------..--Sssapsvts....................yvqldpalpSESDVILLH.G.RV.............................................KR.IKADLRRCEQ.AWQ...EVCWSA..QRLL....................................................................................................................QWANQEDQHlsg..........................................................................................................................................svtsSPTSSMLAaL..HV...M...W...PYIV....GA....AT....AC.C.V.FGSVVVLWSEVF..MGV........................................................-NP..RL....SP.LG.Q...LL..T..T.S..S.AT.ST..E.TTAKsgs..ltvQLVLGA....VL.T..Y..M...G.TC.VYQSLF....SIRG....FG................R.V.ALHG...AHNSTEL..SLLTAAVQ......QCRLQF...S.LG....YNF.C..LLL.NRHGVT......................................dRAAF.HTLFT....D..MRM........I...HF....FG..TDFN....VY...LP.MCMI.VVAAGT--mw.................................................................................................................................................................................................................
T1K5N2_TETUR/31-460                  ............................................................................................................i-ILITLYGLSYL.I......ISSY..LKR...Q...DEFYtdeed..........................................elvfrISFWMCTFSL..ATSIGSTL.LLPFSIIA..------...Nevl...........................................................................................................................................................llsPYNYYL.Q..WL....N...D.....S.L.IK.GL...WNYVFIFSNISLF................VL..LP.FAY.F....F....P........E........S.......E..G...F....T.N.SR...................................................---.R....GLTA..R...V...HETL..V...L..L..LL..LS.VL..VCg......ltYITC.S.L.LG.YNDL......Afttl...................................................................................................lnmnnYLPLLY..SC..VSFL.G.V.ILL....LLCTPIG.IARL.......................................F-----...................--.---..TVLGELIM-..--..---...--..KPK.F.L...RNILE...EY...EMVKL.E.EMH.L..N.---...................................................................RKIK..-N.------..........................................................................................................................................--..--.-..--.-.-----LKD.GE-..------..--K.....................................TPIKCGNL-.T.QL.............................................KE.MEKTLEILET.RLK...ELESQK..----....................................................................................................................---------.................................................................................................................................................--RASAFR.R..SL...G...Y...PLAM....LV....LL....VL.T.T.FAAFLVMQNTLQ..LLV........................................................GVK..AL....PI.TS.A...QT..F..V.V..G.LT.SL..S.KMGPf......gALLEII....LI.L..Y..L...W.CA.SIVGLY....SLPG....--................I.E.RLRP..rLGGTSFT..QCVTNCVL......LIILSSa.lP.VL....ART.V..GIT.NF----.......................................----.-DLLG....N..FGR........I...KW....LG..-NFY....VV...LF.YNTV.FALTTA--ls.................................................................................................................................................................................................................
S9U7P2_9TRYP/272-498                 ................................................................................aahaslhttsarlmeegraldaesagglr------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..--Ls..................................rsTWRKVVRFK.R.EV.............................................RE.VEHEYERLEE.AYN...QDNG--..----....................................................................................................................---------.................................................................................................................................................--------.-..TI...L...H...YYAG....LL....LA....FV.G.T.PLSFLWIAHIIV..FDL........................................................--T..GL....HP.FL.N...RL..L..V.T..M.DG.AL..P.MLGP........-LTYSV....FA.F..Y..M...L.LC.TLLGCY....KVCC...rFT................L.FpVFYM..rVGGTMLN..AILFNSTV......LLLAAFsvlQ.LC....VNS.F..RVY.TA----.......................................RTVL.YSIFV....E.sIQH........K...AF....LR..AVFP....IG...CY.SLLV.IAFLFT--ly.................................................................................................................................................................................................................
H2TMI7_TAKRU/227-445                 ............................................................ptiledldeqiycihlqeealqrrlnesgcflpislnfliwtmtrltcs------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................--------Nfl............................................................................................................................................serRKKASGWE.K..NV...L...Y...PMVM....LI....LL....AG.T.T.ISVFMVAFNILY..LLV........................................................-DE..TA....MP.KG.S...TD..R..G.I..G.NT.TL..S.TFGVa......qAVLQIV....LM.F..Y..L...M.VS.SVVGFY....SLRA....--................F.A.QLTP..rKDDTTMT..TIIGCCVS......ILVLSSa.lP.VM....SRT.L..GIT.TF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAVVTTLC...................................................................................................................................................................................................................
C5DC09_LACTC/7-500                   .......................................................................................................lvaagl-----TAVCSFL.S......VNRY..LSF...K...LHKNt.................................................lpFTLATLLVNM..WILLAITY.LLPLDVFY..AARASR..dDsnaglngtavaqptphl..............................................................................................................................larglksvrelegdtsegN----E.S..YA....P...D.....-.-.FS.AL...WYGIYWLEFFICW................FV..LP.VLI.S....Y....L........D........L.......K..Y...L....F.P.TQlyvsq........................................rktifqRVK.K....AVTV..N...I...KFYA..L...C..A..LG..LL.GG..VL.........YLVF.G.T.NR.GIVD......-............................................................................................................LKPLII..SF..SHLY.S.L.SYT....LILLSMG.LILL.......................................PKALLT...................NR.TDE..N---KLFVD..LS..KSN...DE..SND.A.K...MAMTD...YA...GKILS.I.REV.N..N.GDV...................................................................-ALA..--.--QAIN..........................................................................................................................................EC..KL.E..VQ.S.LVNETQIS.LPH..------..---.....................................--LPNGDQH.I.NL.............................................DK.INKYYNGFKK.EYY...NYLYYQ..AKSD....................................................................................................................RVIHDL---.................................................................................................................................................-AQSQVKT.I..SA...T...K...SVVR....MV....FG....IC.C.L.LLSILVVFLEFT..PSK........................................................---..-F....AH.SK.L...FQ..-..-.-..-.--.GT..S.WFNF........-LLEIS....IL.V..Y..N...T.FA.SLYAMT....CFKW....-Q................N.L.HLIP...NGQSSPK..NALYYSLY......SSRLLL...P.LC....FNF.M..ALI.SHDPGA......................................pECSF.EKVLY....K.dLKL........I...P-....LV..DILN....RY...LP.VFFI.IAVP----vgyf...............................................................................................................................................................................................................
T5AL92_OPHSC/1-160                   ............................................................................................................m------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...PHAR....LV....LG....GF.L.A.LASACVLWSELV..KFL........................................................-FP..KL....SV.IR.L...SV..I..H.H..W.VG.DK..A.QVGFa......gQVISAL....WI.C..Y..M...C.AA.ALISIT....EVKV....WR................G.R.ALVK...-RNTAYE..SAFWYASQ......VAKLCM...P.LS....YNF.M..TFL.TSEVYT.......................................KTTF.YNFLG....R.hIDF........T...R-....LG..RWLD....GF...FP.IILV.IPVLATLF...................................................................................................................................................................................................................
E2BPT8_HARSA/8-532                   ...........................................................................................................te--IIVAFLLAGT.L......LFKY..GNV...F...RHHI....................................................IVTVSVLIAW..YFSLLIIF.ILPLDVSS..TVFRQC..vEqnihnstks..............................................................................................................................................panttsvpfaTCKEPW.P..NV....P...E.....S.V.FP.NL...WRIVYWTSQCLTW................LI..LP.LMQ.S....Y....I........K........A.......G..D...F....T.V.RG...................................................KLK.S....ALID..N...A...IYYG..S...Y..L..FI..CG.IL..LI.........YIAL.K.-.PG.LDFDg....qK............................................................................................................LKVIAS..SA..SNTW.G.L.FLL....VLLLGYA.LVEV.......................................PRGLWN...................AS.KPG..YTLSYSYFK..VA..KLS...LD..KCE.A.E...ETVDD...IL...ESLQI.A.TIS.I..G.PGH...................................................................P-FH..CN.LETIFQ..........................................................................................................................................KI..PA.E..LK.D.RMNRRQLP.D--..----DT.pTDT....................................pTEKSLIRLH.R.QT.............................................IK.ALQTLQRIET.QWG...ILVDKI..FDLE....................................................................................................................DVAKNQVSHdrrfkqafpt.............................................................................................................................hrslpfriiyNPVIEWYW.K..CV...V...K...NYVL....KM....AA....IC.A.G.CLSVAVVWSEVT..FFN........................................................KSP..VL....SL.FA.Q...FL..-..K.L..A.KR.NY..D.YFTI........EVLSML....II.A..Y..L...C.YC.AYSTVL....KIRV....LN................L.Y.YLAP...HHQTNEY..SLIFSGMM......LCRLTP...P.MC....LNF.L..GLI.HMDSHIikt.................................hilETHY.TQVMG....H..MDV........I...PI....IS..DGFN....VY...FP.IAIL.AFCLATYF...................................................................................................................................................................................................................
G7P2Z4_MACFA/20-293                  ............................................................................................................l-LLLAILAFCWI.Y......VRKY..QSR...R...ESEV....................................................VSTITAIFSL..AIALITSA.LLPVDIFL..VSYMKN..qNgtfk........................................................................................................................................................dwanaN----V.S..RQ....I...E.....D.T.VL.YG...YYTLYSVILFCVF................FW..IP.FVY.F....Y....Y........E........E.......K..D...D....D.D.TS...................................................K-C.T....QIKT..A...L...KYTL..G...F..V..VI..CA.LL..LL.........VGAF.V.P.LN.VPNN......Knstewekvkfl......................................................................................feelgsshglaALSFSI..SS..LTLI.G.M.LAA....ITYTAYG.MSAL.......................................PLNLIKgtrs...........aayeRL.ENT..EDIEEVEQH..IQ..TIK...SK..SKD.G.R...PLPAR...DK...RALKQ.F.EER.L..R.TLK...................................................................KRE-..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------rhlefiensw.........................................................................................................................................................................................................
C1GTK0_PARBA/1-351                   .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................-----M..AL..AYFW.G.L.ALA....IYLMGHG.LVAI.......................................PRTLIR...................NA.NLG..NKLRRIQAR..AP..RIH...DH..LTD.S.M...ANLEE...LE...YQVSQ.L.RER.K..T.GVP...................................................................RDLQ..EW.IDELVDm........................................................................................................................................tSI..PEsR..LR.A.SVGAETSR.---..----LS..--Vpp.................................viTTRYLADVT.R.RL.............................................AR.VRHQNARFTN.TWK...RLVKEA..ADTQ....................................................................................................................CIIDSAASKrlefshpslc.............................................................................................................................sspnrslpfiTPTIRYYI.F..VH...I...L...PAGR....LA....LA....GF.F.S.LASACVVWSEIV..KSF........................................................-AP..RV....SI.VT.L...SV..V..H.N..P.-T.KS..E.PIGFi......gQVASAA....WI.F..Y..M...C.SA.AFVGIT....DAKV....WG................N.R.ALVP...-RNTYGE..SACWYAGQ......VAKLTV...P.LS....YNF.L..TFL.PQDVQK.......................................KTTF.YHFLG....R.lINL........T...P-....LG..KGFD....YV...FP.IFIL.IPVCATLF...................................................................................................................................................................................................................
A0A022R3P5_MIMGU/6-491               .......................................................................................................lislpl------TLGMVI.L......TLKY..FSG...P...DVPR....................................................YVFFTVGYTW..FCSISIII.LVPADIWT..TIIGHG...N................................................................................................................................................................gG-----.-..--....-...-.....-.-.IS.FF...WSWSYWSTFLLTW................LV..VP.LIQ.G....Y....E........D........A.......G..D...F....T.M.IE...................................................RLK.T....SIHV..N...L...VFYL..I...V..G..SI..GL.LG..LI........lLITM.D.K.DR.FGSR......G............................................................................................................ILGWAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKNIWK...................NA.DWT..NRHKVLSHK..IA..KIA...LK..LDD.A.H...QELSN...AI...VVAQA.T.SKQ.M..S.KRD...................................................................P-LR..PY.MDVIDNmlv....................................................................................................................................hmfK-..--.-..--.V.DPSFKPQG.GRL..GEN-DM.dYDT.....................................DEKSMATLR.R.HL.............................................RG.AREEYYRCKS.EYL...TYVTEA..IELE....................................................................................................................DTIKNYERRsmtgwkyissf...........................................................................................................................rpersgtlgsfLDMAELVW.R..CI...L...Q...KQLE....KI....FA....VI.L.G.CMSVAILLAEAT..LLT........................................................NGV..DL....SL.FS.I...LV..K..S.-..-.-V.GN..E.EVLV........QIFAFV....PL.M..F..M...C.VC.TYYSLF....KVGR....LM................F.Y.SLTP...-RQTSAV..SLLMICSM......VARYAP...P.IS....YNF.L..NLI.SLGKGK.......................................ETIF.EQLY-....-..---........L...S-....LW..DGFN....SI...YP.LIMV.IYTI----lvasn..............................................................................................................................................................................................................
W7TPT9_9STRA/69-573                  ............................................................................................................v-LAILLALATFY.L......LRYY..RS-...P...DVSP....................................................SVTVLIYISW..LLGFAGVF.LLPYDLGD..------...V.................................................................................................................................................................--QVYH.R..SL....-...-.....P.W.IL.KV...WKGIYWSTFILTW................LV..LP.IVF.S....Y....L........E........S.......G..Y...F....T.P.RD...................................................RIL.D....ALRD..Q...L...RMAF..I...A..L..VA..LV.GF..CI.........YLVA.Q.-.-R.YTLA......G............................................................................................................AEGLLM..AL..GNTY.G.L.LFV....VVLLGNG.LVEV.......................................PRKLWK...................SS.FPD..QELKRLYFR..SS..LVD...SD..LHD.A.V...CVLSD...VE...AEVSA.L.REQ.L..R.QSPpag............................................................eelaLELD..-A.CMKILQdtr...................................................................................................................................asfrHR..PE.D..M-.-.-TLGMLLP.RTP..FGVNSH.pTSGp..................................ppSLAHLAGLH.A.RL.............................................KK.AQLRVQVLKK.QRD...AVISKV..EVIE....................................................................................................................AVCQ----Galpypsdvkagdg......................................................................................................................egccaalgawashlGTVLAWYW.L..TT...L...S...HCTL....RL....LA....IL.G.W.FLTVCFLWSQVF..LGS........................................................-PY..AL....SP.YG.A...FQ..-..-.Q..A.FG.TS..S.PFAI........QLAIAV....PL.A..Y..V...S.IC.TYRSLF....KFKL....FG................E.F.SLQG...PHQSLAG..PLLVNAQY......LIRLQF...P.LA....YNF.L..LML.RSPSSK.......................................QTAF.RHLMS....N..MAV........V...PL....LG..RGFS....VY...AP.LMMV.VLAAFTYF...................................................................................................................................................................................................................
LMBD1_PHANO/15-260                   ............................................................................................................v-AIAILLAIASI.F......VFLY..QKP...R...DRAA....................................................SVTVVCIFTT..LALLATVL.LIPVDVAL..VSSTSR...Sslgqkkdw................................................................................................................................................atpdkvhgiV-----.-..--....-...-.....R.T.LE.IV...YYTLYSLDALLCL................IV..VP.FTY.F....W....Y........E........E.......Y..D...E....D.A.AE...................................................HGE.Q....TAGQ..R...I...WGAF..K...Y..T..IA..FL.VF..VV.........TIFL.I.G.FF.VPFA......Kqakddkrldldy....................................................................................fkhllsenhgerALAFAL..GL..LMTV.G.T.VLF....VLYTGAG.MAML.......................................PVAMIKsa...............pyV-.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------snptlaantasqleanrerqrqlegrnegrd....................................................................................................................................................................................
E1BV17_CHICK/8-540                   ............................................................................................................l-EIVFVFFLALF.L......LHRY..GDF...K...KQHR....................................................LVIIATLLAW..YLCFLIVF.ILPLDVST..TIYNRC...Klavnsspaesn...........................................................................................................................................ssfvtlapskqQCFKPW.S..YI....P...N.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PK.FNLQw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSHWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...IM...EEVRK.V.SES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.E..YQ.E.RMGRNMDD.YED..FDERQN..SYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWQ...ILLEQA..FYLE....................................................................................................................DVAKNETSAtrqfvhtfqsq...........................................................................................................................epenkiiqyfyTPTVEWYW.E..CL...L...R...PWFY....RV....LA....VV.L.A.TFSVIVVWSECT..FFS........................................................TRP..VL....SL.FA.V...FI..-..Q.L..A.EK.TY..N.YIYI........EMACFL....TI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDATIsht.................................daqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
G5AU28_HETGA/264-449                 .....................................................................................................ldmellhr------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.---QVLALQT.QRV...LLEKRQ..----....................................................................................................................---------.................................................................................................................................................--KASAWQ.R..NL...G...Y...PLAM....LC....LL....VL.T.G.LSVLIVAIHILE..LLI........................................................-DE..AA....MP.RG.M...QD..P..S.L..G.QV.SF..S.KLGSf......gAVIQVV....LI.F..Y..L...M.VS.SVVGFY....SSPL....--................F.R.GLLP..rWHDTAMT..QIIGNCVC......LLVLSSa.lP.VF....SRT.L..GLT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNAA.FAGLTTLC...................................................................................................................................................................................................................
LMD2A_DICDI/7-538                    ............................................................................................................f-ILIAVGLLSTK.I......LHRY..ISI...K...KIPW....................................................YVYISVWIGW..FMCFSIVI.LVPIDILC..TDYRQC..kHisdsqseklneiitnisng..........................................................................................................................tnsgsnnnnnnnneiinkydSCEEPW.A..YI....S...N.....D.K.LE.YI...YQTFYFGTLLLTW................LV..YP.LMG.S....F....V........L........A.......G..D...F....H.L.SG...................................................RIT.R....SIKE..N...A...YLYL..I...F..G..VI..GL.VV..MI.........WLLA.V.-.KQ.LDWN......S............................................................................................................MVGFAM..AA..ANTW.G.L.CLV....IILMGYG.LVET.......................................PRSIWV...................SS.QRS..LVLKHLQFK..AV..ELL...NS..KKK.A.N...EELIA...TM...KVIRR.I.QEK.T..K.KYD...................................................................P-YE..KY.IKIIVD..........................................................................................................................................QC..PP.E..QY.A.LVQRGEGD.GEA..------..---.....................................TYSVLVALN.S.RL.............................................KN.AITNSQRAEF.LYD...QCLVEA..FELQ....................................................................................................................DIQNSAISLdknvnwsfr..............................................................................................................................eqrqgrfakkLDIMEWIW.Y..NY...L...E...ISVF....RV....AA....IV.F.A.VLSLLIIWSEFA..LAF........................................................TSF..DI....SV.LS.N...IV..-..-.-..K.HS.NV..S.NIFV........QFILFF....PL.G..Y..E...A.LT.CYSTLF....KIRI....FN................Y.Y.RLIP...HQHSDSN..SIIFSAAY......LCRLGA...P.LC....YNF.I..QFI.NMNSGIe....................................dnRTSF.SVVMG....T..MNV........A...PF....LG..TYFY....IY...FP.LLIV.IVCLSTLF...................................................................................................................................................................................................................
L8IHY6_9CETA/235-450                 ..........................................................................edleeqlhcsafeeaaltrricnptscwlpldmel------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.LHRQVLALQT.QRV...LLEKRR..----....................................................................................................................---------.................................................................................................................................................--KASAWQ.R..NL...G...Y...PLAM....LC....LL....VL.T.G.LSVLIVAIHILE..LLI........................................................-DE..AA....MP.RG.M...QG..A..S.L..G.QV.SF..S.KLGSf......gAVIQVV....LI.F..Y..L...M.VS.SVVGFY....SSPL....--................F.R.GLRP..rWHDTAMT..QIIGNCVC......LLVLSSa.lP.VF....SRT.L..GLT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNAA.FAGLTTLC...................................................................................................................................................................................................................
G2YRC7_BOTF4/18-453                  ............................................................................................................i-ALLVISLVVLL.I......LRHY..LPI...R...TTPA....................................................YLLVPIFFAL..WLPASIVL.LVPIDLAS..NARTED...Ags.............................................................................................................................................................rgI-----.-..WL....Y...D.....R.V.LL.VA...WRITYWLTFALTW................FI..LP.ILA.E....Y....A........D........A.......G..Y...R....D.P.KG...................................................RLL.F....SLRA..N...A...QYQA..L...I..L..GA..GL.AT..ML.........YIFI.K.-.EG.VSPE......S............................................................................................................LKSVVM..AL..AYCW.G.L.VLA....IYLMGHG.LVAI.......................................PRNLFR...................NA.SIS..GKLRRIQTR..AP..KVH...EN..MEE.A.I...QKLED...LE...AQVAQ.L.AQR.K..T.GTA...................................................................RDFK..DW.IEELADe........................................................................................................................................tHL..PE.S..RP.R.TLSRRMSE.PHA..TIP---..-NV....................................iTERYLADLS.R.QL.............................................TR.ARHSRARYLD.EWD...RLLKDA..VHTQ....................................................................................................................TVLDSAASKkieigqssph.............................................................................................................................ssafdritifTPHTRYLY.Q..YF...F...L...PYSK....IV....LG....VV.L.T.LASICIIWSEFI..KSI........................................................-NP..IF....SI.IA.V...TV..V..H.H..R.DS.EK..G.EIGFa......gQVIASF....WI.L..Y..M...C.AA.ALSSLS....EVKV....WR................G.R.ALVR...-RNTHGE..AAM-----......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------c..................................................................................................................................................................................................................
H3DGN7_TETNG/20-302                  ..........................................................................................................ftf-ILLAILAFCWF.Y......IRKY..QSR...Q...ESEV....................................................VSTITAICAL..AIALITSA.LLPVDIFL..VSFMKY..pNgty..........................................................................................................................................................kewaANNVTR.E..QI....E...N.....S.V.LY.GY...Y-TLYSIILFCVF................LW..IP.FVY.F....Y....Y........E........E.......K..D...D....D.N.MN...................................................--K.C....LQVK..N...A...LKYT..I...G..F..VF..VC.VA..LLli.....gaFVPL.E.P.--.---A......Pghnstqwqkvqy....................................................................................lfeelgsshglyALSFSI..SS..LTLI.G.M.LAV....ITYTAYG.MSVL.......................................PLNLIK...................G-.--T..RSVAYERLE..NT..EDT...ED..VEH.Q.I...EKLKS...KC...SDGRP.L.SSR.D..R.NNL...................................................................REL-..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------esrllvlrrrgrhleiaekncctkvgr........................................................................................................................................................................................
K8ER22_9CHLO/6-578                   ........................................................................................................afvas---ALVVALVLR.T......LNYF..SDK...R...NNPV....................................................SVKAQVFLSW..TLSVSILT.LVPLDVGY..ALSRMG...Neengg.......................................................................................................................................................ahertD-----.-..--....D...G.....N.V.MT.HM...WGVTYWSTFLLTW................VI..LP.LHQ.I....Y....E........D........S.......G..D...F....T.F.AS...................................................RCS.T....ALRE..N...V...VFYL..V...L..V..GI..LA.IG..AT.........GLLF.F.-.GS.LDAS......S............................................................................................................LSAYGI..VV..ANAW.G.I.STG....ILLVGYG.LVEV.......................................PRALYK...................RS.FLD..DRPTRAYKR..VA..HVS...RS..LQE.A.H...EDLKK...VC...KAVAT.T.ARV.M..P.RRH...................................................................-ELR..WA.MDIIESevpdaetlrmdn.................................................................................................................nsnnnnnnngggpSS..SS.P..--.-.--------.---..------..--MhatgtsssrrgsygemnamgvmmddddddamldydydLEKDLARLR.R.RL.............................................KR.SLRVYRRTRA.QYV...EAVEDA..FQAE....................................................................................................................ATYQTSKSAhgrlikppsasggiisqdllqn....................................................................................................gsalrdgggvssssspspsirsiRDSIEKFY.R..CT...F...E...PMTC....KV....LA....FS.F.A.FLSLAIILAEST..IWTgd...................................................algEHA..TL....SL.FG.V...IV..-..-.-..E.RN.VN..N.VLTL........HMAIFV....PL.F..Y..V...C.FC.AYLSLG....RLGM....FS................F.Y.TLVP...-YGTDSL..SLLFNASL......VCRYSA...P.LA....YNF.L..ALL.PVLSRP.......................................SVPP.TTFAK....K.mAEH........I...PE....AA..QRFN....TI...VP.GFLA.IYCALIA-f..................................................................................................................................................................................................................
R0KTT4_ANAPL/6-240                   .............................................................................................................LLFAVLYIVSYF.I......ITRY..KRK...A...DEQEdeda............................................ivnrISLFLSTFTL..AVSAGAVL.LLPFSIIS..------...Neil...........................................................................................................................................................lsfPQNYYI.Q..WL....N...G.....S.L.IH.GL...WNLASLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................---.K....GIRA..R...I...LETL..V...M..L..IL..LA.LL..ILg......ivWVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRMftvmg.............................qllvkP-----...................--.---..TILEDLDEQ..MY..IIT...LE..EEA.I.Q...RKLNG...T-...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sstvey.............................................................................................................................................................................................................
G3UI42_LOXAF/8-546                   ............................................................................................................l-EIVFVFFLALF.L......LHRY..GDF...K...KQHR....................................................LVIVGTLLAW..YLCFLIVF.ILPLDVST..TIYNRC..kHaaanssppensni......................................................................................................................................tgsyataipryfqhPCFKPW.S..YI....P...D.....G.I.MP.VF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PR.LHLEw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.L-EI.......................................PRSYWD...................G-.KKG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLER...HH..gDEVRK.V.NES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.E..YQ.E.KMGRNMDD.YED..FDEKHN..TYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWQ...ILLEQA..FYLE....................................................................................................................DVAKNEASAtrqfvhtfqsp..........................................................................................................................epenrfiqyfynPTVAEWYW.E..CL...L...R...PWFY....RI....LA....VV.L.S.VFSVIVVWSECT..FFS........................................................TRP..VL....SL.FA.V...FI..-..Q.M..A.EK.TY..N.YIYI........EMACFL....SI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDSSIshq.................................ntqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
E1ZL65_CHLVA/11-475                  ...............................................................................................svicgvaaalvwlp------------.-......----..--S...R...TTGW....................................................LVRLDVGLAW..FAALATLI.LVPTDVAA..ALSQQD..pG.................................................................................................................................................................P-----.-..--....-...-.....-.-.LA.VW...WRAAYWYGFSVQV................LV..LP.LHM.E....F....A........R........S.......G..E...F....S.I.KD...................................................RLL.A....AARY..N...L...LYYA..V...L..L..AV..AL.AG..LL.........LLLF.S.-.GR.LQPA......N............................................................................................................VIGFCI..AS..SNAY.G.L.VAA....IFLLGFG.LWAV.......................................PRALWN...................SA.DRR..GEQRRVYHK..AG..LQA...ER..AQA.A.H...RRLSA...AV...LTVRR.A.SVL.F..A.AHD...................................................................P-LR..PL.MDVVLGl.......................................................................................................................................aaSV..GP.S..F-.-.KLDAGVQV.P--..---DEA.eLDV....................................fDRADLARLR.R.EL.............................................KA.AMKDWEREHA.LYL...EAVQEH..LNLE....................................................................................................................EVVGRLEAG.................................................................................................................................................VPQGAPAL.D..RM...R...W...----....LL....LA....AL.A.A.LCSLAIVVAEAT..IAW........................................................TLP..NL....SV.VS.A...VL..-..-.-..R.SA.AG..S.RFAT........ELLCFL....FL.A..Y..P...C.AC.AYYSLY....RLGR....FA................F.Y.RMVP...-RHTDAY..SLCFSALL......MCRFAA...P.LA....FNF.M..AAI.AMPETKghgt...............................pdvtSTVF.YSEFG....Q.lMMR........Q...PL....IG..WQFT....TF...AP.VLLV.PWVL----llas...............................................................................................................................................................................................................
G0UJT5_TRYCI/11-285                  ..........................................................................................................vic--SLICLAVAIY.T......LFYF..ISE...E...DSEGg..................................................yFTKGLVILGM..LLAMGVVL.LLPLDASN..-ARDP-...Tv...............................................................................................................................................................wN-----.R..YI....N...T.....L.N.TD.LM...WEIVLWSLCIIAL................AV..AP.FAV.F....F....Y........Q........A.......Y..D...P....E.N.ES...................................................-LS.K....QFAS..A...S...VMTT..V...L..L..FA..FG.IT..TAv.......cFLTA.G.V.AQ.VPVE......Vyasepqfvtdvgkis..............................................................................ynstgvweyldvhvsFFTYVV..GE..LCLL.G.W.VAF....FFYGGVG.LVSV.......................................PVDFIY...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------gfltrpqpisattfaqemsviaakgdallemgialqneargkissklrnkirllrietylleeeqed................................................................................................................................................
A0E6M0_PARTE/7-503                   ............................................................................................................f-EILIVTGLIGY.L......IQSY..CS-...K...DVNI....................................................YVKGMALVSW..LINFLLLL.FLPFDIYI..TYRDQGv.gNi...............................................................................................................................................................sN--D--.-..--....-...Y.....L.N.LA.ET...YQILYWTNFILCW................TV..IP.IMQ.E....Y....E........E........S.......V..E...L....D.K.KD...................................................KIK.K....ALKN..N...M...RFYI..V...I..S..VV..GL.VF..VL.........AIFY.T.-.GQ.AQQC......G............................................................................................................LGSFLK..SM..ANSF.G.V.ALI....IVLLGYG.LVII.......................................PKAQMR...................TS.QLD..VQLKYLYFR..TA..SIN...GE..KDD.A.H...HKLLE...TS...MKVFQ.I.KDQ.R..F.END...................................................................-DMM..YY.LNKCLN..........................................................................................................................................KI..PR.N..MH.K.ILKKEEEK.RKS..QLLITI..TGAffkn.............................kgpeSVEEMMNLY.Q.EI.............................................RK.NSLEYKRIKA.QWK...ENCKSA..YEME....................................................................................................................DIIKAMNSQdkkvhfsfk..............................................................................................................................kpregslaqqLDLLEWQW.L..CV...I...K...PQFK....II....IS....LI.F.G.ILSILVLISEVT..IFM........................................................-GT..QF....TI.FG.L...PL..-..-.-..-.RY.VD..G.LLSI........SFYSFI....PL.L..Y..I...A.FC.VYYGLF....KIRI....QG................F.Y.GLYG...DHQTDAP..SLMFATIN......FSRVGA...P.LC....QNF.L..NMI.KLK--Q.......................................ETAF.RYAMG....N..IEL........L...PI....FG..ISIT....AL...MP.CLLI.VLCLINYF...................................................................................................................................................................................................................
B3NZS8_DROER/7-540                   ...........................................................................................................fg--IVAALFLASI.S......LYRY..GNI...P...RQHI....................................................LVTLSVLTAW..CFSFLIVF.TIPLDVTS..TLYRQC..vEehrptpapnvt...........................................................................................................................................ntstatvapppQCQEPW.G..MV....P...A.....S.V.FP.NL...WRIIYWSSQFLTW................LI..MP.LMQ.S....Y....L........K........A.......G..D...F....T.V.KG...................................................KLK.S....ALIE..N...A...IYYG..S...Y..L..FI..CG.VL..LI.........YIAV.K.G.ES.LDWQ......K............................................................................................................LKAIAS..SA..SNTW.G.L.FLL....ILLLGYA.LVEV.......................................PRSLWN...................NA.KPG..FALQYAYFK..AA..KLS...TE..KAE.A.E...EHVDD...IL...ESLQG.L.SRV.I..P.NNH...................................................................-ELR..PC.LETILR..........................................................................................................................................KV..PI.E..LQ.E.RASRNFAR.TGG..SGMGAT..SSTi..................................lpSEKALVRIH.K.QV.............................................IK.SLQTLQRTEA.LWS...VQVQTV..LHLE....................................................................................................................DVAKNIHSSdrrfksefpr.............................................................................................................................qrtqlericySATLQWYW.E..CL...L...K...APFL....KT....MC....VL.T.A.TMSAMVVWSELT..FFS........................................................RHP..VL....SI.FA.N...VI..-..Y.V..A.KE.SY..D.FFTI........EVFSMV....VL.C..Y..F...F.YC.TYSTIL....RIRF....LN................L.Y.YLAP...HHQTNEH..SLIFSGML......LCRLTP...P.MC....LNF.L..GLI.HMDTHIipn.................................rimETVY.TQIMG....H..MDV........I...GI....IS..NGFN....IY...FP.MCML.AFCLATWF...................................................................................................................................................................................................................
LMBD1_PODAN/19-272                   ............................................................................................................v-AVALVLLVAII.T......TFTW..QSP...H...ERSV....................................................TVSIVAIVSL..TSLLATVF.LLPVDIAL..VSSTAS...Ahlgakkdwa...............................................................................................................................................tperidgilL-----.-..--....-...-.....-.T.LK.VV...YYTLYSFDALLCL................IV..IP.FAY.F....W....Yee....ydE........V.......E..E...E....E.G.TS...................................................GAG.A....RFWK..A...A...KYTL..G...F..V..FL..VL.IL..FLl.......gFFVP.A.A.GS.GNG-......Khldldyfkr..........................................................................................llaankgekALTFGV..GL..LITL.G.T.FLY....TLYTGAG.LALL.......................................PVSLIK...................S-.APS..ISAPQLSAT..IA..TD-...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lehnrelqrqiemrnagrpdgisqkdrr.......................................................................................................................................................................................
W5HH57_WHEAT/2-290                   ..........................................................................................................rat------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................FPEYVV..AL..ATIV.G.S.VLF....TIFGGVG.IACL.......................................PLSLIF...................S-.---..---FVRRPK..AV..ITR...SQ..YIK.E.A...TELGK...KA...KELKK.A.AEA.L..H.QEE...................................................................RSGN..--.------..........................................................................................................................................--..--.-..--.-.-----KGR.KWR..------..---.....................................--KNVKAVE.K.EL.............................................LL.LENDMNALEE.MYP...QGEKAE..----....................................................................................................................---------.................................................................................................................................................----ATWA.F..TV...L...A...YIGK....LI....FG....IV.G.L.IVSIAWVAHIII..YLL........................................................VDP..PL....SS.FL.N...EI..F..I.K..L.DS.VW..G.LLGT........-AAFAF....FC.F..Y..L...L.IA.VIAGEM....MLGL...kLV................F.I.TIHPm.kWGGTLMN..SFLFNVGL......ILLCS-...-.--....---.I..SVI.QFCATAfay.................................yaqATAA.QEIFG....H.tLQS........L...RG....IK..YLYK...yNV...FQ.YGFV.ALAILTLF...................................................................................................................................................................................................................
W5L0L8_ASTMX/25-243                  ............................................................................................................q-LFICLYILSYL.I......LTHF..RKN...A...EFVTddied..........................................atvnkIVLWLCTFTL..SVAVCAVL.LLPISILS..------...Nevl...........................................................................................................................................................ltfPQSYYM.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........A.......E..G...F....T.G.SK...................................................---.R....GVMS..R...V...YETA..V...M..L..LL..LS.LL..VLg......ivWVAS.A.L.LH.DNTA......Resly...................................................................................................dlweyYLPYLY..SC..ISLF.G.V.LLL....LLCTPFG.MSRMfsvtg.............................sllvkPRLLEN...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------veetmncavfe........................................................................................................................................................................................................
D0N4S3_PHYIT/13-278                  ...........................................................................................................ii--AVALLICNVY.I......LVYF..QHD...D...DKNTa..................................................yFPKALVIFGL..FFAEATVL.LLPLDVAN..------...Nst.............................................................................................................................................................aiGCAEGW.N..SV....C...G.....N.InMD.LL...WLMVFLSIVIFLV................VL..LP.FAI.F....Y....Y........E........A.......D..D...G....E.D.TS...................................................--K.K....SQWG..E...A...IKME..L...G..T..IF..VA.VA..LIt......vlYFTS.A.K.SS.IPMR......Alevnamsategfqpyvdgttls................................................................stivtaasnvtmqhitltmdvsVPVYVT..GL..TSFV.G.W.FGF....SIFCGIG.LVAL.......................................PMDLIL...................AF.FHR..PK-------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------fisadvyaiqklilqrrsvelleigrsikqstdr.................................................................................................................................................................................
H9MAA4_PINLA/1-69                    .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.LA.VIAGAM....VLGL...rLV................F.I.TIHPm.kWGGTLMN..SFLFNVGL......ILLCS-...-.--....---.I..SVI.QFCSTAfav.................................yaqATAA.QEIFG....R..---........-...--....--..----....--...--.----.--------...................................................................................................................................................................................................................
H2UV38_TAKRU/15-299                  ...........................................................................................................sf-ILLAILAFCWF.Y......IRKY..QSR...Q...ESEV....................................................VSTITAICAL..AIALITSA.LLPVDIFL..VSFMKF..pNgty..........................................................................................................................................................kewaANNVTR.A..QI....E...D.....S.V.LY.GY...Y-TLYSIILFCVF................LW..IP.FVY.F....Y....Y........E........E.......R..D...D....D.N.IN...................................................--K.C....LQVK..N...A...LKYT..I...G..F..AF..VC.VV..LLli.....gaFVPL.-.-.-D.PPTG......Qnstqwqkvqyl......................................................................................fqelgsshglyALSFSI..ST..LTLI.G.M.LAV....ITYTAYG.MSVL.......................................PLNLIK...................G-.--T..RSVAYERLE..NT..EDT...ED..VEH.Q.I...EKLKS...KC...SDGRP.L.SSR.D..R.NNL...................................................................RELE..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------srllvlrrrgrhleiaekncctkvgralr......................................................................................................................................................................................
LMBRL_HUMAN/235-450                  .........................................................................edleeqlycsafeeaaltrricnptscwlpldmell------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.-HRQVLALQT.QRV...LLEKRR..----....................................................................................................................---------.................................................................................................................................................--KASAWQ.R..NL...G...Y...PLAM....LC....LL....VL.T.G.LSVLIVAIHILE..LLI........................................................-DE..AA....MP.RG.M...QG..T..S.L..G.QV.SF..S.KLGSf......gAVIQVV....LI.F..Y..L...M.VS.SVVGFY....SSPL....--................F.R.SLRP..rWHDTAMT..QIIGNCVC......LLVLSSa.lP.VF....SRT.L..GLT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNAA.FAGLTTLC...................................................................................................................................................................................................................
F7EIN7_MACMU/265-450                 ..................................................................................................ldmellhrqll------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.------ALQT.QRV...LLEKRQ..----....................................................................................................................---------.................................................................................................................................................--KASAWQ.R..NL...G...Y...PLAM....LC....LL....VL.T.G.LSVLIVAIHILE..LLI........................................................-DE..AA....MP.RG.M...QG..A..S.L..G.QV.SF..S.KLGSf......gAVVQVV....LI.F..Y..L...M.VS.SVVGFY....SSPL....--................F.R.SLRP..rWHDTAMT..QIIGNCVC......LLVLSSa.lP.VF....SRT.L..GLT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNAA.FAGLTTLC...................................................................................................................................................................................................................
K2GJ60_ENTNP/7-491                   .............................................................................................................LIFILAGIMALG.I......LFKY..INP...L...KTRW....................................................YVVLCSFVGW..YLAFLSPL.LMPLDIVS..TFRS--...-.................................................................................................................................................................--EKDF.L..YI....N...Q.....N.V.LI.VI...WWIIYILQFGLCY................LI..FP.IVQ.T....Y....S........I........V.......G..D...F....T.F.IR...................................................KLI.R....SIKR..N...V...IFYG..T...L..I..ML..LI.IF..FI........lFWFF.K.G.DE.LITSg....qE............................................................................................................YFGFAL..TL..SNAW.G.L.ILA....IGLMGNG.YIMY.......................................IYDTIR...................TF.TNK..LELRKNICD..VG..LCN...IR..MTE.S.K...KVLEE...QI...KVIKG.Y.DEI.I..N.EED...................................................................P-LR..PY.VNKCVS..........................................................................................................................................DI..KR.Y..YN.E.KYETSPSN.KVK..N-----..---.....................................NYTELAISN.E.KL.............................................QD.SLRKIIRDEK.LYE...KTITKT..-KQL....................................................................................................................FLIENETDIpel...........................................................................................................................................iqeIPKIKYYY.Y..KY...G...R...WFTN....IF....KT....LL.I.L.IFWIFIIQPELT..MIG........................................................KLK..NI....NP.TI.N...IT..S..S.L.lN.ND.LS..G.WVGV........E--TLI....IL.S..L..M...I.FF.AFSSFI....NIEM....IS................F.F.RITK...HQLSDSY..SIIFAGNY......LSRVGP...A.LA....MNF.I..HMI.NFTSNQysn.................................iqtQTAF.QIVNK....G..MEK........V...PF....FG.rNSFN....DT...FP.MCIFcIMVLSALF...................................................................................................................................................................................................................
G3UPB7_MELGA/1-206                   ............................................................................................................f------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.IS.GL...WNLASLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................---.K....GIRA..R...I...LETL..V...M..L..IL..LA.LL..ILg......ivWVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRMftvmg.............................qllvkPTILEDld...............eqMY.IIT..LEEEAIQRK..LN..GIS...ST..LEN.Q.T...VELER...EL...EKVKC.K.KTN.L..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------gnmlfilfhmdsslrdfkvlcsvcnqslin.....................................................................................................................................................................................
C1MZX1_MICPC/5-464                   .........................................................................................................phph------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.LG.ML...WDLTYWTTFALTW................FL..LP.IHQ.M....Y....E........D........A.......A..D...F....S.V.IG...................................................RLK.T....SLRE..N...L...IFYG..V...I..L..SV..IV.FG..VV.........ILVA.Y.-.GT.LTTA......G............................................................................................................LSGFGI..VV..SNMF.G.I.VTG....VFLLGYG.LVEI.......................................PRSMWR...................SA.DVE..TRPRRAARR..VG..VAA...EA..LKN.A.H...HKLRK...IT...RASET.T.QEV.M..P.RLH...................................................................P-LR..WA.MKTIAN..........................................................................................................................................ET..PK.A..SVfA.SASDALAS.AGA..YEDETA.pE-Eeddfl...........................dydydEIKDLVRLR.R.AL.............................................HR.CLRVYRRTAA.QYA...TCVMQA..LEAE....................................................................................................................AVATAAAIDgksclmgggggggear.................................................................................................................frspfrpprntkfgetAEKIEWWW.K..CR...A...Q...PLAL....RV....AS....VL.F.G.VFSALVVWSECT..MWTtq....................................................amNLS..DV....SP.FS.A...LV..-..R.T..A.AS.SG..S.EGGI........HVAVMI....PL.G..Y..M...V.YC.AQYSLF....RLGM....FS................F.Y.QLVP...-RHTDSF..SLLLNAAL......TCRYSA...P.LS....LNF.I..MLV.HSLQETg.....................................rETTF.TSKM-....-..YEN........V...PV....AA..QHFA....AY...FP.MVLG.VYCAAILF...................................................................................................................................................................................................................
K1XBW7_MARBU/15-256                  ............................................................................................................v-AVALVALIAAI.F......TYTY..QTP...R...DRSA....................................................LISTVTIITL..TSLLATVL.LLPVDIAL..VSHTTS...Tklgakkd..................................................................................................................................................watpeavhN-----.-..-I....L...-.....Y.T.LK.IV...YYSLYSLDAILCL................LV..VP.FTY.F....L....Y........Eey....ddV.......D..A...E....E.G.MQ...................................................TFS.Q....RFWG..A...L...KYTL..I...F..F..AL..VV.IL..FLv......gfFV--.-.-.--.-PVA......Kdrkgahydldy.....................................................................................fqrllvenhgerALTFAL..GL..LISL.G.T.LVY....VLYTAAG.FALL.......................................PISFIKs.................aPS.ISA..PQLSETTAT..A-..--L...EQ..NRE.R.Q...RQL--...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------egrhv..............................................................................................................................................................................................................
B4LWE0_DROVI/28-215                  .............................................................................................................LLIILLYFSSYV.V......VSRF..RRR...D...RDDLysnded........................................evlvyrISFWLCTFTL..AVAEGAAM.LLPVSIAS..------...Nevl...........................................................................................................................................................llyPNSYYV.K..WL....N...S.....S.L.IQ.GL...WNHVFLFSNLSLF................VF..LP.FVY.L....F....S........E........S.......T..G...F....V.G.HK...................................................---.K....GILA..R...V...YETF..T...V..F..IL..MA.II..VLv......ltAVLS.A.V.FG.IEKF......Qffwfl..................................................................................................nlgsvHLPFLY..SC..VSFL.G.V.MLM....L------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sit................................................................................................................................................................................................................
B4IMY0_DROSE/7-91                    ...........................................................................................................fg--IVAALFLASI.S......LYRY..GNI...P...RQHI....................................................LVTLSVLTAW..CFSFLIVF.TIPLDVTS..VSWNVE..lEnhlqsn....................................................................................................................................................iatignnR-----.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------nyestkylvtsi.......................................................................................................................................................................................................
W2YXF5_PHYPR/8-540                   .........................................................................................................lamc----GLLGFTWW.L......LTHY..KD-...A...KVPT....................................................VVHAAVFSTW..VLGFLGLI.LLPMDLAT..------...Nglvassq...................................................................................................................................................sagnvaeE-----.-..KA....S...F.....R.E.YL.AV...WRLLYWATFLMSW................VG..LP.FLV.E....F....R........Q........N.......G..E...F....E.L.DK...................................................RIL.S....SFRH..L...V...FHWT..V...L..A..GG..LF.IV..AL.........YLIL.V.-.DH.LSLY......G............................................................................................................VLGLAM..AA..SNTY.G.L.LWV....IALLGYG.LVEI.......................................PRGFWI...................RR.LDG..AQLQILHFE..AV..QLQ...NE..RME.A.R...FEYDD...VV...ADVHD.A.YQR.M..V.QAEsdaii.........................................................ltsemQ---..-Y.VKTCLLqvvaaiekskpaf................................................................................................................rrldtsndtkrgsKS..VS.F..SD.S.KMKR----.---..------..--Gvsnigr.........................asrkapTLTETIELH.R.RV.............................................RI.AQLELRRCDQ.AFL...ELCINV..----....................................................................................................................DILQDRSAQralpagslyp............................................................................................................................etsalnrlhniFLNMRHQL.R..QW...V...T...SPVA....IV....CA....VV.T.G.FLSLCVVWGELT..MGW........................................................RRS..SL....SL.FR.F...LI..A..V.E..A.ME.TS..S.SLRSa......tELISAL....VL.V..Y..L...A.LC.CYRSLF....TLRL....PG................K.Y.VLRA...HGNSTEL..CLLKTSIY......QCRLQF...A.LG....QNA.L..LLL.RGGGLA......................................eGTAF.NTLLA....N..TRV........V...HV....FG..RGFA....VY...AP.LAMI.ALAVFT--lt.................................................................................................................................................................................................................
C1G5H2_PARBD/15-274                  ............................................................................................................i-VVVILIAVASI.F......FYIY..QTP...R...ERSA....................................................YVTAVCIFTL..TALLATVL.LLPVDVAL..VSSTTS..sKqgr..........................................................................................................................................................rkpwATQDEV.D..KI....T...Y.....S.L.T-.VV...YYSLYSLDAVLCL................LV..VP.FTY.F....W....Y........Eey....deV.......A..A...E....E.G.LQ...................................................TWG.K....RFWG..A...F...KYTI..A...F..I..LF..AV.IL..FL.........VGFF.V.-.PV.ARNR......Eapnfdldyfr........................................................................................klltenhgerALTFGL..GL..LITN.G.I.ILY....VLYTSVG.FALL.......................................PVSFIK...................T-.APS..ISSPTLKAS..TA..SRL...EE..NIE.R.Q...RQLEG...R-...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------cggnldtlsskqrreldslv...............................................................................................................................................................................................
F7HSP6_MACMU/1-127                   ............................................................................................................m------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...---L..L...L..L..AL..LI.LG..IV.........WVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRMftvmg.............................qllvkP-----...................--.---..TILEDLDEQ..IY..IIT...LE..EEA.L.Q...RRLNG...LS...SSVEC.N.IME.L..E.QEL...................................................................---E..-N.V-----..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------ktlktkl............................................................................................................................................................................................................
LMBR1_XENTR/25-267                   .............................................................................................................LLFAILYIVSYF.I......IKRY..KRK...G...DEQEdeda............................................tvnrVSLFLCTFTL..AVSGGAVL.LLPFSIIS..------...Neil...........................................................................................................................................................lcfPKSYYI.Q..WL....N...G.....S.L.IH.GL...WNLVSLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................---.K....GIKA..R...I...LETI..I...M..L..IL..LA.LL..IFg......ivWVAS.A.L.ID.NSSA......Smesly..................................................................................................dlwdcYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRMftvmg.............................qllvkP-----...................--.---..TILEDIDEQ..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------myiislqeealqrklnggnytadysrkkiehd...................................................................................................................................................................................
E9CCY3_CAPO3/218-432                 ..................................................................................................slsyspeddav------------.-......----..---...-...---Ae..................................................kVSIWLCTFTL..AVSLAAIL.LLPISIVS..------...Nevl...........................................................................................................................................................lryPDGAYI.Q..WL....N...G.....R.L.IY.FF...WDFIFLSSNAALF................VL..LP.FAY.F....F....M........E........A.......V..G...L....F.G.RG...................................................---.-....-LLA..R...V...YETS..F...L..V..GL..LS.LL..FIv......faYVI-.Q.-.AT.FTTQplanflH............................................................................................................YFFFLY..SG..VSLL.G.A.VVS....LWYTPLG.VAQFvarashi.........................slpqpeaP-----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------ktidsklissadrlqeiaweetrlrleltrhqsvma...............................................................................................................................................................................
K6ZBT3_PANTR/240-445                 ...........................................................................................itleeealqrrlnglsss------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................-------VE.Y.NI.............................................ME.LEQELENVKT.LKT...KLERRK..----....................................................................................................................---------.................................................................................................................................................--KASAWE.R..NL...V...Y...PAVM....VL....LL....IE.T.S.ISVLLVACNILC..LLV........................................................-DE..TA....MP.KG.T...RG..P..G.I..G.NA.SL..S.TFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.NFTP..kKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAIVTTLC...................................................................................................................................................................................................................
H3GLU2_PHYRM/8-540                   ..........................................................................................................lav---CGLLGFTWW.L......LAHY..KD-...A...KVPT....................................................VVHAAVFVSW..VLGFLGLL.LLPMDLAT..------...Ngivass....................................................................................................................................................qsagtitE-----.E..KV....S...F.....R.E.YL.NG...WRLLYWLTFAMSW................LG..LP.FLV.E....F....R........Q........N.......G..E...F....E.L.DR...................................................RVL.S....SLRH..L...V...FHWT..V...L..A..GG..LF.VV..SL.........YLIL.V.-.DH.LSLY......G............................................................................................................VLGLAM..AA..SNTY.G.L.LWV....IALLGYG.LVEI.......................................PRSFWM...................RR.LDG..AQLQKLHFQ..AV..QLQ...DE..RME.A.R...FEYDD...VV...ADVRD.A.YQR.M..M.QAEsda............................................................iiltSEMQ..-Y.VKTCLSqvlaqvetnkpa.................................................................................................................fssldgsddakrtNN..SA.D..TS.S.KLKRGYSS.S--..-GRP--..--Tgr................................kapTLPETVELH.R.RV.............................................RI.AQLELRRCDQ.AFL...ELCINV..----....................................................................................................................DVLDDRNAQralpagslyp............................................................................................................................dtsalnrlyniFLDTRHQL.R..QR...I...T...SPVA....IG....CA....VV.T.G.FLSLCVVWGELT..MGW........................................................HGS..SL....SL.FR.F...LI..A..A.E..A.EE.TS..S.SLRSa......tELISAL....VL.V..Y..L...A.LC.CYTSLF....SLRL....PG................K.F.ALRA...HGNSTEL..CLLKTSIH......QCRLQF...A.LG....HNA.L..LLL.RGGGLA......................................eGTAF.NALLA....N..TRV........V...HV....FG..RGFA....VY...AP.LAMI.ALAVFT--lt.................................................................................................................................................................................................................
G2RBV0_THITE/23-522                  ............................................................................................................v-ALLCISVVVLL.I......LRYY..LPL...R...STPG....................................................YLLVPVFFAL..WLPASMVL.LVPIDLAS..SAMADD..vDa..............................................................................................................................................................rgI-----.-..WL....D...P.....K.A.LR.VS...WRIAYWLTFALTW................FI..LP.ILG.E....Y....S........D........S.......G..Y...R....E.P.RQ...................................................KVL.D....SLYA..N...A...QYYA..I...V..F..GS..GA.LG..LV.........YVLI.S.-.YG.HFSE......S............................................................................................................LKSTVM..AL..AYCW.G.L.VLA....IYLMGHG.LVSI.......................................PRRLFR...................NA.NIS..GRLRRIQTQ..AP..RVY...EK..MED.A.E...MDLED...LE...LQIAE.L.SRR.K..G.GSA...................................................................SLFQ..DW.IEELVD..........................................................................................................................................MT..NL.P..ES.Q.PSQAGILR.GSG..NQ---S.pLPNv...................................iTEKYLAELT.R.RL.............................................VR.AKHARSRYVD.EWN...RLLQDA..VETQ....................................................................................................................AILDSAASKkldfgkasps.............................................................................................................................sgfwdrhtlfTPYTRFLF.H..YH...L...V...PCLQ....IA....LA....VL.L.S.LASLCIVWSELV..KGL........................................................-FP..QL....SV.IR.Y...SV..V..Q.Q..R.DR.GK..D.QVGLv......gQVVAAL....WM.V..Y..M...C.AA.AFISIT....EVKV....WR................G.R.ALVR...-RNTAPE..SAFWYASQ......VARLSV...P.LT....YNF.M..TFL.GG-IYR.......................................DTVF.YDFLG....Q.lINL........T...P-....LG..KWFD....YL...FP.AFIL.LPVCATLF...................................................................................................................................................................................................................
W9IR89_FUSOX/17-274                  ...........................................................................................................av-AVVLCFAAAII.T......TFTW..QTP...R...ERSA....................................................VVSIVAIISL..TSLLATVL.LLPVDIAL..VSATAS...Atlgakkdw................................................................................................................................................atperidsiL-----.-..--....-...-.....Y.T.LK.VV...YYSLYSFDALLCL................IV..IP.FAY.F....W....H........E........E.......Y..D...E....I.E.VEee...............................................grTLS.S....RFLA..A...A...KYTL..F...F..V..AF..VV.VL..FLl.......gFFVP.A.A.GD.SSQS......Hwdldyfkk...........................................................................................lvaqnhgekALTFAL..GL..LLTL.G.T.LLY....VVYTGAG.LALL.......................................PISFIK...................AA.PSI..SAPQLHQTT..AS..QL-...EQ..NRE.R.Q...RQ---...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------iemrnagrqegmsrkdqreld..............................................................................................................................................................................................
W9WGM3_9EURO/13-508                  ............................................................................................................l-ALLTISVAVLF.L......LRHY..LPL...R...TTPA....................................................FLLVPIFLAL..VLPASALV.LVPIDLAS..SARESD...Hgg.............................................................................................................................................................kgI-----.-..WL....P...K.....R.A.VL.VS...WRIVYWLTFVLTW................VV..LP.LLG.E....Y....M........D........A.......G..Y...R....D.P.KS...................................................RLV.Y....SLRS..N...G...RYQL..I...V..L..VC..AI.AG..LV.........YMIF.S.-.YG.FDFT......A............................................................................................................IRALVM..AL..AYVW.G.L.ALA....IYLMGHG.LVSI.......................................PRRMFR...................KA.DIS..GSLRRVQGQ..AP..RVH...EK..LED.A.I...VALDE...LE...AQVMQ.L.KQR.K..T.GSA...................................................................RDFQ..DW.IDELVD..........................................................................................................................................MT..GQ.P..ES.R.VFSNVTT-.---..IDASAK.vPAV....................................iTDRYLADLT.R.RL.............................................VR.AKHRRARYIR.EWD...NIVQTA..SDLQ....................................................................................................................AILDSKASRkldfgrst................................................................................................................................spslkrsliTPSLRYHL.Y..VH...I...I...PAVR....IA....LG....AV.L.S.LASIAIIWSEII..KFP........................................................-AP..HL....SA.VS.L...TV..I..H.H..P.RD.KN..Y.QIGFg......gQLVAST....WI.T..Y..M...C.IC.ALSSMN....DVPT....WN................Q.R.ALVR...-RNTYAE..SACWYAGQ......IAKLTV...P.IA....YNF.L..TFL.PKDIHR.......................................NSTF.YDFLG....R.lINL........T...P-....LG..TWFD....YL...FP.MFIL.LPVIMTLF...................................................................................................................................................................................................................
F2PH44_TRIEC/15-275                  ............................................................................................................v-VVAILIAIASV.F......VYVY..QAP...R...ERSG....................................................LVSAVCILTV..SALLATVL.LLPVDIAL..-ISSTN..sRklgqrkd...................................................................................................................................................watpdavA-----.-..SI....V...Q.....S.-.LT.IV...YYSLYSLDTILCL................LV..IP.FTY.F....W....Y........Eey...delA.......E..Q...Q....D.W.NA...................................................-FG.K....RFWG..A...F...RYTI..A...F..L..VV..TV.IL..FL.........VGFF.V.-.PV.ARNR......Agagldldyfk........................................................................................hlltenngerALTFAL..GL..LTMI.G.I.IVY....VLYTSAG.LALF.......................................PVSFIK...................T-.APS..VSSPSLYAT..TA..SRL...EE..NVE.R.Q...RQLEG...R-...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------cggyldhlsskerreldslvr..............................................................................................................................................................................................
K9FJG1_PEND2/19-513                  ............................................................................................................l-ALFLISAFVLL.L......LRRF..LTL...R...ATPA....................................................YLSVPIFLAL..ALPASVVL.LVPIDLAS..SSRDGS...G.................................................................................................................................................................P---KA.I..WL....P...E.....R.M.VL.VC...WRIAYWLIFVLTW................AI..LP.LLG.E....Y....V........D........S.......G..Y...R....E.P.KG...................................................RLM.Y....SLRS..N...A...RYQL..I...V..L..GC..AM.VG..LI.........YVSI.S.-.NG.FEFT......S............................................................................................................IKGLVM..AL..AYVW.G.L.VLA....IYLMGHG.LVSI.......................................PRNLLR...................NS.NVS..GRLRRLQAH..AP..KVH...DR..LMD.S.V...NELAN...LN...GQVAQ.L.QRR.K..T.GTA...................................................................RDFR..EW.IEELRDgh.....................................................................................................................................gqsD-..--.-..VR.A.PILELPDT.-SA..------..--Mip................................sviTERYLADLT.R.RL.............................................RR.ARHMKARFVD.EWD...RLVQLS..ADLQ....................................................................................................................AIINSTASKklefapaprr.............................................................................................................................sswipqvtflTPYMRYQL.Y..SN...V...I...PSVR....LA....FG....TF.F.A.VASACIVWSEMI..KSL........................................................-AP..HL....SA.VS.L...TV..V..H.N..W.DN.NP..V.GFGG........QLTASA....WL.L..Y..M...C.SA.ALVGVS....DVKV....WG................N.R.ALVR...-RNTYGE..SACWYASL......VARLTV...P.IA....YNF.L..TFL.PKEFRR.......................................TTTF.YGFLG....K.lINL........T...P-....LG..KGFD....FI...FP.IFIL.LPICATLF...................................................................................................................................................................................................................
U6MDB7_EIMMA/102-198                 ...........................................................................................................qr------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.----CF....KLAVh..lFC................C.F.SIHPl.rRDATRLN..SILFNVGL......VCISSC..gT.VL....FSY.N..AFR.EY---A......................................rGTEA.ALTFG....V.eFQH........L...RF....LG..PMFR...wNI...FE.LILL.VVFLLTL-lf.................................................................................................................................................................................................................
K7HV66_CAEJA/38-165                  .............................................................................................................WLFMLLYLFAFW.V......ISRL..KRK...T...EREAlyagee........................................dylvyrVSVWISSTAV..GTSLGSLT.LLPFSVIG..------...Vell...........................................................................................................................................................qlyDGNYYL.Q..WL....S...Y.....S.L.IG.AL...WHYVFMLCNLSLF................VL..LP.FSY.F....F....I........E........S.......Q..G...F....S.A.HK...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------ggnvsfwse..........................................................................................................................................................................................................
B7Z633_HUMAN/218-415                 ..........................................................................................iitleeealqrrlnglsss------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................-------VE.Y.NI.............................................ME.LEQELENVKT.LKT...KLERRK..----....................................................................................................................---------.................................................................................................................................................--KASAWE.R..NL...V...Y...PAVM....VL....LL....IE.T.S.ISVLLVACNILC..LLV........................................................-DE..TA....MP.KG.T...RG..P..G.I..G.NA.SL..S.TFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.NFTP..kKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..GLH.KL--HLpnt................................srdsETAK.PSVNG....H..---........-...--....--..----....--...--.----.--------qkal...............................................................................................................................................................................................................
F4P0N2_BATDJ/8-489                   ............................................................................................................f-VFMGMAAVVAV.L......IDYF..GNR...K...SFPW....................................................YVLAACFISY..FFPFTIIL.MLPLDLAS..TRYRDCs.sNpl............................................................................................................................................................ittPCDLPL.A..YV....S...E.....E.F.LY.RF...WEVVYWITFNIQM................FV..VP.IMQ.G....Y....V........R........S.......G..E...L....S.F.GR...................................................RLW.S....GIKD..N...L...IFYC..I...C..G..SI..GS.IF..VL.........YALF.A.-.LH.ISAE......Y............................................................................................................LLTLAI..PA..TNAY.G.L.LLL....TILMGYG.LVEV.......................................PRGLWY...................NA.NVS..WVLRYLEVQ..AP..KLK...EA..CVD.S.E...TDIYD...IA...RLVGH.A.SRK.I..E.TGD...................................................................-ALR..PL.VDQMME..........................................................................................................................................KC..PL.A..LQ.Q.RSAAEEED.DLP..N-----..-SF.....................................TRDKLIDLH.A.RI.............................................KY.AAFLSERDQA.LLK...YLEQNA..FLCQ....................................................................................................................DIIAN----.................................................................................................................................................-------Y.G..NS...S...R...PIAM....RS....LS....VM.C.V.IASLLVIWSEST..FQF........................................................TSV..TL....SI.PA.L...IV..-..-.-..E.PG.NI..S.YGSL........EILAIG....FV.C..Y..M...C.TC.TYSTLL....TINI....FE................Y.Y.KMVP...EHHTNEV..SLLFVGAY......LCKLTF...P.LC....YNF.L..NMG.GLAEGVsrknst...........................mvdyssSPVF.IQYFG....P.aVNL........T...PL....FG..AGYN....DW...VA.HLVL.ITCV----visl...............................................................................................................................................................................................................
F7A4I2_MONDO/243-445                 .............................................................................................eeealqrrlnglsssv------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................--------E.Y.NT.............................................ME.LEQELDNVKA.MKS...KLERRK..----....................................................................................................................---------.................................................................................................................................................--KASAWE.R..NL...V...Y...PAVM....VL....LL....IE.T.S.ISVLLVACNILC..LLV........................................................-DE..TA....MP.KG.S...RG..P..G.I..G.NA.SL..S.TFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.SFTP..rKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAIVTTLC...................................................................................................................................................................................................................
I7GPL7_MACFA/1-78                    .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...M.VS.SVVGFY....SLRF....--................F.G.NFTP..kKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..GLH.KLH--Lsnt................................srdsETAK.PSVNG....H..Q--........-...--....--..----....--...--.----.--------kal................................................................................................................................................................................................................
A0A023B3V7_GRENI/15-459              ..........................................................................................................gvg------LVATLW.F......VYHY..CHP...D...DLKYnq................................................giLAQVVVIFGF..QIAYLSFC.LVATDAYN..------...Erfe...........................................................................................................................................................gqfN-----.-..--....-...-.....-.-.MS.YC...WKLVYLMIVIYLS................IV..LP.LAV.F....Y....Y........E........A.......D..S...D....P.R.IT...................................................--K.T....SPLV..Q...T...LKRG..S...M..Y..IV..AV.WG..VIg......llYLAC.R.K.MT.IGGE......Hcldegcsvs.........................................................................................vptsqtvtleFLSYLI..GL..PGFI.G.W.FVF....MFTGGIG.IASV.......................................PVGLFM...................K-.---..----WWHFP..KP..LPV...HE..YEK.M.K...KVLGE...RA...TALRE.V.GEG.L..A.AHE...................................................................--MR..--.-----K..........................................................................................................................................K-..--.-..--.-.---N----.---..------..--Gl...................................rNPTARMRFR.S.KV.............................................SK.YKEIVQLLSE.EYE...RLEKRA..----....................................................................................................................------GGK.................................................................................................................................................LNPVKYMF.Y..FV...L...-...---A....MF....SF....VL.T.V.ILWCQVIMACLY..PSA.......................................................tGKP..PI....NG.IS.V...AF..-..-.T..K.MR.EW..R.AFFP........E-FSLY....LL.I..YghQ...V.LC.SVVGMI....TLNAk..mKG................C.L.PVEPl.rKKSTHLN..AMLFHTAI......MLTTCC...A.IV....V--.L..SVE.TLPSYV......................................eGTEA.NTIFY....M.eKNY........A...KL....FK..TFYR...kAV...FQwIWFL.LSCLS---fiw................................................................................................................................................................................................................
G7P2J7_MACFA/4-466                   .............................................................................................................LLFAILYVVSYF.I......ITRY..KRK...S...GKDEqeded..........................................aivnrISLFLSTFTL..AVSAGAVL.LLPFSIIS..------...Neil...........................................................................................................................................................lsfPHNYYI.Q..WL....N...G.....S.L.IH.GL...WNLASLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................---.K....GIRA..R...I...LETL..V...M..L..LL..LA.LL..ILg......ivWVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRM.......................................F-T---...................--.---..-VMGQLLV-..--..---...--..KPT.I.L...EDLDE...QI...YIITL.E.EEA.L..Q.---...................................................................RRLN.vGM.LCAGNSeva....................................................................................................................................igrQV..PE.E..PA.G.QL---LLG.KWI..QEG---..--Gdm.................................taNLGLSSSVE.C.NI.............................................ME.LEQELENVKT.LKT...KLERRK..----....................................................................................................................---------.................................................................................................................................................--KASAWE.R..NL...V...Y...PAVM....VL....LL....IE.T.S.ISVLLVACNILC..LLV........................................................-DE..TA....MP.KG.T...RG..P..G.I..G.NA.SL..S.TFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.NFTP..kKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAIVTTLC...................................................................................................................................................................................................................
V4LCH4_EUTSA/104-579                 ............................................................................................................v-VCVIVFISSIY.L......LVNY..QHP...D...DANQa..................................................yFPKFVVVFGL..SIAMISIL.MLPADVAN..--RHAC...Rhsiyng.....................................................................................................................................................acnltlP-----.-..--....-...-.....-.-.MK.NL...WLAVYIVDAVLVF................FI..IP.FAM.F....F....Y........E........G.......D..Q...D....K.S.LG...................................................---.-....KRIK..S...A...LIWV..V...T..T..AV..VC.AL..VLg......ilYGVI.G.K.VD.FSVR......Hlssattsfptswqfsnnqpcign..............................................................tarqcsaytanaasektwtmrttFPEYVV..AL..ATIV.G.S.VLF....TIFGGVG.IACL.......................................PLGLITa.................fI-.---..-----RRPK..AV..ITR...SQ..YIK.E.A...TELGK...KA...RELKK.A.ADA.L..H.QEErsg.............................................................akgRKWR..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................--KNVKAVE.K.EL.............................................LQ.LEEDVNLLEE.MYP...QGEKA-..----....................................................................................................................---------.................................................................................................................................................---ETAWA.F..TV...L...G...YLAK....FI....LG....II.G.L.IVSVAWIAHIII..YLL........................................................VDP..PL....SP.FL.N...EV..F..I.K..L.DD.VW..G.LLGT........-AAFAF....FC.F..Y..L...L.LA.VIAGAM....MLGL...kLV................F.I.TIHPm.kWGATLMN..SFLFNVGL......ILLCS-...-.--....---.I..SVI.QFCATAfgy.................................yaqATAA.QEIFG....H.tLQS........L...RG....IK..YLYK...yNV...FQ.IGFV.VLAGL---tfl................................................................................................................................................................................................................
LMBD1_ASPFU/15-253                   ............................................................................................................i-VIFVLIVVASV.F......IHVY..QTP...R...DRSS....................................................FVTFICVFSI..AALLATVM.LLPVDVAL..VSSTI-...Ssalg........................................................................................................................................................qreewATQEEV.D..KI....T...Y.....S.L.-T.II...YYSLYFLDALLCF................VG..IP.FAY.FwheeY....D........E........V.......A..F...E....A.G.DQ...................................................TAC.K....RFWA..A...T...KYTL..T...F..I..AV..VI.AL..VL.........VGFF.A.-.PM.MESQ......Pghdlgywrg..........................................................................................ylienqgehAFTFLL..GF..VTII.G.S.CLY....AFYTPSG.LAML.......................................PALFLR...................KS.S--..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sfatqtlggstamelnfnrerqrqlegrc......................................................................................................................................................................................
X0K5R1_FUSOX/19-520                  ............................................................................................................i-ALVVISLVVLL.I......LRYY..LPL...R...TTPA....................................................FYLIPIFFAL..WLPTIVVI.LVPVDLAS..SAVTGD...-.................................................................................................................................................................-EESRG.I..WL....P...E.....R.V.IL.VS...WRISYWLTFALTW................FI..LP.ILA.E....Y....S........D........S.......G..Y...R....E.P.YD...................................................KFM.Y....SVRS..N...A...QFHA..I...V..L..GF..GF.VG..LI........yYVIS.S.G.FS.FKVD......V............................................................................................................IKGTIM..AL..AYCW.G.L.ILA....IYLMGHG.LVSI.......................................PRRFMR...................GA.SIS..GRLRRLQSK..AP..KVY...EE..MED.S.I...TKLED...IE...VQVAE.L.GRR.K..T.GSA...................................................................NTYR..DW.IEELQE..........................................................................................................................................MA..NL.P..ES.Q.PRGTRFGS.SSD..--NN--..--Iip................................hviTEKYLADLT.R.KY.............................................VR.ARHARSRYVN.AWS...DLVQEA..AETQ....................................................................................................................AILDSAASKkldfgevsph.............................................................................................................................atfwektailTPYTRYLY.Y..YQ...I...L...PYAQ....VL....LG....LS.L.A.AASACIVWSEVV..KFA........................................................-FP..KL....SI.IR.L...TV..V..H.H..W.VG.DK..P.EVGFa......gQAISSF....WI.C..Y..M...C.AA.ALISMT....EVKV....WR................G.R.ALVR...-RNTAHE..SAFWYAMQ......VAKLTI...P.IS....YNF.I..TFL.SSQVYN.......................................KTVF.YHFLG....Q.lIDF........T...P-....LG..RYFD....DL...FP.VVVL.FPVFATLF...................................................................................................................................................................................................................
L7IIM5_MAGOY/27-533                  ...........................................................................................................vs--LLVVSFLVLL.L......LRYY..LPL...R...TTPA....................................................YLLVPVFFAI..WLPACIVL.LVPIDLAS..SAATDD...Eas.............................................................................................................................................................rgI-----.-..WL....P...D.....R.L.LL.VS...WRITYWLTFVLTW................FI..LP.VLG.E....Y....S........D........A.......G..Y...R....E.P.KD...................................................RLI.Y....SLHQ..N...A...QYYA..I...V..L..GS..SL.VG..LV.........YVIW.S.-.YG.MKLD......A............................................................................................................LKSLVM..AL..AYFW.G.L.ALA....IYLMGHG.LVAI.......................................PRSLIR...................AL.SIS..GQLRRIHTR..AP..KIY...ER..MED.A.E...ADLAD...LE...AQVTE.L.AKR.A..KtGSA...................................................................RDFQ..DW.IEELVEl........................................................................................................................................aCL..PD.G..IP.G.QIASNRAS.L--..---SSR.aLPTv...................................iTAKYMADLT.R.QL.............................................VR.ARHARSRYVS.EWN...YLLQDA..RETQ....................................................................................................................IILDSAASKkldfgtatpg.............................................................................................................................agfwdritilTPHTRYIY.Y..YY...V...L...PYAK....AC....LG....GL.L.A.LASACIIWSEMI..KLA........................................................-FP..SL....SL.IR.L...SV..V..H.H..W.IT.DS..E.GKPVgqv.gfagQMAASF....WI.L..Y..M...M.AA.AFISIT....EVKV....WR................G.R.ALVR...-RNTAHE..SAFWYASQ......VARLSV...P.LS....YNF.V..TFM.SPEVYK.......................................RTVF.FKFLG....Q.lINL........T...P-....LG..SWFD....YL...FP.VLVL.IPVCATLF...................................................................................................................................................................................................................
F2TAA0_AJEDA/21-517                  ............................................................................................................i-ALLVISILVLL.L......LRHY..LPL...R...STPA....................................................FLSLPVFLAL..ALPASVVL.LVPIDLTS..STKGDE..pS.................................................................................................................................................................----SG.I..WL....P...P.....R.V.ML.VS...WRIAYWLTFVMTW................VI..LP.LLG.E....Y....V........D........S.......G..Y...R....T.P.KD...................................................RIL.Y....SLRS..N...G...RYQL..I...V..L..GS..GI.AG..LV.........YISI.Q.-.NG.FDFT......S............................................................................................................IKALVM..AL..AYFW.G.L.ALA....IYLMGHG.LVVI.......................................PRTLIR...................NA.NPG..NKLRRLQAR..AP..RIY...DR..LTD.S.M...ADLED...LE...FQVSQ.L.RKR.K..T.GVP...................................................................HDLQ..EW.IDELVDm........................................................................................................................................tSI..PE.S.rLR.A.SA------.-SA..NDSRLS..--Vps.................................iiTTRYLADIT.R.RL.............................................GR.ARHQNARFTN.AWE...RLVREA..ADTQ....................................................................................................................SIIDSSASKrlefslpsfr.............................................................................................................................sspnksvtymTPTVRYYI.H..VH...I...L...PAAR....LI....LA....GF.F.S.LASACVVWSEIV..KSF........................................................-AP..RV....SI.VT.L...SV..V..H.N..P.-T.KS..E.PIGFl......gQVASAA....WI.F..Y..M...C.SA.AFVGIT....DARV....WG................N.R.ALVP...-RNTYSE..SACWYAGQ......IAKLTV...P.LS....YNF.L..TFL.PQDIQK.......................................KTTF.YHFLG....R.lINL........T...P-....LG..KGFD....YA...FP.IFIL.IPVCATLF...................................................................................................................................................................................................................
I1P4G5_ORYGL/6-495                   ...................................................................................................lislpltlgm----------VT.V......TLRY..FAG...P...GVPR....................................................YVIATVGYAW..FCSLSFII.LVPADIWT..TLTGRE...K.................................................................................................................................................................------.-..--....-...-.....G.G.IG.FF...WSWSYWSTFILTW................AV..VP.TIQ.G....Y....E........D........A.......G..D...F....T.V.KE...................................................RLK.T....SIHM..N...L...LFYS..I...V..G..AI..GL.FG..LI.........LLLV.M.H.RA.WDGG......-............................................................................................................IVGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PRNIWK...................NA.DWT..HRQKVLSHR..VA..KMA...VK..LDN.A.H...QEYSN...AI...VVAQA.T.SNQ.M..S.KRD...................................................................L-LR..PY.MDIIDK..........................................................................................................................................ML..AQ.M..LR.E.DPSFKPSG.GRL..GENDMD..YDT.....................................DDKTMATLR.R.QL.............................................RR.AHEEYYRCKS.EYM...TYVMEA..LELE....................................................................................................................DTIKNYERRdangwkfvssf...........................................................................................................................resrpgtlgslLDTMEFIW.R..CV...L...R...KQLQ....KG....FA....IV.L.G.CMSAAILLAEAT..LLP........................................................SGV..DL....SL.FS.I...LV..K..S.-..-.-V.GK..Q.EVLV........QVAAFV....PL.M..Y..M...C.IC.TYYSLF....QIGM....LM................F.Y.SLTP...-RQTSSV..SLLMICSM......VARYAP...P.IS....YNF.L..NLI.RLGGDA.......................................KTTF.EKRMG....N.iDDA........V...PF....FG..RGFN....RI...YP.LFMV.VYTLL---vas................................................................................................................................................................................................................
F6W863_ORNAN/3-211                   ........................................................................................................dddat------------.-......----..---...-...-VNK....................................................IALGLCTFTL..AVALGAVL.LLPFSILS..------...Nevl...........................................................................................................................................................lslPRSYYV.Q..WL....N...A.....S.L.IH.GL...WNLVFLFSNLSLI................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVLG..R...V...YETV..V...M..L..VL..LT.LL..LVg......iiWVAS.A.M.VG.GTPA......Sresly..................................................................................................dlweyYLPYLY..SC..ISFM.G.G.LLL....LVCTPLG.LARMfsvtg.............................kllvkPRLL--...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------edleeqlhcstfeeaaltrrirnpasccp......................................................................................................................................................................................
W2VXI1_PHYPR/15-310                  ..................................................................................llyasvalvllllstglvlyaqpknga------------.-......----..---...-...---Ssslaafagtst..............................lsaapltvssrFVNIVCILAL..YVALLCLF.TAPVDVYL..------...-.................................................................................................................................................................-LENAL.P..HV....P...Sn...vR.A.LR.VM...YQVYFAALALYSF................VG..AP.LAF.N....Y....A........K........Q.......T..E...I....A.H.LTlkf............................................sardRLY.A....AIKR..T...S...CFLL..G...L..S..FL..LV.IL..MV.........VLLC.G.K.PA.S---......Sdidwlrpl...........................................................................................lkfssdletFLRLLV..GI..LALT.G.M.YLW....LFVCSRG.LASV.......................................PLVGLLmed.............hsiDE.NMT..TFEDLLQEN..AM..---...--..ETQ.A.T...KQTRE...TI...LQRYV.V.EQQ.M..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sgadqerlsqlktreklleerrevlkanlqrfa..................................................................................................................................................................................
LMBRL_MOUSE/28-269                   .............................................................................................................LLFATLYILCHI.F......LTRF..KKP...A...EFTTvdded..........................................atvnkIALELCTFTL..AVALGAVL.LLPFSIIS..------...Nevl...........................................................................................................................................................lslPRNYYI.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVLG..R...V...YETV..V...M..L..IL..LT.LL..VLg......mvWVAS.A.I.VD.NDKA......Sresly..................................................................................................dfweyYLPYLY..SC..ISFL.G.V.LLL....LVCTPLG.LARMfsvtgkllv....................kprlledleeQ-----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lncsafeeaaltrricnptscwlpldmel......................................................................................................................................................................................
A9T3A3_PHYPA/14-495                  ............................................................................................................v-VTLMVLAFNLY.L......LINY..QHP...D...DKNQa..................................................wFPKVVVIVGL..SVAELSIL.MLPADIAN..--RHAC...K.................................................................................................................................................................-HSVYT.D..AC....N...Y.....T.LpMR.EL...WYSVYIVDAVLVF................FV..VP.FSI.F....Y....Y........E........A.......D..Q...E....K.S.WL...................................................---.-....RRAC..S...A...ISWV..V...A..T..AI..IL.GI..LFg......vaFVLV.G.K.VD.FGVQ......Rlessaqayttdfslvtsmspclatn.........................................................qggtatrcsaeladpesattwtmrtsFPEYVI..AI..LTIV.G.S.ILF....SIFGGVG.IASL.......................................PLSLIF...................A-.---..---YVHRPK..TI..ITR...SQ..YIK.E.A...TELGN...RA...KQIKE.A.ALA.L..Q.REQ...................................................................RSGS..--.------..........................................................................................................................................--..--.-..--.-.--------.--K..SRK---..---.....................................WKTNVHKVQ.K.EL.............................................MY.LEEDERALEE.VYP...QGEKQA..----....................................................................................................................---------.................................................................................................................................................---DTSWA.L..TV...L...G...YLGG....LV....FG....II.G.L.LVSVVWVVHIII..YML........................................................ITP..PL....TP.FL.N...WI..F..I.R..L.DN.FW..G.LLGT........-VAFAF....FC.C..Y..L...L.IA.VISGQM....HLSL...nIL................F.V.AIHPm.kLNGTYMS..SFLFNVEL......VLICS-...-.--....---.I..SVI.QFCAKSfav.................................yaqATVV.QEIFG....H.tLES........L...RG....IK..YLFE...yNV...FQ.YAFLvCAGL----ata................................................................................................................................................................................................................
C1BPY3_9MAXI/9-279                   ...........................................................................................................dl---LLAFLLSGC.L......LYRY..GDW...F...RQRI....................................................IVTLAVFLAW..YFSFLIVF.IIPLDVSM..TKYRHCl.kEnnlplkdednaimgergng..........................................................................................................................tgyynvtlnsthndnnnssgVCYAPY.S..LL....P...S.....Y.V.LP.SL...WRIVYWTSQFLTW................IV..LP.LMR.S....F....T........Q........A.......G..E...F....G.F.WG...................................................KLR.S....SLWD..N...V...IYYT..S...Y..L..II..SA.II..FT.........YILL.Q.-.PG.LHLNl....eR............................................................................................................LKAIAS..SA..SNTW.G.L.FVL....VLMLGYG.LIEV.......................................PRSLWK...................AS.LRG..HSLNRAYFK..LA..KLM...SE..KAD.A.E...EELED...SL...ALVYA.L.HQR.I..Q.S--...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------msskel.............................................................................................................................................................................................................
I3JTS9_ORENI/17-303                  ..........................................................................................................fti-ILLVILVFCWI.Y......IRKF..QSR...R...ESEV....................................................ISTITAICAL..AIALITSA.LLPVDIFL..VSFMKY..pNgty..........................................................................................................................................................kewaANNETR.G..QI....E...D.....T.V.LY.GY...-YTLYSIILICVF................LW..IP.FVY.F....Y....Y........E........E.......R..D...D....N.N.VN...................................................--K.C....SQVK..N...A...LKYT..I...G..F..VI..VC.VA..LLli.....gaFVPL.A.A.PP.GQNS......Tqwekvqylf.........................................................................................eelgsshglpALSFSI..SS..LTLI.G.M.LAV....IIYTAYG.MSVM.......................................PLNLIKgtrs...........vkyeRL.ENT..EDIDDVEHQ..IE..KLK...SK..CQD.G.R...PLSSR...DR...NNLQE.L.EGK.L..Q.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------vlrrrgrhleiaerncctkvgsalrp.........................................................................................................................................................................................
A0A024V9E3_PLAFA/5-545               ....................................................................................................illiffiay------LFISGI.Igt..rlIIIY..SHK...E...ENNRlv................................................yiIIKCFIIIGY..ILSWTIIL.LVPIDVYY..NTYKDI...Ek..............................................................................................................................................................yiD-----.-..--....-...-.....-.-.IF.KL...FRICYWFSILYIF................ML..TP.VMFiI....Y....S........E........S.......D..R...K....I.Y.-TlnkhhtkikkqnkgknnnpqnngniindgniinhdnitnddnitnnyyyynKMT.Y....KIIY..K...K...IIPI..T...L..F..FLlsSI.CF..LYf.......tFLYL.K.K.LN.LNLN......Aqecalwynyikdiykknfliyn................................................................irkiehcenikntnikiiinleFNDYII..II..ISFI.G.F.LFF....IFYGGIG.LISL.......................................PFNLIN...................S-.---..----YIYRK..KK..IKK...DD..LKK.Q.L...DIINR...KS...KMLLN.I.TEA.L..Q.KEK...................................................................NQLL..--.------..........................................................................................................................................--..--.-..--.-.--KMNYFR.---..------..---.....................................SFFKYMKYN.R.EK.............................................NF.LNYTVHNLEK.EYD...ILLENF..----....................................................................................................................---------.................................................................................................................................................-----TKN.S..SI...L...F...PYIS....LF....LG....II.F.L.IISTVIIIHLFV..NLIidvl...............................................kynddIIN..SL....TF.LD.S...LL..V..Y.L..V.QI.KL..S.VLST........-IIYTF....IM.S..Y..L...L.VC.SLSGFI....QFCSk.lsLG................F.I.FVLE...KRSTYLN..SLLLNICL......FFFIS-...-.--....---.L..GIS.LFSTKIfyt.................................yssFTYA.TFLFD....L.tLKK........M...RF....VG..PLYS...nNT...FL.YILL.LINFITL-v..................................................................................................................................................................................................................
W2RKV9_9EURO/38-312                  ............................................................................................................i-AVVLLLAIASL.F......VYLY..QTH...R...DRSA....................................................YVTTVCIFTI..TCLLATVL.LLPVDVAL..VSSTTS...Skhgirkd...................................................................................................................................................watqdkvD-----.-..QI....T...-.....Y.T.LR.IV...YYLLYSLDALLCL................LV..IP.FTY.F....W....Y........Eey....deV.......A..E...E....E.G.SQ...................................................TFA.T....RFWA..A...F...KYTI..V...F..V..FL..CV.AL..FLvg....ffiPVAK.H.R.--.----......Egahfdldffk........................................................................................nllaenhgerALTFAL..GL..LITI.G.I.IIY....CFYTAAG.LALL.......................................PLTLIKsap............gvsaP-.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------amgestatqlesnlerqrqlegraqgnsnglsskdqreldalvreertlrrhqriaee.........................................................................................................................................................
M7B2F5_CHEMY/384-446                 ..........................................................................................................aal------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..QIIGNCVS......LLVLSSa.lP.VF....SRT.L..GLT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FF.YNML.FAALTTLC...................................................................................................................................................................................................................
G3RWF7_GORGO/28-268                  .............................................................................................................LLFATLYILCHI.F......LTRF..KKP...A...EFTTvdded..........................................atvnkIALELCTFTL..AIALGAVL.LLPFSIIS..------...Nevl...........................................................................................................................................................lslPRNYYI.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLI................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVLG..R...V...YETV..V...M..L..ML..LT.LL..VLg......mvWVAS.A.I.VD.KNKA......Nresly..................................................................................................dfweyYLPYLY..SC..ISFL.G.V.LLL....LVCTPLG.LARMfsvtgkllv.....................kprlledleE-----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------qlycsafeeaaltrricnptscwlpldme......................................................................................................................................................................................
D2VJK4_NAEGR/223-466                 .................................................................................................kpkrikssefie------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................AKARLMKQS.R.RL.............................................ID.IGTKLQEAQD.EGK...ITLKDR..RVLN....................................................................................................................D----FKIAayrle......................................................................................................................................eewkviHTSFFHAG.G..SV...I...L...PIIY....LI....LG....II.C.C.LVSLTWIIHLIV..YWA........................................................IIY..PP....NG.ML.N...VV..F..N.W..L.DD.LT..I.GFPIl......gGLSFWF....FT.V..Y..L...I.FT.VLAGNA....AITS...rIP................L.F.AIHPm.kKGDTMMN..SLMFNTGL......ILLSS-...-.VV....VNQ.F..SQR.AFNSYS......................................rSTAM.DIIFS....G.aITN........L...RY....IQ.yFFFY....LI...YA.YLGC.CV------igfflal............................................................................................................................................................................................................
H0EGU3_GLAL7/8-164                   ............................................................................................................l------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------DAVLCL................LV..VP.FTY.F....F....Y........E........E.......L..D...D....E.E.AD...................................................NDR.Q....SFGS..K...A...LGAL..K...Y..T..LI..FV.VL..VL.........ILFL.V.G.FF.VPVA......Rnregkhmdldy.....................................................................................fkkllqedhgtrALTFSL..GF..LICI.G.T.LLY....VLYTAAG.LALL.......................................PISFIKs.................aPS.ISA..PQLSETTAS..AL..---...EQ..NRE.R.Q...HQLE-...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------arntgrd............................................................................................................................................................................................................
L7I0J7_MAGOY/16-271                  .........................................................................................................vavg----LALFAAIV.T......TFTW..QKP...R...ERSA....................................................VVNTVAVVSL..TSLLATVL.LLPVDIAL..VSSTGS...Vhlgvnkew................................................................................................................................................atpehvagmL-----.-..--....-...-.....R.T.LQ.IV...YYSLYSLDALLCL................IV..IP.FAY.F....W....Y........Eey....deV.......E..E...E....E.G.TR...................................................STG.A....KLWG..A...F...KYTS..G...F..I..IL..VL.IL..FF.........VGFF.V.-.PA.AGNQ......Kgghldldyfk........................................................................................rllaankgekALTFAV..GL..LVCL.G.T.LLY....VLYTSSG.LALL.......................................PISFIKs.................aPS.ISA..PQLSETTAS..AL..E--...-R..NRE.R.Q...R----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------qlelrnggnhdempskdrrel..............................................................................................................................................................................................
C0NU62_AJECG/1-351                   .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................-----M..AL..AYFW.G.L.ALA....IYLMGHG.LVVI.......................................PRTLIR...................NA.NPG..NNLRRIQAR..AP..RIH...DR..LTD.S.M...ADLED...LE...FQVSQ.L.RKN.K..T.GAP...................................................................YDLQ..EW.IDELVDm........................................................................................................................................tSI..PEsR..LR.A.SAGANES-.---..---RSS.vPPT....................................iTARYLADIT.R.RL.............................................AR.ARHQNARFAN.AWE...KLVREA..ADTQ....................................................................................................................AIIDSSASKrlefshpsfq.............................................................................................................................pssnrsipyiTPTLRYYI.Y..VH...I...L...PAAR....LI....LA....GF.F.S.LASACVVWSEII..KSF........................................................-AP..RA....SI.VT.L...SV..-..V.H..N.PT.QS..E.PIGFl......gQVASAA....WI.F..Y..M...C.SA.AFVGVT....DVKV....WG................N.R.ALVP...-RNTYSE..SACWYAGQ......IAKLTV...P.LS....YNF.L..TFL.PQDVQK.......................................KTTF.YNFLG....R.lINL........T...P-....LG..KGFD....YI...FP.IFIL.IPVCATLF...................................................................................................................................................................................................................
W5J515_ANODA/1-281                   ......................................macygyiaifvctpmgfvrlfgvvgqvlvkpnllrdvneefhafnieeatvkrklanvnlnielrnvttid------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................LT..PA.K..LC.S.GLDDLYQI.K--..------..---.....................................--NTAEGTA.S.ES.............................................AK.LFARLRELES.ERK...VLEKQR..----....................................................................................................................---------.................................................................................................................................................--SSSALQ.R..NL...V...Y...PIAM....LL....LL....IL.T.G.ITVLLVVQNTLE..LLI........................................................-GI..KA....VP.LS.T...RQ..F..T.L..G.IT.SL..S.KLGPl......gATLEVC....II.T..Y..L...G.VT.SAVGLY....TMPF....--................M.R.NVRP..rRRKTSLT..QLIFNCGL......VLILSSa.lP.LL....ARI.L..GIT.NF----.......................................----.-DLLG....D..FGE........I...EW....LG..-NFM....IV...LL.YNVV.FGTAATLC...................................................................................................................................................................................................................
Q4RGQ6_TETNG/345-496                 ............................................................................................................q------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.-VSVAVVWSECT..FFS........................................................TRP..VL....SL.FA.V...FI..-..Q.L..A.EK.DY..N.YLYI........EMACFI....TI.F..F..L...C.TC.VYSTVF....RIRV....FN................Y.Y.YFAS...HHQTDAY..SLQFSGML......FCRLTP...P.LC....LNF.L..GLI.HMDSAIshq.................................qkeQTAY.TSIMG....S..MRV........L...SF....IA..NGFY....IY...YP.MLIV.ILCIATYF...................................................................................................................................................................................................................
G1MYC8_MELGA/8-540                   ............................................................................................................l-EIVFVFFLALF.L......LHRY..GDF...K...KQHR....................................................LVIIATLLAW..YLCFLIVF.ILPLDVST..TIYNRC...Klavnsspaetn...........................................................................................................................................gsfvtlapnkqKCFKPW.S..YI....P...N.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YIAV.N.-.PK.FNLQw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSHWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...VM...EEVRK.V.SES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.E..YQ.E.RMGRNMDD.YED..FDERQN..SYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHHRTQV.QWQ...ILLEQA..FYLE....................................................................................................................DVAKNETSAtrqfvhtfqsq...........................................................................................................................epenkivqyfyTPTIEWYW.E..CL...L...R...PWFY....RA....LA....VV.L.A.MFSVIVVWSECT..FFS........................................................TRP..VL....SL.FA.V...FI..-..Q.L..A.EK.TY..N.YIYI........EMACFL....TI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDATIshn.................................daqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
H6C332_EXODN/13-511                  .............................................................................................................LAFCTISVAVLF.L......LRHY..LPL...R...TTPA....................................................FLLVPIFLSL..VLPASAIL.LVPIDLAS..SAREND...Hgg.............................................................................................................................................................kgI-----.-..WL....P...E.....R.A.VL.VS...WRIVYWLTFVLTW................VV..LP.LLG.E....Y....M........D........A.......G..Y...R....D.P.KA...................................................RMI.Y....SLRS..N...A...RYQM..I...V..L..GC..AM.VG..LI.........YMIL.S.-.HG.FDFT......A............................................................................................................IRALVM..AL..AYVW.G.L.ILA....IYLMGHG.LVAL.......................................PRKMFR...................KA.DIA..GSLRRVQAQ..AP..KVH...EN..LED.A.I...LALEE...LE...AQVMQ.L.KQR.K..T.GTA...................................................................RDFR..EW.IDELVD..........................................................................................................................................MT..GQ.P..EN.R.VFA-NPT-.--T..VDASAK.vPAV....................................iTERYLADLT.R.RL.............................................VR.ARHRRARYTR.EWD...NIVQTA..SDLQ....................................................................................................................AILDSKASKkldfgrpsss.............................................................................................................................aslfgrisfiTPFMRYHL.Y..VH...V...I...PALR....IA....VG....GI.L.S.LASVAIIWSEMI..KFP........................................................-AP..QL....SA.VS.L...TV..I..H.H..P.SD.KN..Y.QIGLg......gQLLASM....WI.T..Y..M...C.VC.AISSVS....DVPT....WN................Q.R.ALVK...-RNTYPE..SACWYSGQ......IAKLTV...P.LA....YNF.L..TFL.PRDIHQ.......................................TSTF.YNFLG....R.lINL........T...P-....LG..TWFD....YL...FP.MFIL.VPVCAALF...................................................................................................................................................................................................................
W5DPE6_WHEAT/2-290                   ..........................................................................................................rat------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................FPEYVV..AL..ATIV.G.S.VLF....TIFGGVG.IACL.......................................PLSLIF...................S-.---..---FVRRPK..AV..ITR...SQ..YIK.E.A...TELGK...KA...KELKK.A.AEA.L..H.QEE...................................................................RSGN..--.------..........................................................................................................................................--..--.-..--.-.-----KGR.KWR..------..---.....................................--KNVKAVE.K.EL.............................................LL.LENDMNALEE.MYP...QGEKAE..----....................................................................................................................---------.................................................................................................................................................----ATWA.F..TV...L...A...YIGK....LI....FG....IV.G.L.IVSIAWVAHIII..YLL........................................................VDP..PL....SS.FL.N...EI..F..I.K..L.DS.VW..G.LLGT........-AAFAF....FC.F..Y..L...L.IA.VIAGEM....MLGL...kLV................F.I.TIHPm.kWGGTLMN..SFLFNVGL......ILLCS-...-.--....---.I..SVI.QFCATAfay.................................yaqATAA.QEIFG....H.tLQS........L...RG....IK..YLYK...yNV...FQ.YGFV.ALAILTLF...................................................................................................................................................................................................................
W5L0L9_ASTMX/25-243                  ............................................................................................................q-LFICLYILSYL.I......LTHF..RKN...A...EFVTddied..........................................atvnkIVLWLCTFTL..SVAVCAVL.LLPISILS..------...Nevl...........................................................................................................................................................ltfPQSYYM.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........A.......E..G...F....T.G.SK...................................................---.R....GVMS..R...V...YETA..V...M..L..LL..LS.LL..VLg......ivWVAS.A.L.LH.DNTA......Resly...................................................................................................dlweyYLPYLY..SC..ISLF.G.V.LLL....LLCTPFG.MSRMfsvtg.............................sllvkPRLLEN...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------veetmncavfe........................................................................................................................................................................................................
W5G7F4_WHEAT/1-388                   ............................................................................................................m------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..N...L...LFYS..I...V..G..AI..GL.FG..LI.........LLLV.M.H.RA.WDGG......-............................................................................................................LVGFLM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PRNIWK...................NA.DWT..HRQKVLSHR..VA..KMA...VK..LDN.A.H...QEYSN...SI...VVAQA.T.SNQ.M..S.KRD...................................................................L-LR..PY.MDIIDR..........................................................................................................................................MV..AQ.M..LR.D.DPSFKPSG.GRL..GENDMD..YDT.....................................DDKTMATLR.R.QL.............................................RM.AHEEYYRCKS.EYM...TYVMEA..LDLE....................................................................................................................DTIKNYEHRdangwkyvssf...........................................................................................................................resrsgtlgslLDTMEFIW.R..CI...L...R...KQLQ....KA....LA....VI.L.G.CMSAAILLAEAT..LLP........................................................GGV..DL....SL.FS.I...LV..K..S.-..-.-V.GK..Q.EVLV........QVAAFV....PL.M..Y..M...C.IC.TYYSLF....QIGM....LM................F.Y.SLTP...-RQTSSV..SLLMICSM......VARYAP...P.IS....YNF.L..NLI.RLGGNV.......................................KTTF.EKRMG....N.iDDA........V...PF....FG..RRFN....RI...YP.LIMV.VYTLL---vasn...............................................................................................................................................................................................................
Q16UA7_AEDAE/27-482                  .............................................................................................................LLFLLLYLGSFA.L......IGRF..RRR...D...REDLfstddd........................................eitvyrISLWLCTFSL..AVAVGAAL.LLPISIAS..------...Nevl...........................................................................................................................................................ilyPNSYYV.K..WL....N...S.....S.L.IQ.GL...WNHVFLFSNLALF................VL..LP.FSY.L....F....T........E........S.......S..G...F....S.G.HK...................................................---.K....GLMA..R...V...YETF..T...V..F..SL..LA.FI..VFg......mtYVIS.A.L.RD.PERN......Tfqalf..................................................................................................nlgkyHLPFLY..SC..VSFL.G.V.LLL....LVCTPMG.FVRL.......................................F-----...................--.---..--------G..VV..GQV...LV..KPN.L.L...RDVNE...EF...NAFNL.E.EAT.V..R.---...................................................................RKLA..-N.ANINIElksv..................................................................................................................................ttvdSA..PS.K..LC.A.DLEDLYQI.---..------..---.....................................RPTNGGAVN.E.S-.............................................TK.LFERLRELEA.ERK...LLDKQR..----....................................................................................................................---------.................................................................................................................................................--SSSALQ.R..NL...V...Y...PVAM....LL....LL....LL.T.G.ITVLLVVQNTLE..LLI........................................................-GI..KA....VP.LS.T...RQ..F..T.L..G.IT.SL..S.KLGPl......gAALEVC....II.M..Y..L...G.VT.SAVGLY....TMPF....--................M.R.NVRP..qRRKTSLC..QLIANCAL......VLILSSa.lP.LL....SRI.L..GIT.NF----.......................................----.-DLLG....D..FGQ........I...EW....LG..-NFM....IV...LL.YNVI.FGTAATLC...................................................................................................................................................................................................................
Q7QC62_ANOGA/6-530                   ..........................................................................................................vfs--ICLALLLASI.S......LYRY..GCI...Q...RQHP....................................................IVTFSVLTAW..SFSFLIVF.TIPLDVTS..TVYRQC..lQehnitgsng...............................................................................................................................................snnndapdaICQRPW.G..MV....E...E.....E.V.FP.NL...WRIIYWSSQFLTW................LI..MP.LMQ.S....Y....L........K........A.......G..D...F....T.I.KG...................................................KLR.S....ALVD..N...A...IYYG..T...Y..L..FI..CG.IL..LI.........YLAL.Q.-.PG.ISLDw....qK............................................................................................................LKAIAS..SA..SNTW.G.L.FLL....VLLLGYA.LVEV.......................................PRSLWN...................NS.KPG..FTLQYAYFK..LS..KLS...SE..KAE.A.E...ENVDD...VL...ESLQS.A.SRA.I..P.PRH...................................................................-ELR..PA.LETIIR..........................................................................................................................................KV..PT.E..LM.E.RA------.-SR..ISREDG..SPMa..................................ipSEKALVRLH.R.QV.............................................IK.SLQTLQRTEA.LWS...VQVNKV..LHLE....................................................................................................................DVAKNAVSLdhrfksefpk.............................................................................................................................hrvgmaralySPTVDWYW.E..CV...V...K...APFL....KA....LA....II.T.A.FLSFTVVWSELT..FFN........................................................RQP..VL....SI.FA.N...VL..-..N.V..A.KG.SY..D.FVTI........EIFSML....TL.C..Y..L...C.YC.AYSTVF....RIKF....LN................L.Y.YLAA...HHQTNEY..SLIFSGML......LCRLTP...P.MC....LNF.L..GMI.HMDSHIike.................................rvlETHY.TQIMG....H..MDV........L...GI....IA..DGFN....IY...FP.MVML.AFCLATWF...................................................................................................................................................................................................................
G9K8C0_MUSPF/1-99                    ............................................................................................................l-EIVFVFFLALF.L......LHRY..GDF...K...KQHR....................................................LVIVGTLLAW..YLCFLIVF.ILPLDVST..TIYNRC..kHaaanssppensni......................................................................................................................................tglyatatpgpsqhPCFKPW.S..YI....P...D.....G.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------i..................................................................................................................................................................................................................
Q57XX2_TRYB2/11-245                  ..........................................................................................................vvc--SLLCLAIAIY.V......LYYF..SSE...D...DHEGs..................................................yLTKVIIVFGI..LLAIGVVL.LLPFDASN..------...Ard.............................................................................................................................................................ptVGSKYV.N..TL....N...T.....D.L.--.-M...WEIVLWSLAVMAL................VV..VP.FTV.F....F....Y........E........A.......Y..D...P....D.D.ES...................................................-FS.K....QCGQ..A...I...TLTL..I...V..S..FV..FI.VI..TAv.......cFLSF.G.T.AL.VPVE......Lyealpqivddidrvs..............................................................................ynttsdkdkfevhvsIFTYVV..GE..LCLV.G.W.IAF....FFYAGVG.LVSV.......................................PVDLIRg.................fI-.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------nrpkpisgstfaqemaviaakgdt...........................................................................................................................................................................................
S7ZGH5_PENO1/19-516                  ............................................................................................................l-ALCAISALVLL.L......LRRF..LTI...R...ATPA....................................................YLLVPIFLAL..ALPASVVL.LVPIDLAS..STRNGT...G.................................................................................................................................................................P---KA.I..WL....P...E.....R.M.VL.VC...WRIAYWLIFMLTW................AI..LP.LLG.D....Y....V........D........S.......G..Y...R....E.P.KA...................................................RIL.Y....SLRS..N...A...RYQL..I...V..L..SC..AV.VG..LI.........YISI.S.-.IG.FDPT......S............................................................................................................IKGTIM..AL..AYVW.G.L.VLA....IYLMGHG.LVSI.......................................PRNLFR...................NA.SVS..GRLKRIQAQ..AP..RVH...DR..LMD.A.V...NELES...LN...SQVAQ.L.QQR.K..T.GTA...................................................................RDFQ..EW.IEDLSE..........................................................................................................................................SP..GS.G..S-.D.DVRVPILE.TPE..TSGS--..--Vps.................................viTERYLADLT.R.RL.............................................QR.ARHMKARFVD.EWD...RVVTLA..ADLQ....................................................................................................................AIMNSAASQklefgstrrr.............................................................................................................................tscvpkvkllSPYLRYQL.Y..SN...I...I...PALR....LV....FG....MI.F.A.VASVCIVWSELI..KSL........................................................-AP..QL....SA.IT.L...TV..V..P.H..W.-K.NE..Q.PLGFg......sQVIASL....WL.L..Y..M...C.SA.ALVGIS....EVKV....WG................N.R.ALVR...-RNTYGE..SACWYASL......VARLTV...P.IA....YNF.L..TFL.PRDFRR.......................................STTF.YEFLG....R.lINL........T...H-....LG..KGFD....FI...FP.MFIL.LPVCATLF...................................................................................................................................................................................................................
F6TEM6_XENTR/196-420                 ..............................................................tvmgqllvkptiledideqmyiislqeealqrklnggnytadysrkk------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.IEHDLLNARS.M--...------..----....................................................................................................................--------Ksk............................................................................................................................................lerRKNASAWQ.R..NL...V...Y...PAVM....IL....LL....IA.T.F.SSVILVSLNILR..LLV........................................................-DE..TA....MP.KG.S...KG..S..G.F..G.DA.SL..F.TFGFa......gATLEII....LI.-..F..G...T.IG.PIVHFV....SICS....--................-.-.SLIP..fSLYSTFL..QVIGNCLS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...VA.YNLM.FAVMTTLC...................................................................................................................................................................................................................
V6TPQ5_GIAIN/12-681                  ...............................................................................................flftgialtytgiv------------.-......FKWF..PNS...A...TINL....................................................LDYIIVGTAL..VFGMTAFL.GFPPDIAE..SSSAS-...-.................................................................................................................................................................------.S..DF....S...T.....G.P.MV.GL...WKFLYFGWLVFNW................AI..IF.LYK.Q....L....L........K........S.......G..H...W....N.F.WG...................................................RLG.H....GMLR..T...L...TIYL..L...I..G..VP..AV.IV..VI.........VLLV.T.-.KK.FTMD......V............................................................................................................LYTVLI..SL..INTF.G.T.FQI....VLLLAYG.IVDV.......................................PRRLVI...................AA.FPS..LRLYQIYYD..AF..KTT...RT..IRKiY.K...DILFQ...RS...KQNIG.L.SII.P..R.TNH...................................................................--MY..VY.SQRLIKmqmvpneqldaltdttggckgrt............................................................................................kalssakalssdqgpnkayqsvpVL..PD.Q..IH.S.SAQSSVYS.TKG..SKQQGA..KNAplpprs.........................hysnlqSSSTCNLFH.E.AEpknideckvssylshssrasaltedsiemsssklpggqanienssS-.----------.---...------..----....................................................................................................................--------Taeaekvtekpisyyapevrlagrlvkfpsgpttadmpfcscdchggprrtitssvkqglklve..................ksnfklkflywnamrehgamehlvvqrnyyemlvncrkkgctlqdlraqpnlnpywakmlsrarLGQMSFVY.I..KY...F...R...SFLL....ML....VA....MI.F.I.FFSVVLVLSELM..SPIas...................................................lslY--..--....SP.LL.V...LY..E..Y.V..V.DT.SS..D.STRLv.....lvYAIFGL....LV.A..Y..L...Q.C-.---ALL....NLRF....FN................I.Y.RLVK...-HSTDIM..SLLFIIAR......VPTYIF...P.LG....WNL.M..LLL.NI--QF.......................................TTAY.GTVMA....Q..MSA........I...PI....MG..MDFS....NY...FP.IVII.ALTI----ffas...............................................................................................................................................................................................................
Q7LDY5_HUMAN/1-50                    .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...M.VS.SVVGFY....SLRF....--................F.G.NFTP..kKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------...................................................................................................................................................................................................................
M2S4K6_ENTHI/285-454                 .......................................................................................................nlkgfl------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...W...GYVA....II....LG....II.A.T.LLTLLWMVQLVL..WTI........................................................--L..KI....FP.FV.D...WI..M..Q.W..M.TG.PI..A.FFGA........-IIYGI....FA.G..Y..L...L.LC.SFKAVV....YVGFr..fAL................G.F.VFYPf.eVSNTYMN..AFCFNGIL......LVLIA-...-.--....---.F..GVN.QFSSETfsn.................................fltGSSF.HSFMG....E.aITQ........L...RY....VK..YIYKy.apFV...MP.ILCV.LM------lvfmll.............................................................................................................................................................................................................
Q0CTG4_ASPTN/17-512                  ............................................................................................................f-TLLLISIVVLL.L......LRRF..LTL...R...ATPA....................................................YLIIPIFLAL..ALPASVVL.LVPIDLAS..SSRDGS...G.................................................................................................................................................................P---KA.I..WL....P...D.....R.L.LL.VT...WRIAYWLIFVLTW................AI..LP.LLG.E....Y....V........D........S.......G..Y...R....D.P.KG...................................................RLQ.Y....SIRS..N...A...RYQL..I...V..L..GC..AF.VG..LI.........YISI.Q.-.NG.FKFG......S............................................................................................................IKGLVM..AL..AYVW.G.L.VLA....IYLMGHG.LVSI.......................................PRALFR...................NA.NVS..GRLRRVQAH..AP..RLH...DR..LMD.A.I...NDLES...LE...SQVSQ.L.QRR.K..T.GSA...................................................................REFQ..DW.IEELAE..........................................................................................................................................PS..GT.P..E-.-.ARTPLLAP.SEE..---SST..VPNv...................................iTERYLADLT.R.RL.............................................QR.ARHQKARFID.EWD...RLVLLA..ADLQ....................................................................................................................AIINSSASKklefnhsphr.............................................................................................................................stfwprvkilTPYMRYHV.Y..VH...L...V...PKIR....LL....LG....AV.F.T.VASVCVVWSELI..KSL........................................................-AP..RL....SV.VT.L...SI..V..S.Y..H.-K.DP..A.PVNFg......rQVTASA....WL.L..Y..M...C.WA.ALVGVN....DAKV....WG................N.R.ALVR...-RNTYGE..SACWYASL......VARLTV...P.IA....YNF.L..TFL.PTTFRQ.......................................STTF.YHLLG....R.fIDL........T...P-....LG..KGFD....YF...FP.VFIL.LPVCATLF...................................................................................................................................................................................................................
A7RHN0_NEMVE/281-410                 .................................................................................................rnciypisllil------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.LL.L...TV..L..V.L..G.KV.SS..S.MMGTf......gALLEIV....LI.F..Y..L...M.LA.SLVGLY....SVPW....--................F.V.RLRP..vPKDTPMT..KVIANCIV......LLILSSa.lP.VL....SRT.L..GIT.NF----.......................................----.-DLMG....E..FGR........L...DW....LG..-NIR....VI...II.YNVW.FEVATAFC...................................................................................................................................................................................................................
K7VBQ0_MAIZE/2-290                   ..........................................................................................................rat------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................FPEYVV..AL..TTIV.G.S.VLF....TIFGGVG.IACL.......................................PLGLIF...................S-.---..---FVRRPK..AV..ITR...SQ..YIK.E.A...TELGK...KA...RELKK.A.AEA.L..H.QEE...................................................................RSGN..--.------..........................................................................................................................................--..--.-..--.-.-----KGR.KWR..------..---.....................................--KNVKALE.K.EL.............................................LL.LEDDMKALEE.MYP...QGEQAE..----....................................................................................................................---------.................................................................................................................................................----ATWA.F..TV...L...G...YIGK....LL....FG....VV.G.L.IVSIAWVAHIVI..YLL........................................................IDP..PL....SS.FL.N...EV..F..I.K..L.DG.VW..G.LLGT........-AAFAF....FC.F..Y..L...L.IA.VIAGEM....MLGL...kLV................F.I.TIHPm.kWGGTLMN..SFLFNVGL......ILLCS-...-.--....---.I..SVI.QFCATAfay.................................yaqATAA.QEIFG....H.tLQS........L...RG....IK..YLYK...yNV...FQ.YGFV.ALAILTLF...................................................................................................................................................................................................................
W4ZK09_STRPU/8-277                   ...........................................................................................................te--ILCVFVLAAY.L......LHKY..GDW...R...KQHP....................................................AVTLATFISW..YFSLIIVF.MLPLDVTT..TFYLQC..mKaaesptvpdvtpaspplqqipttdlhakltqvght...........................................................................................dsalgttnlmlnaslmnltgggegslrdrrslaeeQCKKPW.S..YV....P...E.....D.I.LP.II...WKIVYWTTFVLTW................LI..MP.FMK.S....Y....T........Q........A.......G..D...F....T.V.AG...................................................KLK.T....ILVQ..N...A...IWYG..S...Y..L..LI..FG.VL..LI.........CVAA.K.-.PE.LQLS......G............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------hqdhyhkeesrgmttlvyqkvvnmkakdptadldlmwktsvmftsprpawsglmq............................................................................................................................................................
J9BKW3_WUCBA/26-259                  .............................................................................................................LLFICLYLISYS.I......IRLL..KER...S...DNDElysgge........................................dffvfrVSLWMCTWSL..AVSMGAAT.LLPFSVIG..SEII--...Qa...............................................................................................................................................................yPDSYYF.Q..WL....N...W.....P.L.IH.SL...WNYIFALSNLSLF................IL..LP.FAY.F....L....L........N........L.......K..D...S....-.-.--...................................................---.K....GIMT..R...V...YETV..A...V..C..IL..LI.VV..LIcla...dvvY---.-.-.-S.LFLA......Esdsisls..............................................................................................ilnftsvNLPFLY..SC..VSLL.G.V.MTL....LITTPIGrLA--.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------rmfsvvsnhllatehqkiidpleeaifrleyqtlkrrlqrnnl........................................................................................................................................................................
W4YYE7_STRPU/11-265                  ............................................................................................................t------------.V......ICRY..KRR...T...DREDlysada.......................................edamvysIALWLCTFTM..AVSVGTVL.LLPLSIIS..------...Nevl...........................................................................................................................................................lwnPKSFYI.Q..WL....N...G.....S.L.IH.GL...WNLIFLFSNLCLF................VL..LP.FAY.F....F....T........E........S.......E..G...F....P.G.SK...................................................---.K....GIRG..R...V...YETF..M...V..L..LM..LS.IL..VFg......lvWVFS.A.L.LD.DTDS......Sretlq..................................................................................................rvstsYIPYLY..SC..MALL.G.V.LML....LISTPLG.FARLfsvig.............................klvvkPQFMENidee...........fhtaKF.EEE..DILRKIQVD..QE..LAN...GH..LSQ.L.R...ERLSD...VT...RERKI.L.ERR.R..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------ras................................................................................................................................................................................................................
M7Z4C2_TRIUA/6-496                   ....................................................................................................lislpltlg---------MVV.V......TLRY..FAG...P...GVPR....................................................YVQATVGYAW..FCSLSVII.LVPADIWT..T-----...-.................................................................................................................................................................-----L.T..GF....D...K.....G.G.IG.FF...WGWSYWSTFILTW................AV..VP.TIQ.G....Y....E........D........A.......G..D...F....T.V.RE...................................................RLK.T....SIHM..N...L...LFYS..I...V..G..AI..GL.FG..LI.........LLLV.M.H.RA.WDGG......-............................................................................................................LVGFLM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PRNIWK...................NA.DWT..HRQKVLSHR..VA..KMA...VK..LDN.A.H...QEYSN...SI...VVAQA.T.SNQ.M..S.KRD...................................................................L-LR..PY.MDIIDR..........................................................................................................................................MV..AQ.M..LR.D.DPSFKPSG.GRL..GENDMD..YDT.....................................DDKTMATLR.R.QL.............................................RM.AHEEYYRCKS.EYM...TYVMEA..LDLE....................................................................................................................DTIKNYEHRdangwkyvssf...........................................................................................................................resrsgtlgslLDTMEFIW.R..CI...L...R...KQLQ....KA....LA....VI.L.G.CMSAAILLAEAT..LLP........................................................GGV..DL....SL.FS.I...LV..K..S.-..-.-V.GK..Q.EVLV........QVAAFV....PL.M..Y..M...C.IC.TYYSLF....QIGM....LM................F.Y.SLTP...-RQTSSV..SLLMICSM......VARYAP...P.IS....YNF.L..NLI.RLGGNV.......................................KTTF.EKRMG....N.iDDA........V...PF....FG..RRFN....RI...YP.LIMV.VYTLL---vasn...............................................................................................................................................................................................................
A0A034VPN9_BACDO/10-297              ...............................................................................ffisivctplgfvrlfgvvgqvlvkphllr------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-DVNE...EY...QVFYM.E.IAS.L..K.RKI...................................................................ANIE..-L.LNISINs........................................................................................................................................nGG..AG.S..LH.N.DYSSGYTN.VDG..YYPHTS.lG-Hl...................................yQRKPLENHQ.T.EQ.............................................QK.LKQRLRELES.ESR...ELEKLR..----....................................................................................................................---------.................................................................................................................................................--KSSAFQ.R..NF...V...Y...PLAM....LL....LL....FF.T.G.ITVLLVVQNTLE..LLI........................................................-GI..KA....LP.LS.T...RQ..F..T.L..G.IT.SL..S.KMGPf......gAGLEVC....LI.F..Y..L...G.AT.SVVGFY....TMPF....--................M.R.NVCP..qKRKTSLA..QLILNCAL......VLILSSa.lP.LL....SRI.I..GIT.NF----.......................................----.-DLLG....D..FGA........I...EW....LG..-NFQ....IV...LL.YNLV.FGTTTALC...................................................................................................................................................................................................................
H2YCN3_CIOSA/8-247                   ............................................................................................................f-ELFVVFCVALF.L......LHHY..GRI...T...KQHP....................................................AVTIATLVAW..YFSLIIIF.ILPLDVSS..TFYRQClhvNgqdnvssqtstgi.......................................................................................................................................itendsrgiavesICEKPW.S..YV....K...G.....T.T.LP.AM...WHIVYWTSQVLTW................LV..LP.FIQ.S....Y....V........G........A.......G..D...F....S.T.LG...................................................KIK.R....AVIE..N...A...VYYG..S...Y..L..FI..FG.CL..LI.........YVAA.S.K.IS.LDIQ......Q............................................................................................................LKVLLI..TA..SNTW.G.L.FLL....VLLLGYG.LVEV.......................................PRGLWH...................AA.DNA..RCMAQTYFK..LS..KLS...TE..KQE.A.A...EDLED...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------v..................................................................................................................................................................................................................
A0CB69_PARTE/7-516                   ............................................................................................................l-EIILVTVYCAK.L......INNI..CC-...K...DVGY....................................................TVKVTCLISW..LTNFILLI.LLPLDIYI..TFRDQE...Qf..............................................................................................................................................................snQDGQEM.H..SR....E...Y.....E.A.IA.NL...YQLLYWANFILCW................TI..IP.IMQ.E....Y....E........E........A.......I..D...L....N.K.AQ...................................................KIV.R....SLIN..N...G...KFYL..I...I..G..IA..GI.AF..VV.........ILVM.T.G.QA.SDYG......-............................................................................................................LAKLLK..SM..ANSF.G.V.ALI....IVLLGYS.LIAV.......................................PRAHMR...................TS.TLD..VQLKYLYFK..TA..KIT...EE..KDD.A.Q...HYLQE...KA...KRVVG.I.RNQ.E..K.FQL...................................................................QSSK..IY.LQMSID..........................................................................................................................................AI..PK.T..MF.N.ELKEEDAK.SKA..PGISYL..QRMffke.............................qpeaTDEEVVEIY.R.DI.............................................RT.KSRTFRRLKA.AWK...ENCKKA..YALE....................................................................................................................NVINSIESPdkkihyevkt.............................................................................................................................nrregscsqtLDTLEWYW.L..CH...Y...K...PQFK....IF....FS....LA.L.S.ILSLLVIVSETT..LFL........................................................-NT..PF....SI.FG.M...PI..-..-.-..-.SL.QS..G.VITL........QIFCFV....PL.F..Y..I...A.FC.VYYGMF....RIKI....AG................C.Y.GLYD...DHQTDAP..SLLFATIN......FSRVAA...P.LC....QNF.L..NML.RIKQRMn.....................................cEPAF.KFAMG....E..MEF........V...PI....FG..VNVI....QL...MP.AILL.FLCFINYF...................................................................................................................................................................................................................
O73804_TAKRU/21-272                  .............................................................................................................LLFTCLYIVCYL.I......LTHF..KKT...A...EFVTgdclpkddrvtfcc........................vspfqrtlkmppstRLLWLCTFTL..SVAVCAVL.LLPISILS..------...Nevl...........................................................................................................................................................hsfPHSYYM.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SK...................................................---.K....GVMA..R...V...YEAV..V...L..L..LL..LA.LL..VLg......ivWVAS.A.L.LH.DNLA......Rksly...................................................................................................dlweyYLPYLY..SG..ISLF.G.V.LLL....LLCTPFG.LSRMfsvtg.............................sllvkPRLLE-...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------dvedtlsctafeedylsrklnsstasc........................................................................................................................................................................................
C5XYA9_SORBI/6-496                   ....................................................................................................lislpltlg---------MVV.V......TLRY..FAG...P...AVPR....................................................YVVVTVGYAW..FCSLSIII.LVPADIWQ..TLTGSA...K.................................................................................................................................................................------.-..--....-...-.....G.G.IG.FF...WSWSYWSTFILTW................AV..VP.TIQ.G....Y....E........D........A.......G..D...F....T.V.KE...................................................RLK.T....SIHM..N...L...LFYS..I...V..G..AI..GL.IG..LI.........LLLI.M.H.RA.WDGG......-............................................................................................................IVGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PRNIWK...................NA.DWS..HRQKVLSHR..VA..KMA...VK..LDN.A.H...QEYSN...AI...VVAQA.T.SNQ.M..S.KRD...................................................................I-LR..PY.MDIIDN..........................................................................................................................................ML..SQ.M..LR.E.DPSFKPSG.GRL..GENDMD..YDT.....................................DDKSMATLR.R.QL.............................................RR.AHEEYYRCKS.EYM...TCVMEA..LKLE....................................................................................................................DTIKNYERRdangwkyvssf...........................................................................................................................resrsgtlgsiLDTIEFIW.R..CI...L...R...KQLQ....KA....FA....VI.L.G.CMSAAILLAEAT..LLP........................................................SGV..DL....SL.FS.I...LI..K..A.V..G.--.-K..Q.EVLV........QVAAFV....PL.M..Y..M...C.IC.TYYSLF....KIGM....LM................F.Y.SLTP...-RQTSSV..SLLMICSM......VARYAP...P.IS....YNF.L..NLI.RLGGNA.......................................KTTF.EKRMG....N.iDDA........V...PF....FG..RGFN....RI...YP.LIMV.VYTLL---vasn...............................................................................................................................................................................................................
W6UTP0_ECHGR/8-579                   ............................................................................................................v-VLLLFSAVVLY.L......SYYF..GQW...K...NQPV....................................................ICTVSYTIGW..LISLLFVG.VLPIDISS..TFAHQNe.iNni............................................................................................................................................................teqKSESIP.V..FV....D...M.....R.T.LH.IF...WSVVYWASQLLTW................II..LP.IME.S....Y....A........D........S.......G..E...F....T.I.LR...................................................KLR.S....AIID..N...A...IIYG..S...Y..L..IL..FL.GV..MI.........YLLV.K.-.RT.VSLDa....aS............................................................................................................LKVLLI..TT..SNTW.G.L.FLV....IFFLGYG.LVEV.......................................PRALLR...................AA.SPI..SRLRFGYFS..LS..KRY...LE..YIE.D.E...EELKM...VL...AEIDD.L.DHQ.V..G.PEH...................................................................P-LR..SR.LNVIVS..........................................................................................................................................KA..AG.I..SE.T.STSSERAA.RRA..NGSRSE..--Ggagl............................gsaalTAQRLVRLH.K.RL.............................................KR.VYHYCCRAHA.LWH...EALRQA..ASAE....................................................................................................................DVCNNCVAGrprvfengptpavlstrd.............................................................................................................ssssvpslwrrlvgadsrARNLEWYW.R..CR...L...Y...PLAL....RA....LG....SL.L.A.VVSLLVVWSECT..FFV........................................................REP..RL....SV.IA.A...II..-..H.S..H.QT.IT..S.YNLI........AFVSFA....FL.G..Y..L...G.FC.IYFTAY....RLRF....FN................Y.Y.RLVP...NHHSDAI..SLIFYGYM......LCRLTP...S.LC....VNF.L..CLA.HLDSHVisasvdttsavtnknstvattanettnttippsatsayyETAF.TKFMG....H..LDV........V...PF....IA..NGFN....IY...FP.IIVV.LLCLVTFF...................................................................................................................................................................................................................
A0A058ZCL4_9EUKA/5-399               .........................................................................................................lfil-ELVVAAALVGR.L......LWWY..GQR...L...KTEW....................................................FVYLFAFIGW..FAAFSVIG.SLPVDILS..GRYRECl.aEaal...........................................................................................................................................................sgeLCQEPI.I..YM....D...F.....D.A.MT.YY...WRTLYWSAFTLTW................SI..CP.FHQ.A....F....V........N........A.......G..G...F....T.Y.LQ...................................................KAW.I....ALRT..N...L...ILYS..L...M..G..AA..GL.VG..LI.........IILS.T.-.QK.LGFA......D............................................................................................................LFDLII..AL..ANIY.G.L.VMI....VGFMGYG.FVEL.......................................PRTLWR...................NS.NRI..RRMHYLEFY..TE..SRY...QD..YVK.A.E...RELAD...LL...ATVKG.L.DLA.I..G.PRD...................................................................P-LR..PK.VNIIVG..........................................................................................................................................KC..PI.D..YM.A.VVEYNTVN.PYD..F-----..---.....................................DIDSLMDLH.G.SL.............................................LC.ISQARDRCRN.EWE...RHLREA..FHLM....................................................................................................................DIELCKNSPnglftepwk..............................................................................................................................rtdiskyarqKQQLKWYW.Y..CR...A...E...TIVM....KI....IS....LV.F.V.CLSLLVLWSELV..LPV........................................................KTP..PL....SI.ME.L...IL..-..H.S..P.-N.TS..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------hvfvt..............................................................................................................................................................................................................
A0A017SHX6_9EURO/15-445              ...........................................................................................................ia--IAILIAVASI.F......IYVY..QTP...R...DRSP....................................................SVTLTCIFAI..TTLLATVL.LLPVDVAL..VSSTTS...Salgr.........................................................................................................................................................rkdwASQDVV.D..RI....T...Y.....S.L.-T.IV...YYLLYSLDAVLCL................LV..IP.FTY.F....F....Y........E........E.......Y..D...E....V.A.TE...................................................SGE.Q....TILK..R...F...WSAF..K...Y..T..IC..FM.AI..IV.........ILFL.V.G.FF.VPVS......Knkdgqdldyf.......................................................................................kklltenhgerALTFTL..GL..LTTI.G.L.CLY....VLYTSSG.LALL.......................................PISLIK...................T-.--A..PSFSNPNIK..AT..TCM...QL..D--.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------snrerqrqlegrcggnpdvlsskdrreldtlvreertlirrqrlveeargegqswlmkacvkieavfrpvkllgglfllliafatwvsmtltaidkaknsvckhrcgyilghinffnpvnwifvqsakvfpvdyviftilallffnssvigiasigirflwirifqirkghtspqalllatamlmltalalnyslsmvvapqyat......
U9U671_RHIID/32-499                  .............................................................................................................LLFVSLYSISYS.L......LQRF..RRK...N...RITDieeeedd......................................pygidslIIIILCAGGL..AMALAGFL.LWPFTMIA..TALLHN...Ei...............................................................................................................................................................fSGNYYL.T..WL....D...V.....E.L.LV.TL...WNYAFIGCNISLF................AL..LP.FAF.F....Y....S........E........T.......D..Q...L....-.-.--...................................................---.R....TFFA..K...A...RETL..I...I..M..GL..VG.ML..MYg......fiYTLK.M.L.FG.ISNV......D............................................................................................................ELEMLN..LF..TCIG.G.A.LIC....LKATPRG.YIEIfsc................................isklPLRPNY...................RR.SLK..EKLKRNKMD..IT..VW-...--..-QQ.R.L...ENLER...GL...RSIYS.V.NNT.S..R.SAI...................................................................--LV..--.-----P..........................................................................................................................................ST..ES.Q..Y-.-.-----SYS.SEK..LYASGI.aNNI.....................................ITNRSGHLS.N.SR.............................................NE.IIAKINKLEE.EEK...RLQKDL..----....................................................................................................................---------.................................................................................................................................................--SHSPLY.R..NM...L...F...----....LV....LF....IV.S.H.FIWLLILGHILY..ALMksl..................................................lvdDGK..EL....KN.LE.A...--..-..L.I..G.KQ.TV..S.LFGF.......gTLNEIT....LI.F..C..F...T.SA.TIIGVY....SISP....--................F.K.RIRP..rLGKMTVQ..QIIANVTV......LLVISSs.wP.VL....VRV.L..GLT.RLS---.......................................SAGP.YENFS....T.mTNI........G...QY....LA..MAFR....VS...AL.ITTV.FSTLEYY-v..................................................................................................................................................................................................................
LMBRL_DANRE/25-255                   .............................................................................................................LLFICLYILSHF.I......LTHF..KKS...A...EFVTddied..........................................atvnkIALWLCTFTL..SVAVCAVL.LLPISILS..------...Nevl...........................................................................................................................................................ltfPHSYYM.Q..WL....N...G.....S.L.IR.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SK...................................................---.K....GVMA..R...V...YETA..V...M..L..LL..LS.LL..VLg......ivWVAS.A.L.LH.HNTA......Resly...................................................................................................dlweyYLPYLY..SG..ISLF.G.V.LLL....LLCTPFG.LSRMfsvtg.............................sllvkPRLLEN...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------leetmncavfeeaslsrklkstn............................................................................................................................................................................................
LMBD2_CHICK/8-540                    ............................................................................................................l-EIVFVFFLALF.L......LHRY..GDF...K...KQHR....................................................LVIIATLLAW..YLCFLIVF.ILPLDVST..TIYNRC...Klavnsspaesn...........................................................................................................................................ssfvtlapskqQCFKPW.S..YI....P...N.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PK.FNLQw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSHWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...IM...EEVRK.V.SES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PT.E..YQ.E.RMGRNMDD.YED..FDERQN..SYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHRRTQV.QWQ...ILLEQA..FYLE....................................................................................................................DVAKNETSAtrqfvhtfqsq...........................................................................................................................epenkiiqyfyTPTVEWYW.E..CL...L...R...PWFY....RV....LA....VV.L.A.AFSVIVVWSECT..FFS........................................................TRP..VL....SL.VA.V...FI..-..Q.L..A.EK.TY..N.YIYI........EMACFL....TI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDATIsht.................................daqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
G7PHS1_MACFA/265-450                 ....................................................................................................ldmellhrq------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----LLALQT.QRV...LLEKRR..----....................................................................................................................---------.................................................................................................................................................--KASAWQ.R..NL...G...Y...PLAM....LC....LL....VL.T.G.LSVLIVAIHILE..LLI........................................................-DE..AA....MP.RG.M...QG..A..S.L..G.QV.SF..S.KLGSf......gAVVQVV....LI.F..Y..L...M.VS.SVVGFY....SSPL....--................F.R.SLRP..rWHDTAMT..QIIGNCVC......LLVLSSa.lP.VF....SRT.L..GLT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNAA.FAGLTTLC...................................................................................................................................................................................................................
G9P4Q7_HYPAI/19-518                  ............................................................................................................v-ALLLVSLGVLL.I......LRYY..LPL...R...TTPA....................................................FYLVPIFFAL..WLPSVLVL.LVPIDLAS..SAITDD..vAs..............................................................................................................................................................rgI-----.-..WL....P...Q.....R.V.VL.VL...WRITYWLTFCLTW................FL..LP.ILA.E....Y....S........D........T.......G..Y...R....E.P.WD...................................................KFM.Y....SLRA..N...A...QFYA..M...V..L..GA..SV.LG..LV.........YIFA.S.-.YE.FSFT......A............................................................................................................LKALIM..AL..AYCW.G.L.VLA....IYLMGHG.LVSI.......................................PRQLLR...................SG.SIS..GKLRSLQIK..AP..RVY...EK..MED.S.L...TGVEE...IE...QQIAE.L.SRR.K..T.GSA...................................................................AAFQ..DW.IEELQEm........................................................................................................................................aSI..PE.S..Q-.-.PRSTLLDP.T-I..NTQ---..--Avp................................hviTEKYLADLT.R.KY.............................................VR.ARHSRSRYVG.EWN...RLVQSA..AKLQ....................................................................................................................MILDSVASKkldfggasph.............................................................................................................................agfwdrvkilTPYSRYVC.Y..FY...V...F...PYMR....MA....FG....AV.L.A.FASACIVWSEIV..KYP........................................................-FP..KL....SI.IR.V...SV..V..H.H..W.VG.DK..A.QVGFa......gQVISAF....WI.C..Y..M...C.IA.ALSSMT....EVKV....WR................G.R.ALVR...-RNTGHE..AAFWYAMQ......VAKLSV...P.LS....YNF.L..TFL.SSEVYE.......................................KTIF.YNFLG....K.yVDV........T...P-....LG..QWFD....NF...FP.IALV.IPVFAALF...................................................................................................................................................................................................................
R0KLI6_ANAPL/1-221                   ..........................................................................................................hfi------------.-......ITHF..KKQ...T...DFAAvhdde.........................................daavnrIALGMCTFTL..AVALGAVL.LLPFSIIS..------...Nevl...........................................................................................................................................................lsfPHNYYI.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNMSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SK...................................................---.K....GIMA..R...V...YETS..V...V..L..LL..LT.LL..VLg......mvWVAS.A.I.VG.NNAA......Srqsly..................................................................................................dlweyYLPYLY..SC..ISLF.G.V.LLL....LLCTPFG.LSTMftvtg.............................kllvkPRLL--...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------edldeqlsctrfeeaavsrrias............................................................................................................................................................................................
G3NXX4_GASAC/8-376                   .............................................................................................................VVVVVVFLLALY.L......LQRY..GDL...R...RQQR....................................................MVLLGTLLSW..YLCFLIVF.ILPLDVST..TIYKQCildNaihptsvtqerrtnq...................................................................................................................................tddnsavnptdsilkVCEEPW.S..YI....P...D.....A.I.LP.VF...WRVVYWTSQFLTW................LL..LP.FMQ.S....Y....A........R........S.......G..A...F....S.R.VG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FI.SL..LV.........YVAA.H.-.PQ.WKFTw....tE............................................................................................................LQTIGI..TA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSYWL...................AS.SHG..YLLAKTYFK..AA..KVA...TE..KVA.A.E...ENLAD...VM...EEVAG.V.HES.V..R.YNH...................................................................C-LR..KC.VDTIIT..........................................................................................................................................KC..PS.E..YK.E.ELGRTVES.SGG..EQ----..--Nv..................................ppTKRGLIKLH.K.KV.............................................IS.AVQSHGQTQV.QWS...ILLEEA..FHLE....................................................................................................................DVAKSQSSPirqf........................................................................................................................................ihsspSERHASWI.H..RF...I...Y...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------tptvg..............................................................................................................................................................................................................
F8N2H0_NEUT8/24-265                  ............................................................................................................v-AVALVFFVAVI.T......VFTW..QTP...Y...DRSK....................................................LVTTVAIVSL..TALLATVF.LLPVDIAL..VSSTAS...Asrgtkkdw................................................................................................................................................atperihgiL-----.-..--....-...-.....K.T.LK.IV...YYSLYSFDALLCL................VV..IP.FAY.F....W....Y........E........E.......H..D...E....V.L.EEeg...............................................reTWS.T....RFWQ..A...L...KYTI..A...F..I..IL..VI.IL..FL.........VGFF.V.-.PT.AAQD......Hgrhldldyfk........................................................................................rlltnnngekALSFGL..GL..LMTL.G.V.LLY....VLYTGTG.LALL.......................................PVSLIK...................SA.PAI..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sapelsamtaaelehnrelqrqiemrna.......................................................................................................................................................................................
Q22RN8_TETTS/71-556                  ............................................................................................................f-LMAVLYLFARM.I......YKYY..IDP...S...EQYF....................................................VTKYSVIICL..VLSMICLL.IIPIDILV..TQNKEK...Tfst...........................................................................................................................................................leiN-----.-..-V....N...Q.....T.F.MK.EL...ELKIYGVLILCSF................IL..LP.FSY.F....Y....C........E........Q.......K..Q...K....D.F.DEdvs............................................mdttSTS.S....KFFK..A...L...QNTT..F...F..I..LV..VS.VL..LL........lGLVI.K.E.KD.RSAQ......Segvdevdwvk.......................................................................................elfdvehlgesAISFCI..AL..FISF.G.S.ILW....IIYGSYG.LIML.......................................PLYLIK...................G-.---..---------..TK..SLS...QE..KDE.V.F...SDLDQ...VK...QQQKT.I.QGK.Y..A.KSH...................................................................GKIS..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..-NH.....................................DKKNLANLR.K.RE.............................................RI.LQFKTSRISE.LEE...NTNDNL..----....................................................................................................................---------.................................................................................................................................................----QT--.L..FK...I...L...APFR....IL....LG....IS.S.L.VISFMLYYSLFL..STYdriqgssc.......................................glrcgyiteRKQ..TF....NP.LD.Q...IL..V..Y.L..S.--.--..S.YYPL.......dYFFFFI....IA.G..Y..M...Y.IA.LLYGII....KLGF....-N................Y.L.WLKNyeiRRSTSQP..QALIIFAF......FVSIC-...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------imvmtsqimyispqyttfgaqrtvkgdqctlgsvsssikyvcsmsnistfynkmslsfplfamvfffsnvaflflktif....................................................................................................................................
E1BMA6_BOVIN/28-264                  .............................................................................................................LLFATLYIFCHI.A......LTHF..KKP...A...EFTTvdeed..........................................atvnkIALELCTFTL..AVALGAVL.LLPFSIIS..------...Nevl...........................................................................................................................................................lslPRNYYI.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLI................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVLA..R...V...YETV..V...M..L..ML..LT.LL..VLg......mvWVAS.A.I.VD.NNKA......Sresly..................................................................................................dfweyYLPYLY..SC..ISFL.G.V.LLL....LVCTPLG.LARMfsvtg.............................kllvkPRL---...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------ledleeqlhcsafeeaaltrricnptscwlp....................................................................................................................................................................................
U3DXH0_CALJA/264-450                 .....................................................................................................pldmellh------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.--RQVLALQT.QRV...LLEKRR..----....................................................................................................................---------.................................................................................................................................................--KASAWQ.R..NL...G...Y...PLAM....LC....LL....VL.T.G.LSVLIVAIHILE..LLI........................................................-DE..AA....MP.RG.M...QG..A..S.L..G.QV.SF..S.KLGSf......gAVIQVV....LI.F..Y..L...M.VS.SVVGFY....SSPL....--................F.R.SLRP..rWHDTTMT..QIIGNCVC......LLVLSSa.lP.VF....SRT.L..GLT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNAA.FAGLTTLC...................................................................................................................................................................................................................
LMBD1_NEUCR/19-262                   ............................................................................................................v-AVALVFFVAVI.T......VFTW..QTP...Y...DRSK....................................................LVTTVAIVSL..TALLATVF.LLPVDIAL..VSSTAS...Asrgtkkdw................................................................................................................................................atperihgiL-----.-..--....-...-.....K.T.LK.IV...YYSLYSFDALLCL................VV..IP.FAY.F....W....Y........E........E.......H..D...E....V.L.EEeg...............................................reTWS.T....RFWQ..A...L...KYTI..A...F..I..IL..VI.IL..FL.........VGFF.V.-.PT.AAQD......Hgrhldldyfk........................................................................................rlltnnngekALSFGL..GL..LMTL.G.V.LLY....VLYTATG.LALL.......................................PVSLIK...................SA.PAI..S--------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------apelsamtaaelehnrelqrqiemrnagr......................................................................................................................................................................................
D3BC73_POLPA/1-96                    ............................................................................................................m------------.-......----..---...-...----....................................................-----SWIGW..FMCFGIVC.LVPIDVLA..TQYRDC..lEskg...........................................................................................................................................................vnqCERAPW.S..YV....S...S.....D.V.LY.YF...YQTFYFGTLLLTW................LV..YP.FLG.S....L....V........L........A.......G..D...F....K.L.TE...................................................RIQ.R....SIRE..N...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------hg.................................................................................................................................................................................................................
A0DTG9_PARTE/41-327                  ...........................................................................................................ii--AVLLLGINIY.I......LALY..CHP...S...DSGFga................................................slFCKILVVLGF..TLAWGQIL.LVSADISA..------...S.................................................................................................................................................................---KGV.F..TT....E...G.....E.S.MM.IV...WYVIYCTILGMVA................FL..IP.CAQ.F....Y....Y........E........S.......D..E...D....K.P.LM...................................................---.K....RLLE..V...M...CYEF..I...L..L..GV..LL.TL..LLv.......gFTYL.G.T.AR.IPVH......Titqtfdsqisatfpivln........................................................................nyafnqiesdtnveisvsFPVFLM..GF..LAFI.G.W.FLL....VLFGGVG.LSAL.......................................PIDLIQ...................E-.---..YIS---RPK..VM..K-S...SE..AME.K.K...MRLKK...QA...VELIQ.F.GQQ.I..Q.EEEkelalv.......................................................ngfmaeRKVK..NQ.IKQKAK..........................................................................................................................................KF..Q-.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------aatealanehei.......................................................................................................................................................................................................
Q6C0H8_YARLI/9-480                   .............................................................................................................LAFCATAVCSVL.W......ISQY..SSI...K...STPL....................................................FILLPLVLAV..YIPFSIVV.LVPIDLLS..ASSNGE...-.................................................................................................................................................................--GHPL.F..YL....N...E.....N.V.RL.IL...WRVSYWLAFVLTW................AV..LP.LLQ.S....Y....V........E........S.......G..H...H....D.P.RK...................................................KAR.E....AIMY..N...L...KYQG..I...L..L..GV..GL.IG..LI.........YTII.S.-.TG.LSIT......S............................................................................................................IKQVAI..AL..SYSY.T.L.IFA....IWFMGHG.LVNV.......................................PRRLWI...................LA.APT..ERVRQHYRK..AV..SVH...DR..YAE.A.Q...QKYIE...VS...NEVLA.L.--R.V..H.REH...................................................................TQYT..NW.VDELCD..........................................................................................................................................SI..ED.T..S-.N.VVQLPPRG.R--..PAT-VE.rSRI.....................................SEEYLSNLQ.R.SL.............................................QK.AEFRLIRYTM.DWK...NLVDEA..ARDE....................................................................................................................DIVNSHGDLkfrr........................................................................................................................................sstrlPPNVAHIY.Y..SL...V...E...PWVM....RL....GA....VF.W.G.LLSLTLVWSELL..YGT........................................................---..KY....SL.VN.I...II..-..-.-..-.-S.ST..Q.GFGQ........QVVSSF....IL.G..Y..M...C.YT.AVSSLF....RVRV....FN................V.Y.GLVR...-QHSDAS..SMLFYAMY......ACRLTV...P.IA....YNY.L..MLI.PSR---.......................................ESVF.QAFLG....K.yINL........T...P-....LG..TFFS....DG...IP.RFIL.VPIGLTLF...................................................................................................................................................................................................................
A2EHB0_TRIVA/9-481                   .........................................................................................................lvsc---VVLIAVITV.F......YWFY..GAF...R...HPAW....................................................ASSFMVFSAC..IPVIIVSG.ILPYDISL..NLFGHT...N.................................................................................................................................................................E-----.-..--....T...P.....K.V.LY.IC...LEILYWTSFILTW................II..VP.FAV.S....Y...lS........Y........S.......H..S...I....S.I.KH...................................................RIW.F....VIRE..N...L...IFFG..V...A..G..GL..VL.IF..GI.........VMIA.T.-.KK.LDPK......G............................................................................................................LFSLAI..AL..GNAY.G.L.ILQ....CLAFGYA.FVKV.......................................PMNIWR...................NA.DPG..FKYKNSVYQ..LF..KET...KR..CAA.A.V...ADADA...AL...DHWRR.C.REN.I..E.GEMaeky..........................................................ldlgrP---..--.-----Raenid...............................................................................................................................llksalPI..PE.R.fYT.S.QCTNRKIN.AVR..KIDWKH.cTEA.....................................NIEDFFYLM.D.QT.............................................AN.ALDQCKNYVN.YTA...VVAEKS..----....................................................................................................................-LAKF----.................................................................................................................................................KKSVESGK.K..AS...I...T...KILI....RA....AD....IL.L.M.VLIGISFYNEIL..MIP........................................................SKQ..KY....TL.FN.Y...LS..-..-.-..H.CH.MS..Q.YIGQ........ILITFP....LI.S..F..Y...L.FL.GGWALV....QLRI....GS................F.Y.RFIA...-HASNGN..TLNYWAIL......IARFGP...T.VG....YHY.M..LQV.GAS---.......................................NAAF.VKVMG....N..MND........V...YF....IG..NSFN....YI...SP.SIMI.IVAIFVAF...................................................................................................................................................................................................................
I3K2D5_ORENI/25-252                  .............................................................................................................LLFTCLYMLSYL.I......LNQF..RKT...A...EFVTddved..........................................atvnkIALWLCTFTL..SVAVCAVL.LLPISILS..------...Nevl...........................................................................................................................................................ltfPQSYYM.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVMA..R...V...YEAV..V...L..L..LL..LA.LL..VLg......ivWVAS.A.L.LH.DNIA......Rksly...................................................................................................dlweyYLPYLY..SG..ISLF.G.V.LLL....LLCTPLG.LSRMfsvtg.............................sllvkPR----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lledvedtlscttfeedslsrkin...........................................................................................................................................................................................
C5L569_PERM5/3-153                   ..........................................................................................................eye------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....S.V.HS...................................................-IK.K....ALRN..N...A...IWYL..A...Y..A..CA..GL.LI..LA.........YLWY.M.-.QR.LGLQ......G............................................................................................................ILGFIY..AA..SNAW.G.L.VLV....TLLLGYG.LVAV.......................................PQWLHV...................LS.YDK..RHMEAIYAQ..VV..SAE...DA..RLS.A.K...FDLMD...VF...NLYRD.Q.ERE.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sgqgaskqlcisavvcldddstglptcvqlpq...................................................................................................................................................................................
D3B509_POLPA/28-448                  ........................................................................................................ielfg-----VGVVVFI.A......MKQY..ISF...K...RTPF....................................................YAMFTAFLGW..YLCFNIVF.LVPLDITA..TIHGECl.vKandtctin................................................................................................................................................nttsceinnMCPEPI.S..YL....P...D.....V.I.VV.NQ...WRILYWGTFVLSW................LI..FP.ILQ.T....F....S........G........T.......G..D...F....R.I.RE...................................................RLL.R....AIKE..N...I...ILYC..F...M..G..IV..GL.IT..LI.........IILA.M.-.RL.QALA......T............................................................................................................LVQSTF..IV..LNVY.G.L.VLV....VVTMGFG.LVDV.......................................PRNLLR...................KG.DYY..RTLRHYRVH..AL..ELK...NE..LDE.S.T...KKLEH...HL...RLIKQ.T.SDR.A..G.EYH...................................................................P-YR..PY.LDIIIS..........................................................................................................................................KC..PL.E..FD.Q.VDTEDMSE.---..-----A.sDEI.....................................TYSKVVEMH.A.NL.............................................MD.FTHQAERADT.SYK...RLLGKA..FATE....................................................................................................................DIIATLEKPsdlrsgkiew.............................................................................................................................sfkqtssnptKARWEYYW.H..LY...I...Y...PNFY....KA....LG....AL.G.A.IMSLLIVWAEIS..MAF........................................................SSS..NLanvkSP.FA.M...II..-..R.S..T.DA.SM..N.GLGL........QIFCFI....PL.I..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------lv.................................................................................................................................................................................................................
F6WVI3_CALJA/243-445                 .............................................................................................eeealqrrlnglsssv------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................--------E.Y.NI.............................................ME.LEQELENVRT.LKS...KLERRK..----....................................................................................................................---------.................................................................................................................................................--KASAWE.R..NL...V...Y...PAVM....IL....LL....IQ.T.S.ISVLLVACNILC..LLV........................................................-DE..TA....MP.KG.T...RG..P..G.I..G.NA.SL..S.TFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.NFTP..kKDDTTMT..KIIGNCVS......LLVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAIVTTLC...................................................................................................................................................................................................................
F7VYL4_SORMK/19-522                  ............................................................................................................v-ALFVISVIVLL.I......LRHY..LPL...R...TTPA....................................................YLLVPIFFAL..CLPASMVL.LVPIDLAS..SAMVDD..iDa..............................................................................................................................................................rgI-----.-..WL....E...R.....G.P.LR.IC...WRIAYWLTFCLTW................FI..IP.ILG.E....Y....S........D........S.......G..Y...R....D.P.QA...................................................KFR.D....SLRA..N...A...QYYA..V...V..F..GS..GF.LG..LL.........YVLW.S.-.YG.GFSE......S............................................................................................................LKSTVM..AL..AYCW.G.L.ILA....IYLMGHG.LVAI.......................................PRRLFR...................NA.DIS..GRLRRIQTQ..AP..KVY...DQ..MED.A.Q...MNLDD...LE...MQVAE.L.NKR.R..Q.TGT..................................................................aKNFQ..DW.IEELVD..........................................................................................................................................LT..NI.P..ES.Q.LASTSGAV.RGS..G--EYI.rTKLpt.................................viTEKYMADLT.R.QL.............................................IR.AKHARSRYTS.DWN...RLLHDA..VKTQ....................................................................................................................AIIDSVASKrldfgvpspn.............................................................................................................................sgfwgrhsplTPYTRFLY.Y..YY...V...L...PYFN....LG....FG....GL.L.A.LASVCIVWSEVV..KGI........................................................-FP..VL....SV.IR.Y...SV..V..H.H..N.VG.DK..G.QIGLa......gQAIAAL....WM.I..Y..M...C.AA.ALISIT....EVKV....WR................G.R.ALVR...-RNTAPE..SAFWYASQ......VARLSV...P.LT....YNF.M..TFL.GV-VYK.......................................DTVF.YDFLG....Q.lINL........T...P-....LG..KWFD....YL...FP.ALIL.VPVCFTLF...................................................................................................................................................................................................................
Q86AH0_DICDI/99-712                  ............................................................................................................i-FFLILMIFSHF.I......IRRY..IRK...K...DDEKk.................................................iyIPRLLCTVCL..SISISAML.LIPITIIS..------...Neim...........................................................................................................................................................ttfPSSYYT.Q..WL....D...R.....E.L.IF.SF...WNKIFWGANISLF................II..LP.FTY.F....L....Y........E........S.......E..G...I....R.G.--...................................................---.R....SLLN..R...I...KEAL..L...I..L..LL..VA.VI..FVg......fvFVVF.K.L.FY.GQQK......Qpstlmen..............................................................................................isiistdYLPFSY..SL..ISTF.G.T.VVV....MYSIPSG.FNFL.......................................ISKCISlr..............ivrPI.EDE..IKAAKMEIE..SI..TFT...LD..KAE.A.A...GFVNL...EI...KKSKL.K.KRL.L..N.CSInsgnnnnnnnnnnnn....................................nnnnnnnnnngnncndN---..--.-----Kvekkkdnknknemksdkkt...................................................................................................nhsnvnsdiissssspssplTP..SS.P..LS.Q.ASNANESN.STV..NTPNII.aTTTnsn..............................iviiNDEYNNNNN.N.NN.............................................IN.FENGNNSNNE.NNN...NIDNDN..--LE....................................................................................................................TNIENKKKInnylikkkkvnvnsnfkit..........................................................................................................peeiqkledtrdelylyidkISRPSYFS.S..TL...V...R...ILSS....IL....LT....II.N.F.TITGWVIFKVFI..TLIkrife..............................................lfeleSIK..AY....FD.SW.M...SS..A..I.D..L.SK.GS..S.KLGPf......eSLLETT....II.I..Y..L...M.IS.AFVGFL....NEPY....--................F.A.NIKP..rIHSTSLR..KMIINTGI......ILLMSSs.fP.VV....VRI.L..EIS.RF----.......................................----.-DLMG....Y..YSH........T...NY....LR.gDFFK....II...YS.ISFL.FMVIRSYM...................................................................................................................................................................................................................
U3ESK3_MICFL/234-450                 .......................................................................edldeqlsctgfeeasisrkinsgktscwlnfdvemlr------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................--------Qqylaiha...................................................................................................................................hritletRRKASAWQ.R..NL...G...Y...PLAM....VS....LL....SL.T.G.ISVLVVCFHVLE..LLL........................................................-DD..AA....MP.RG.I...QD..A..P.L..G.KV.SF..S.VFGSf......gAAMQVI....LI.F..Y..L...M.IS.SVVGFY....SSPF....--................F.I.KLLP..eQHNTAMT..KIIGNCVS......LLVLSSa.lP.VL....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNML.FAGLTTLC...................................................................................................................................................................................................................
F1KVP9_ASCSU/279-443                 ....................................................................................................qkplrgyqk------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................------VL.Q..SV...K...Y...PLAI....II....LL....LL.T.A.VSVLMVLINTLQ..LLF........................................................---..GY....RA.LP.V...YA..Q..Y.I..E.VN.SR..H.TFGVf......gALVEVI....II.S..Y..L...M.VA.SLVGVY....SVPL....--................L.R.RLRP..rKGKTTMT..FIIANCTT......VLVLSSa.lP.VL....ART.L..GIT.TF----.......................................----.-DLLG....A..YGS........F...NW....LS..-NFT....LV...WT.YNVA.FAIATVS-c..................................................................................................................................................................................................................
I3JF56_ORENI/243-453                 ...............................................................................ycihlqeetlqrrlngsstnayargsfahq------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.LNKELDN---.---...------..----....................................................................................................................--IRNQRNKl..............................................................................................................................................erRKKASGWE.K..NL...L...Y...PIVM....LI....LL....TG.T.T.ISVLLVALNILY..LLV........................................................-DE..TA....MP.KG.S...TD..R..A.I..R.NT.SL..S.TFGVa......qAVLEII....LM.F..Y..L...M.VS.SVVGFY....SLRV....--................F.E.GLTP..rKDDTTMT..TIIGCCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAVVTTLC...................................................................................................................................................................................................................
W7K9R9_PLAFO/5-545                   ....................................................................................................illiffiay------LFISGI.Igt..rlIIIY..SHK...E...ENNRlv................................................yiIIKCFIIIGY..ILSWTIIL.LVPIDVYY..NTYKDI...Ek..............................................................................................................................................................yiD-----.-..--....-...-.....-.-.IF.KL...FRICYWFSILYIF................ML..TP.VMFiI....Y....S........E........S.......D..R...K....I.Y.-TlnkhhtkikkqnkgknnnpqnngniindgniinhdnitnddnitnnyyyynKMT.Y....KIIY..K...K...IIPI..T...L..F..FLlsSI.CF..LYf.......tFLYL.K.K.LN.LNLN......Aqecalwynyikdiykknfliyn................................................................irkiehcenikntnikiiinleFNDYII..II..ISFI.G.F.LFF....IFYGGIG.LISL.......................................PFNLIN...................S-.---..----YIYRK..KK..IKK...DD..LKK.Q.L...DIINR...KS...KMLLN.I.TEA.L..Q.KEK...................................................................NQLL..--.------..........................................................................................................................................--..--.-..--.-.--KMNYFR.---..------..---.....................................SFFKYMKYN.R.EK.............................................NF.LNYTVHNLEK.EYD...ILLENF..----....................................................................................................................---------.................................................................................................................................................-----TKN.S..SI...L...F...PYIS....LF....LG....II.F.L.IISTVIIIHLFV..NLIidvl...............................................kynddIIN..SL....TF.LD.S...LL..V..Y.L..V.QI.KL..S.VLST........-IIYTF....IM.S..Y..L...L.VC.SLSGFI....QFCSk.lsLG................F.I.FVLE...KRSTYLN..SLLLNICL......FFFIS-...-.--....---.L..GIS.LFSTKIfyt.................................yssFTYA.TFLFD....L.tLKK........M...RF....VG..PLYS...nNT...FL.YILL.LINFITL-v..................................................................................................................................................................................................................
I1MYP4_SOYBN/6-495                   ....................................................................................................lislplttg--------MVLF.T......LRYF..AG-...P...DVPR....................................................YVLFTVGYTW..FCSLSIII.LVPADIWA..TMSSNQ...E.................................................................................................................................................................N-----.-..--....-...-.....G.A.IS.FF...WSWSYWSTFLLTW................AV..VP.LIQ.G....F....E........D........A.......G..D...F....T.V.SE...................................................RLK.T....SVHV..N...L...IFYL..I...V..G..SI..GL.FG..LI.........LLIL.T.H.NK.WKGS......-............................................................................................................LLGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKSIWR...................NA.DWT..IRQKVLTHK..IA..QMA...VK..LDD.A.H...QELSN...AI...VVAQA.T.SKQ.M..S.KRD...................................................................-SLR..PY.MNVIDD..........................................................................................................................................ML..TQ.M..FR.E.DPSFKPQG.GRL..GENDMD..YDT.....................................DEKSMATLR.R.HL.............................................RG.AREEYYRYKS.EYM...TYVLEA..LELE....................................................................................................................DTIKNYERRnstgweynssi...........................................................................................................................rpartgklgslCDTLEFLW.K..CI...L...R...KQVE....KG....LA....VI.L.G.IMSVAILLAEAT..LLP........................................................-SI..DL....SL.FS.I...LI..-..-.-..K.SV.GT..Q.EVLV........QVFAFV....PL.M..Y..M...C.IC.TYYSLF....KIGM....LM................F.Y.SLTP...-RQTSSV..NLLMICSM......VARYAP...P.VS....YNF.L..NLI.RLGKNK.......................................TTIF.EQRMG....N.iDNA........V...PF....FG..DEFN....KI...YP.LIMV.IYTIL---vas................................................................................................................................................................................................................
V9EN96_PHYPR/8-540                   .........................................................................................................lamc----GLLGFTWW.L......LTHY..KD-...A...KVPT....................................................VVHAAVFSTW..VLGFLGLI.LLPMDLAT..------...Nglvassq...................................................................................................................................................sagnvaeE-----.-..KA....S...F.....R.E.YL.AV...WRLLYWATFLMSW................VG..LP.FLV.E....F....R........Q........N.......G..E...F....E.L.DK...................................................RIL.S....SFRH..L...V...FHWT..V...L..A..GG..LF.IV..AL.........YLIL.V.-.DH.LSLY......G............................................................................................................VLGLAM..AA..SNTY.G.L.LWV....IALLGYG.LVEI.......................................PRGFWI...................RR.LDG..AQLQILHFE..AV..QLQ...DE..RME.A.R...FEYDD...VV...ADVHD.A.YQR.M..V.QAEsdaii.........................................................ltsemQ---..-Y.VKTCLLqvvaaiekskpaf................................................................................................................rrldtsndtkrgsKS..VS.F..SD.S.KMKR----.---..------..--Gvsnigr.........................asrkapTLTETIELH.R.RV.............................................RI.AQLELRRCDQ.AFL...ELCINV..----....................................................................................................................DILQDRSAQralpagslyp............................................................................................................................etsalnrlhniFLNMRHQL.R..QW...V...T...SPVA....IV....CA....VV.T.G.FLSLCVVWGELT..MGW........................................................RRS..SL....SL.FR.F...MI..A..V.E..A.ME.TS..S.SLRSa......tELISAL....VL.V..Y..L...A.LC.CYRSLF....TLRL....PG................K.Y.VLRA...HGNSTEL..CLLKTSIY......QCRLQF...A.LG....QNA.L..LLL.RGGGLA......................................eGTAF.NTLLA....N..TRV........V...HV....FG..RGFA....VY...AP.LAMI.ALAVFT--lt.................................................................................................................................................................................................................
S9UHX5_9TRYP/271-498                 ...............................................................................eaahaslhttsarlmeegraldaesagglr------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..--Ls..................................rsTWRKVVRFK.R.EV.............................................RE.VEHEYERLEE.AYN...QDNG--..----....................................................................................................................---------.................................................................................................................................................--------.-..TI...L...H...YYAG....LL....LA....FV.C.T.PLSFLWIAHIIV..FDL........................................................--T..GL....HP.FL.N...RL..L..V.T..M.DG.AL..P.MLGP........-LTYSV....FA.F..Y..M...L.LC.TLLGCY....KVCC...rFT................L.FpVFYM..rVGGTMLN..AILFNSTV......LLLAAFsvlQ.LC....VNS.F..RVY.TA----.......................................RTVL.YSIFV....E.sIQH........K...AF....LR..AVFP....IG...CY.SLLV.IAFLFT--ly.................................................................................................................................................................................................................
F2SIJ5_TRIRC/15-258                  ............................................................................................................v-VVAILIAIASV.F......VYVY..QAP...R...ERSG....................................................LVSAVCILTV..SALLATVL.LLPVDIAL..-ISSTN..sRrlgqrkd...................................................................................................................................................watpdavA-----.-..SI....V...Q.....S.-.LT.IV...YYSLYSLDTILCL................LV..IP.FTY.F....W....Y........Eey...delA.......E..Q...Q....D.W.NA...................................................-FG.K....RFWG..A...F...RYTI..A...F..L..VV..TV.IL..FL.........VGFF.V.-.PV.ARNR......Agagldldyfk........................................................................................hlltenngerALTFAL..GL..LTMI.G.I.IVY....VLYTSAG.LALF.......................................PVSFIK...................T-.APS..VSSPSLYAT..TA..SRL...EE..NVE.R.Q...RQLEG...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------rcggn..............................................................................................................................................................................................................
U4KV42_PYROM/10-485                  ............................................................................................................l-CLFSIAIFTLL.L......QRRY..LPL...R...TTPE....................................................YLLLSTFLGL..FLSSSIIV.LVPIDLAS..SA----...-.................................................................................................................................................................-SSNLA.I..TL....P...E.....R.A.LR.VC...WRISYWLCFILTW................AI..LP.LLL.S....Y....S........D........S.......G..H...R....S.P.QK...................................................RLL.D....SLKA..N...A...RYHM..I...T..L..SL..GS.VG..LF.........YFLF.S.-.NG.FNFA......S............................................................................................................VKGMLV..AI..SYCY.S.L.FLA....IALMGHG.LVAI.......................................PRNLLH...................AA.SIP..GTLKRLRRS..AP..AAY...DK..VLE.S.T...TNLES...VV...AEVSA.L.RNR.R..S.TVA...................................................................PEFQ..DW.IDELLE..........................................................................................................................................LA..-S.P..PS.T.TI------.---..-SRPTI.pN-I....................................iTEEYLAALT.A.RL.............................................KL.CLHRRHRFQA.AWN...SLIQSA..VDQQ....................................................................................................................AILDSATTRrlvfsh....................................................................................................................................ptrwsllNPYTRHLY.H..FH...L...L...PLLH....YL....MG....AL.L.A.VASAMIILTELS..HSY........................................................-FP..AL....AV.IR.Y...TV..-..-.-..T.PH.GH..L.TF-L.......sQLSAAF....WI.G..Y..M...C.LS.AYHSLS....VIKV....WG................T.H.ALVP...-RNTSGS..SACFYASY......AARLTV...P.LA....YQF.V..SFL.QEKEVV......................................eKTVF.YDFLG....R.lVNL........T...P-....LG..EGFN....DF...FP.CLIL.IPVAAN--la.................................................................................................................................................................................................................
G5C9G5_HETGA/8-546                   ............................................................................................................l-EIVFVFFLALF.L......LHRY..GDF...K...KQHR....................................................LVIVGTLLAW..YLCFLIVF.ILPLDVST..TIYNRC..rHaaanssppessns......................................................................................................................................tgsygiispvprqhPCFKPW.S..YI....P...D.....G.I.MP.IF...WRVVYWTSQFLTW................IL..LP.FMQ.S....Y....A........R........S.......G..G...F....S.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..LI..FG.AF..LI.........YVAV.N.-.PR.LHLEw....nQ............................................................................................................LQTIGI..AA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSYWN...................GA.KRG..YLLMKTYFK..AA..KLM...TE..KAD.A.E...ENLED...VM...EEVRK.V.NES.I..K.YNH...................................................................P-LR..KC.VDTILK..........................................................................................................................................KC..PI.E..YQ.E.KMGRNMDD.YED..FDEKRN..TYP.....................................SEKSLVKLH.K.QV.............................................IY.SVQRHHRTQV.QWQ...ILLEQA..FYLE....................................................................................................................DVAKNETSAtrqfvytfqpp...........................................................................................................................epenrfiqyfyNPKVEWYW.E..CL...L...R...PWFY....RI....LA....VV.L.S.IFSVIVVWSECT..FFS........................................................TTP..VL....SL.FA.V...FI..-..Q.L..A.EK.TY..N.YIYI........EIACFL....SI.F..F..L...S.IC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLT.HMDSSIshq.................................ntqPTAY.TSIMG....S..MKV........L...SF....IA..DGFY....IY...YP.MLVV.ILCIATYF...................................................................................................................................................................................................................
S4RXV9_PETMA/26-270                  .............................................................................................................LLFTTLYIVSYI.T......ITRY..KKK...A...DFISddded..........................................amvnrISLWLCTFTL..AMSLGAVL.LLPFSIVS..------...Neil...........................................................................................................................................................lsfPQSYYM.Q..WL....N...G.....S.L.IH.GL...WNLIFLFSNLSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GIAA..R...L...YETL..V...V..L..FL..LS.LL..VAg......mvWVAS.A.L.ID.DDAA......Skesly..................................................................................................dfwefYLPYLY..SC..ISLF.G.V.LLL....LLCTPLG.LSCMfsvtg.............................qllvkPRL---...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------ledldeqidcqrfeedtikrrlngvfsaprynhhnksrs............................................................................................................................................................................
E9B0I0_LEIMU/10-489                  ............................................................................................................v-VFFVLALGVCL.L......TYHY..YTK...V...SIKRi.................................................piACAVWHVIAL..YMCMLPFP.LLVVDIDA..SLAAQS..dT................................................................................................................................................................sQ-----.-..--....K...Q.....D.W.MR.PI...WITIFAVTYFCAW................VS..LP.LAQ.M....Y....T........E........V.......G..E...F....T.V.KG...................................................RVL.H....SIKL..N...L...ILYA..V...I..I..VI..VL.AA..LG........yFVVI.T.N.SY.SSVA......K............................................................................................................VMKVVI..SL..ANAW.G.L.LIL....TLFMPAG.LVGV.......................................PRMLWR...................YA.DAK..RLLRSQLYA..AT..DIQ...ED..LDL.A.A...MDLAS...IK...AELIS.I.DPQ.V..S.EED..................................................................rPHLA..FM.LEIISAa.......................................................................................................................................drEI..PM.Y..HI.A.ALRVKTAP.---..---STE.rDDV.....................................SLLHLETLN.Q.RL.............................................KK.AIKIANRANY.RWN...STVRKC..DSLD....................................................................................................................QIVRGVKGT.................................................................................................................................................NNRLKRMW.F..P-...I...R...QYVY....YT....GC....FV.C.S.VLTIFILWSELT..MPL........................................................RDW..AG....KP.LG.V...IE..-..L.V..M.KS.SI..H.FIGS........----VV....LL.F..Y..M...A.YC.AYWAAF....QFKV....HD................V.Y.VIYP...-SIADNA..SLCFNETF......LVRLLM...P.LC....FNF.L..LIS.GLSSTA......................................sETRV.DVAYG....H.vYRS........N...MD....IG..LLFGsyvnKL...LP.LMIP.FI------aaivff.............................................................................................................................................................................................................
W4ZD29_STRPU/8-168                   ...........................................................................................................te--ILCVFVLAAY.L......LHKY..GDW...R...KQHP....................................................AVTLATFISW..YFSLIIVF.MLPLDVTT..TFYLQC..mKaaetpivpgvtpaspplqqipttdlhakltqvghtd.........................................................................................savglgttnlmlnaslmnltgggedslrdrrsvaeeQCKKPW.S..YV....P...E.....D.I.LP.II...WKIVYWTTFVLTW................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------...................................................................................................................................................................................................................
U3JWR3_FICAL/17-297                  ............................................................................................................c-VFQAILIFCWV.Y......VRKY..QSR...R...ESEV....................................................ISTITAIFAL..AVALITSA.LLPVDIFL..VSYMKN..pNgtfkvw.....................................................................................................................................................adanvsR-----.-..QI....-...E.....D.T.VL.YG...YYTLYSIILFCVF................LW..IP.FVY.F....Y....Y........E........E.......K..D...E....D.D.GN...................................................-TC.S....QVKT..A...L...KYTL..G...F..I..TI..CA.VL..LL.........IGAF.V.P.LD.IPNK......Knstewekvkll......................................................................................feefgsshgltALSFSI..SS..LTVI.G.M.LAA....ITYTAYG.MSAL.......................................PLNLIKgtts...........asyeRL.ENT..EDIEEVEQH..LL..RIK...SK..CGD.G.R...PLSSR...DR...RTLHQ.L.EER.L..R.TLR...................................................................RRER..-H.LESIE-..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------kswwtkacea.........................................................................................................................................................................................................
S9V024_9TRYP/1-193                   .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.-M...WEVVLWMMAALAV................VI..CP.FLM.F....F....Y........E........A.......Y..D...P....E.K.PK...................................................-WKaN....RPRN..R...F...HVDY..F...R..I..FA..LV.TG..LC.........YWKV.G.V.SQ.IKFE......Afatgpqllpvtnagi.............................................................................lnngtyedatlvinvtFTTYCM..GM..LCFF.G.W.IFF....FFYGGVG.VTSYpirk...............................llafPKRVKRi.................gSS.RFT..QEMANILAK..AE..ALL...EL..SLQ.L.Q...KQCRS...RI...SR---.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------qnkskvniirne.......................................................................................................................................................................................................
M4A9N0_XIPMA/25-267                  .............................................................................................................LLFTCLYMVCYL.I......LTHF..KKT...A...EFITddied..........................................atvnkIALWLCTFTL..SVAVCAVL.LLPISILS..------...Nevl...........................................................................................................................................................ltfPHSYYM.E..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLV................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SK...................................................---.K....GVMA..R...V...YEAV..V...L..L..IL..LA.LL..VLg......ivWVAS.A.L.LH.DNVA......Rqsly...................................................................................................dlweyYLPYLY..SG..ISLF.G.V.LLL....LLCTPFG.LSRMfsvtg.............................sllvkPR----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------llediedtlsctvfeedslfrklncgspscwvklnmeam............................................................................................................................................................................
E9CCY3_CAPO3/425-628                 ..........................................................................trhqsvmapaverdqvlsslaaldrekhlihqhak------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................LGQSSHWL.R..RV...F...R...SISS....VCtslaVL....AL.S.G.YFMLQMAWNVLT..SIL........................................................-KP..GT....WP.LE.YateFA..F..G.V..A.-S.SS..S.ILGTv......gAVLDIV....LM.G..Y..F...L.GC.SILGIL....SSPW....--................F.R.RIRP..qRHNTSIE..LIILNCAG......FLLLSSs.lP.LL....SRI.L..GVT.NF----.......................................----.-DLLG....R..YAQ........F...DW....LK..SRLL....-L...VF.YNIM.FL------swtah..............................................................................................................................................................................................................
C5G8K1_AJEDR/21-504                  ............................................................................................................i-ALLVISILVLL.L......LRHY..LPL...R...STPA....................................................FLSLPVFLAL..ALPASVVL.LVPIDLTS..STKGDE..pS.................................................................................................................................................................----SG.I..WL....P...P.....R.V.ML.VS...-------------................VI..LP.LLG.E....Y....V........D........S.......G..Y...R....T.P.KD...................................................RIL.Y....SLRS..N...G...RYQL..I...V..L..GS..GI.AG..LV.........YISI.Q.-.NG.FDFT......S............................................................................................................IKALVM..AL..AYFW.G.L.ALA....IYLMGHG.LVVI.......................................PRTLIR...................NA.NPG..NKLRRLQAR..AP..RIY...DR..LTD.S.M...ADLED...LE...FQVSQ.L.RKR.K..T.GVP...................................................................HDLQ..EW.IDELVDm........................................................................................................................................tSI..PE.S.rLR.A.SA------.-SA..NDSRLS..--Vps.................................iiTTRYLADIT.R.RL.............................................GR.ARHQNARFTN.AWE...RLVREA..ADTQ....................................................................................................................SIIDSSASKrlefslpsfr.............................................................................................................................sspnksvtymTPTVRYYI.H..VH...I...L...PAAR....LI....LA....GF.F.S.LASACVVWSEIV..KSF........................................................-AP..RV....SI.VT.L...SV..V..H.N..P.-T.KS..E.PIGFl......gQVASAA....WI.F..Y..M...C.SA.AFVGIT....DARV....WG................N.R.ALVP...-RNTYSE..SACWYAGQ......IAKLTV...P.LS....YNF.L..TFL.PQDIQK.......................................KTTF.YHFLG....R.lINL........T...P-....LG..KGFD....YA...FP.IFIL.IPVCATLF...................................................................................................................................................................................................................
A3ABJ6_ORYSJ/88-521                  .........................................................................................................ekgg------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.IG.FF...WSWSYWSTFILTW................AV..VP.TIQ.G....Y....E........D........A.......G..D...F....T.V.KE...................................................RLK.T....SIHM..N...L...LFYS..I...V..G..AI..GL.FG..LI.........LLLV.M.H.RA.WDGG......-............................................................................................................IVGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PRNIWK...................NA.DWT..HRQKVLSHR..VA..KMA...VK..LDN.A.H...QEYSN...AI...VVAQA.T.SNQ.M..S.KRD...................................................................L-LR..PY.MDIIDK..........................................................................................................................................ML..AQ.M..LR.E.DPSFKPSG.GRL..GENDMD..YDT.....................................DDKTMATLR.R.QL.............................................RR.AHEEYYRCKS.EYM...TYVMEA..LELE....................................................................................................................DTIKNYERRdangwkfvssf...........................................................................................................................resrpgtlgslLDTMEFIW.R..CV...L...R...KQLQ....KG....FA....IV.L.G.CMSAAILLAEAT..LLP........................................................SGV..DL....SL.FS.I...LV..K..S.-..-.-V.GK..Q.EVLV........QVAAFV....PL.M..Y..M...C.IC.TYYSLF....QIGM....LM................F.Y.SLTP...-RQTSSV..SLLMICSM......VARYAP...P.IS....YNF.L..NLI.RLGGDA.......................................KTTF.EKRMG....N.iDDA........V...PF....FG..RGFN....RI...YP.LFMV.VYTLL---vas................................................................................................................................................................................................................
G5A2L2_PHYSP/13-279                  ...........................................................................................................ii--AVALLICNVY.I......LVYF..QHD...D...DKNTa..................................................yFPKALVVFGL..FFAEATVL.LLPLDVAN..------...Nstaigca..................................................................................................................................................egwntacgN-----.-..--....-...-.....I.N.MD.LL...WLMVFLSIVIFLV................VL..LP.FAI.Y....Y....Y........E........A.......D..D...G....E.D.NP...................................................--K.K....SQWG..E...A...IKME..V...G..T..VV..VA.AA..LIt......vlYITS.A.E.SN.VPMR......Alevnsmsatagfhayvdgttls................................................................tdvvdaasnvtvqhitltvdvsLPVYVT..GL..TSFV.G.W.FGF....SIFCGVG.LIAL.......................................PMDLIL...................AF.FHR..PKFI-----..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sadvyaiqklilqrrstelleigrsikqsmdrp..................................................................................................................................................................................
L5LFY6_MYODS/67-347                  .........................................................................................................tvga-----ILAFCWI.Y......VRKY..QSQ...R...ESEV....................................................VSTITAIFSL..AIALITSA.LLPVDIFL..VSYMKN..qNgtfk........................................................................................................................................................dwanaN----V.S..RQ....I...E.....D.T.VL.YG...YYTLYSVILFCVF................LW..IP.FVY.F....Y....Y........E........E.......K..D...D....D.D.TS...................................................K-C.T....QIKT..A...L...KYTL..G...F..A..VI..CA.LL..LL.........IGAF.V.P.LN.VPNN......Knstewekvkfl......................................................................................feelgsshglaALSFSI..SS..LTLI.G.M.LAA....ITYTAYG.MSAL.......................................PLNLIKgtrs...........aayeRL.ENT..EDIEEVEQH..IQ..SIK...SK..SKD.G.R...PLPAR...DK...HTLKQ.L.EER.L..R.TLR...................................................................K-RE..RR.LEFIEN..........................................................................................................................................SC..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------wtkfcgal...........................................................................................................................................................................................................
A4HM51_LEIBR/11-224                  ............................................................................................................v-VAILVLFLAVY.I......VFRY..SAE...E...EDGDa..................................................wLPRVLVIVTL..CVACYVVL.LLPLEVAL..TGDRPS...L.................................................................................................................................................................D-----.-..--....-...-.....-.-.FS.WA...WKGMLVSAYSLLF................VG..GP.FTF.V....F....Y........E........S.......W..S...P....T.Q.NSv................................................wtQVR.L....SLAV..V...V...GVNV..A...F..A..AA..FG.AL..WL.........WGAH.H.D.PK.DDIL.....tR............................................................................................................VPPFVY..FVvtISSF.G.W.CFF....FIFAGVG.LAAV.......................................PLRAVAafvn...........rphpIT.KAE..YELAR----..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------vklrmevqslldagrrldaqv..............................................................................................................................................................................................
L2G8F9_COLGN/19-517                  ............................................................................................................l-ALLSISVIVLF.I......LRHY..LPL...R...TTPA....................................................FYLVPIFFAL..WLPACMVL.LVPIDLAS..SARTDD...Eat.............................................................................................................................................................rgV-----.-..WL....P...Q.....R.M.LL.VS...WRITYWLTFALTW................FI..LP.ILG.E....Y....S........D........S.......G..Y...R....E.P.QD...................................................SLK.Y....SLRQ..N...A...QYHV..M...V..L..GT..AG.VG..LA.........YLFI.R.-.YQ.PSIT......T............................................................................................................LKTSFM..AL..AYFY.G.L.VFA....IYLMGHG.LVSI.......................................PRRLFR...................YS.SIS..GRLRRLQIR..AP..KLY...EK..MED.S.L...LNLED...VE...LQVSE.L.GRR.K..T.GSA...................................................................VKFS..EW.IDELVE..........................................................................................................................................SA..NL.P..ES.-.----HPRS.TMG..VAVESR.sLPTv...................................iTEKFMADLS.R.KL.............................................MR.ARHARSRYVN.EWN...DLLKEA..AETQ....................................................................................................................AILDSAASKklefgapspd.............................................................................................................................agfwdrftvhTPYTRYLY.Y..YH...C...E...PYGA....IF....LG....AF.L.A.VASALIVWSEVI..KAA........................................................-FP..QL....SV.IR.L...TV..V..H.H..W.VG.EK..G.QVGFa......gQVISVL....WL.L..Y..M...C.AA.TFTTMT....EVKT....WR................G.R.ALVR...-RNTAYE..SAFWYAGQ......VAKLSV...P.LS....YNF.M..TFL.SESIYS.......................................KTRF.YGFLG....Q.lIDF........T...P-....MG..RWAD....YL...FP.IFVL.VPVAATLF...................................................................................................................................................................................................................
G3YE86_ASPNA/17-512                  ............................................................................................................l-ALLTISVLVLL.L......LRRF..LTL...R...ATPA....................................................YLSIPVFLAL..ALPASVVL.LVPIDLAS..SSRDGG...G.................................................................................................................................................................P---TA.I..WL....P...D.....R.L.IL.VS...WRIAYWLIFVLTW................AI..LP.LLG.E....Y....I........D........S.......G..Y...R....E.P.KG...................................................RIQ.Y....SIRS..N...A...RYQL..I...V..L..CC..AT.VG..LI.........YISI.Q.-.NG.FEFT......S............................................................................................................IKTLVM..AL..AYVW.G.L.VLA....IYLMGHG.LVSI.......................................PRTLFR...................NS.NVS..GRLRRIQAH..AP..KLH...DR..LMD.A.I...NDLES...LE...SQVAQ.L.QRR.K..T.GTA...................................................................RDFQ..EW.IDELAE.........................................................................................................................................tSN..PP.E..LR.S.GLLEQADG.PG-..------..--Tip................................aviTERYLADLT.R.RL.............................................QR.ARHQKARFVD.EWD...RLVLSA..ADMQ....................................................................................................................AIINSSASKklefihsphr.............................................................................................................................sswlpslnflSPYMRYHL.Y..VH...V...I...PNVR....LG....LG....AV.F.S.AASVCVVWSELV..KSL........................................................-AP..RL....SV.VT.L...SV..V..S.Y..H.-K.EP..A.PVDFg......rQLIASA....WL.L..Y..M...C.SA.ALVGVN....DAKV....WG................N.R.ALVR...-RNTYGE..SACWYAGL......VARLTV...P.IA....YNF.L..TFL.PATVRQ.......................................STTF.YKFLG....R.fIDL........T...P-....LG..KGFD....YF...FP.VFIL.VPIGATLF...................................................................................................................................................................................................................
W5N502_LEPOC/8-189                   ............................................................................................................i-EIVVVFFLALF.L......LHRY..GDF...R...KQQK....................................................MVLFGTLLAW..YLCFLIVF.ILPLDVST..TIYKQC..kNeteahsavtlllanq..................................................................................................................................tagngsisptpslqrkVCTKPW.S..YI....P...D.....G.I.MP.IF...WRVVYWTSQCLTC................LY..LP.YLR.T....Y....C........H........G.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------tptqvavlsrthcfptlqceafaegtvmflqtacmsytvllpswklqall.................................................................................................................................................................
S8BTX0_9LAMI/14-490                  ............................................................................................................v-VCVLVFIFNVY.L......LVNY..QHP...D...DANQa..................................................yFPKFVVVLGL..SVAAISIL.MLPADVAN..--RQAC..rNaiyng......................................................................................................................................................acnltlP-----.-..--....-...-.....-.-.MR.SL...WLAVYIIDAVLVF................FV..IP.FAM.F....Y....Y........E........G.......D..L...D....K.S.VW...................................................---.-....KRMK..S...S...LVWV..I...V..T..AI..VC.AL..ALg......ilYGVI.G.K.VD.FTVM......Rlssttasfpsswdftssqpcigg..............................................................garqcsafsanssaettwtmrttFPEYVV..AL..ATIV.G.S.VLF....TIFGGIG.IACL.......................................PLGLIF...................S-.---..---FLRRPK..AV..ITR...SQ..YIR.E.A...TELGK...KA...KELKK.N.ADA.L..H.QEErng.............................................................skgRKW-..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................-RKNVKAVE.K.EL.............................................LL.LEEDVKALEE.MYP...QGEKA-..----....................................................................................................................---------.................................................................................................................................................---ETTWA.L..TV...L...G...YLAK....LI....LG....VI.G.L.IVSIAWIAHIVI..YLL........................................................INP..PL....SP.FL.N...EI..F..I.K..L.DD.VW..G.LLGT........-AAFAF....FC.F..Y..L...L.LA.VVSGAT....MLGL...kLV................F.I.TIHPm.kWGGTLMS..SFLFNVGL......ILLCS-...-.--....---.I..SVI.QFCATAfay.................................yaqATAA.QEIFG....H.tLES........L...RG....IK..YLYK...yNV...FQ.IGFV.ALA-----gvtfly.............................................................................................................................................................................................................
R7YJT6_CONA1/15-277                  ............................................................................................................v-AVAILVAIASV.F......VYVY..QKP...R...DRAA....................................................SVTIICIFTV..TALLATVL.LMPVDIAL..VSSTTL...Ssegrkkdw................................................................................................................................................atpdkidniV-----.-..--....-...-.....V.T.LK.IV...YYTLYSLDAVLCL................LV..IP.FTY.F....W....Y........E........S.......Y..D...D....D.A.AEqg...............................................tqTVG.S....RLWE..A...F...KYTI..A...F..V..FL..CV.IL..FLv......gfFIPA.A.K.NT.K---......Hsdhrnldyfk........................................................................................dlltenrgerALTFAL..GL..LITV.G.T.IVY....VIYTGSG.LALL.......................................PVSLIK...................S-.APA..ISTPALAAN..TA..TQL...EQ..NRE.R.Q...RQLE-...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------grnegrqngldsrdrrelealvre...........................................................................................................................................................................................
W2PZ14_PHYPN/13-276                  ...........................................................................................................ii--AVALLICNVY.I......LVYF..QHD...D...DKNTa..................................................yFPKALVIFGL..FFAEATVL.LLPLDVAN..------...Nst.............................................................................................................................................................aiGCAEGW.N..TV....C...G.....N.InMD.LL...WLMVFLSIIIFLV................VL..LP.FAI.F....Y....Y........E........A.......D..D...G....E.D.NP...................................................--K.K....SQWG..E...A...IKME..L...G..T..VF..VA.AA..LIt......vlYLTC.A.K.SS.VPMR......Alevnsmsdsegfqpyvdgttvs................................................................stivtvasnvtvqhitltvdvsLPVYVT..GL..TSFV.G.W.FGF....SIFCGIG.LIAL.......................................PMDLIL...................AF.FHR..PK-------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------fisadvyaiqklilqrrsvellevgrsikqsm...................................................................................................................................................................................
W5I709_WHEAT/2-365                   ......................................................................................................hhdwgga------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................ILGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKDIWR...................NA.DWT..RRQKILSHM..VA..KMT...VK..LDN.A.R...QEYCN...TI...TVVQA.T.SKQ.M..S.KRD...................................................................P-LR..PF.MDIIDN..........................................................................................................................................ML..AQ.M..LR.D.DPLFKLSG.GNK..LAENDM.dYDT.....................................DEKTMAALR.R.RL.............................................RI.AHEEYCRSKS.KYT...TSVMEA..LELE....................................................................................................................DTVTNYEQHdadgwkyvsdl...........................................................................................................................resrsgtlgsfLDHIEFIW.R..CI...L...L...NRLL....KV....LS....VL.L.G.CISAAILLAEAT..LLP........................................................TGV..HL....SL.FS.V...LI..N..A.V..G.--.-K..Q.EILV........QVVAFA....PL.M..Y..M...C.IC.TYYPLF....RIGM....ML................V.Y.SLTP...-GQTSSV..SLLMICSM......VARYAP...A.IS....YNF.L..NLV.HLGGDV.......................................RTTF.EKRMG....S.iDDA........V...PF....FG..RNFN....RI...YP.LIMV.VYTI----lva................................................................................................................................................................................................................
J9EHG3_9SPIT/1-222                   ............................................................................................................m------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...------TSAFFVV................VI..LP.FAL.F....Y....Y........E........S.......D..E...D....K.T.FK...................................................---.L....RLWT..A...L...KYEL..L...L..I..VI..VS.II..LFg.......sFAGL.R.Y.AQ.LPFI......Antckfalndsksffnadv.......................................................................nasssgcvrtdeelqitvsFPIYVI..GI..TCWL.G.W.FFL....IFFLGSG.LTAL.......................................PVDLIN...................QF.R--..-----FRPK..P-..MNE...VE..FNN.V.K...HELAK...KV...ERMLQ.I.GKA.L..L.EDK...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------trsdamsgfkgwkerravgrrqnefetncmlaekefqrldntaqyrnk...................................................................................................................................................................
X6MBN3_RETFI/1-386                   ............................................................................................................m------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..-A.IG..FF.........YLLF.T.-.TH.LSAA......R............................................................................................................VIALAQ..SL..GNLW.G.L.SLA....ILTVGYG.LVEI.......................................PRLLWY...................RS.NHK..KRTQYLMWR..LA..QLQ...SE..KDE.A.H...DRVDE...YV...YLFRY.F.EKK.F..Q.HKH...................................................................TFLQ..SQ.IAIVKDtli....................................................................................................................................hhqL-..--.-..YE.K.EIVSPDIT.QTK..IKED--..--Idk................................geiSEKLLAKIH.T.EL.............................................KI.WIFELERSES.WWY...KTAHDV..LILE....................................................................................................................LSLKQKQSLkrqsltnststkkqwkrdtsssfhrinssdangnhslhkskdhrsldndkkfklgrat............................kekvrseeenddededddnhvtndsnpqnrkdeaeesqlelhlnathqpsfdeirqlnaTAKMYWYA.H..IY...V...V...PVLQ....KV....FA....IA.F.G.ILSLVFIWSEIA..LAF........................................................-NI..HW....SI.FA.I...VA..N..E.F..D.VH.TL..Y.FYTI........YVYIIT....MC.I..Y..V...Y.M-.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------kyfl...............................................................................................................................................................................................................
C5L571_PERM5/3-130                   ..........................................................................................................eye------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....S.V.HS...................................................-IK.K....ALRN..N...A...IWYL..A...Y..A..CA..GL.LI..LA.........YLWY.M.-.QR.LGLQ......G............................................................................................................ILGFIY..AA..SNAW.G.L.VLV....TVLLGYG.LVAV.......................................PQWLHV...................LS.YDK..RHMEAIYAQ..VV..SAE...DA..RLS.A.K...FDLMD...VF...NHYRD.Q.ERE.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------sgqgaskql..........................................................................................................................................................................................................
A2G7G8_TRIVA/287-450                 .........................................................................................................gnpv------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...W...PWCE....LF....LG....II.C.I.IISLIWIIHIIV..YTF........................................................--L..DV....HP.FL.N...QF..F..H.L..L.DT.KF..A.LSAV........-IFFGL....FT.Y..Y..L...Y.LC.VLSGAT....SFGL...nLL................I.I.RVHPm.eDQNTPMN..SILFNSCL......MLFASFg.vA.LFs..tMNF.P..IYT.R-----.......................................LTAL.DMIYG....V.qMKY........L...KG....LK..YVWE....-Y...AI.YVFLgIFVIAL--av.................................................................................................................................................................................................................
I3LY14_SPETR/16-189                  ......................................................................................eqiyiitleeealqrrlnglsss------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................-------VE.Y.NI.............................................MD.LEQELENVKA.LKT...KLERRK..----....................................................................................................................---------.................................................................................................................................................--KASAWE.R..NL...V...Y...PAVM....IL....LL....IE.T.A.ISVLLVACNILC..LLV........................................................-DE..TA....MP.KG.A...RG..P..G.I..G.NA.SL..S.TFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.NFTP..rKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------...................................................................................................................................................................................................................
M3WUU2_FELCA/23-301                  ............................................................................................................l-LLLAILAFCWI.Y......VRKY..QSQ...R...ESEV....................................................VSTITAIFSL..AIALITSA.LLPVDIFL..VSYMKN..qNgtfk........................................................................................................................................................dwanaN----V.S..RQ....I...E.....D.T.VL.YG...YYTLYSVILFCVF................FW..IP.FVY.F....Y....Y........E........E.......K..D...D....D.D.TS...................................................K-C.T....QIKT..A...F...KYTL..G...F..A..VI..CA.LL..LL.........VGAF.V.P.LN.VPNN......Knstewekvkfl......................................................................................feelgsshglaALSFSI..SS..LTLI.G.M.LAA....ITYTAYG.MSAL.......................................PLNLIKgtrs...........aayeRL.ENT..EDIEEVEQH..IQ..TIK...SK..SKD.G.R...PLPSR...DK...RALKQ.F.EER.L..R.TLR...................................................................K-RE..RH.LE----..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------fienswwtkfc........................................................................................................................................................................................................
F7CGT0_ORNAN/115-324                 ....................................................................................yiitleeealqrrlngvsssveynt------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................SE.LERELVNVKA.---...------..----....................................................................................................................--MKSKLER.................................................................................................................................................RKKASAWE.R..NL...V...Y...PAVM....IL....LL....IE.T.A.ISVLLVACNILC..LLI........................................................-DE..TA....MP.KG.S...RG..P..G.I..G.NA.SL..S.TFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.SFTP..rKDDTTMTkkQIIGNCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAIVTTLC...................................................................................................................................................................................................................
W9MYJ5_FUSOX/19-520                  ............................................................................................................i-ALVVISLVVLL.I......LRYY..LPL...R...TTPA....................................................FYLIPIFFAL..WLPTIVVI.LVPVDLAS..SAVTGD...-.................................................................................................................................................................-EESRG.I..WL....P...E.....R.V.IL.VS...WRISYWLTFALTW................FI..LP.ILA.E....Y....S........D........S.......G..Y...R....E.P.YD...................................................KFM.Y....SVRS..N...A...QFHA..I...V..L..GF..GF.VG..LI........yYVIS.S.G.FS.FKVD......V............................................................................................................IKGTIM..AL..AYCW.G.L.ILA....IYLMGHG.LVSI.......................................PRRLMR...................GA.SIS..GRLRRLQSK..AP..KVY...EE..MED.S.I...TKLED...IE...VQVAE.L.GRR.K..T.GSA...................................................................NTYR..DW.IEELQE..........................................................................................................................................MA..NL.P..ES.Q.PRGTRFGS.SSD..--NN--..--Iip................................hviTEKYLADLT.R.KY.............................................VR.ARHARSRYVN.AWS...DLVQEA..AETQ....................................................................................................................AILDSAASKkldfgevsph.............................................................................................................................atfwektailTPYTRYLY.Y..YQ...I...L...PYAQ....VL....LG....LF.L.A.AASACIVWSEVV..KFA........................................................-FP..KL....SI.IR.L...TV..V..H.H..W.VG.DK..P.EVGFa......gQAISSF....WI.C..Y..M...C.AA.ALISMT....EVKV....WR................G.R.ALVR...-RNTAHE..SAFWYAMQ......VAKLTI...P.IS....YNF.I..TFL.SSQVYN.......................................KTVF.YHFLG....Q.lIDF........T...P-....LG..RYFD....DL...FP.VVVL.FPVFATLF...................................................................................................................................................................................................................
A2G7G8_TRIVA/11-285                  ...........................................................................................................ii-FCILSILVGIY.L......VVRF..QMP...E...DKKSs..................................................wFIKIIIILTI..GISVMNVL.ILPLDALN..---RST..pN.................................................................................................................................................................P-----.-..--....-...M.....N.T.TL.MC...W-ILTIISAVLAF................IV..IP.FTL.T....Y....Y........E.......nA.......E..D...E....D.V.KH...................................................PIC.K....AT--..-...-...LSVI..P...F..L..LF..FI.IF..LLi.......lYFLV.S.D.CQ.IPAT.....iHagkvvdeselttsi................................................................................yscststtidiklsPLIFVV..TV..IGFI.G.Y.IIL....IILGGMG.FATL.......................................PINLFI...................DF.VRRprPISLKQYAK..GQ..Q--...-L..INR.W.A...EELIE...EG...NKIRE.E.GKH.K..G.YKN...................................................................RKVK..RM.VNKYAD..........................................................................................................................................QI..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------enmerayqlievsykvr..................................................................................................................................................................................................
G1SF20_RABIT/26-283                  .............................................................................................................LLFAILYIVSYF.I......ITRY..KRK...S...DEQEdeda............................................ivnrISLFLSTFTL..AVSAGAVL.LLPFSIIS..------...Neil...........................................................................................................................................................lsfPQNYYI.Q..WL....N...G.....S.L.IH.GL...WNLASLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................---.K....GIRA..R...I...LETL..V...M..L..LL..LA.LL..ILg......ivWVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRMftvmg.............................qllvkPTILEDld...............eqIY.IIT..LEEEALQRR..LS..GLS...SS..VEY.N.I...MELEL...EL...ENVKT.L.KTK.L..E.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------rrk................................................................................................................................................................................................................
D4DJN3_TRIVH/15-276                  ............................................................................................................v-VVAILIAIASV.F......VYVY..QAP...R...ERSG....................................................LVSAVCILTV..SALLATVL.LLPVDIAL..-ISSTN..sRklgqrkd..................................................................................................................................................watpdvvaS-----.-..-I....V...Q.....-.S.LT.IV...YYSLYSLDTILCL................LV..IP.FTY.F....W....Y........Eey...delA.......E..Q...Q....D.W.NA...................................................-FG.K....RFWG..A...F...RYTI..A...F..L..VV..TV.IL..FL.........VGFF.V.-.PV.ARNR......Agagldldyfk........................................................................................hlltenngerALTFAL..GL..LTMI.G.I.IVY....VLYTSAG.LALF.......................................PVSFIK...................T-.APS..VSSPSLYAT..TA..SRL...EE..NVE.R.Q...RQLEG...R-...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------cggnldhlsskerreldslvre.............................................................................................................................................................................................
G1KKY1_ANOCA/253-444                 .......................................................................................................issple------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.Y.NT.............................................KQ.LEQELNNVKR.MKT...KLERRK..----....................................................................................................................---------.................................................................................................................................................--KASAWE.R..NL...V...Y...PTVM....IL....LL....TK.T.A.ISVLLVACNILC..LLV........................................................-DE..TA....MP.KG.S...RG..P..G.I..G.NA.SL..S.TFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRF....--................F.G.DFTP..rKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAILTTL-s..................................................................................................................................................................................................................
LMBD2_DROPS/7-540                    ...........................................................................................................fg--IIAALCLASI.S......LYRY..GNI...P...RQHI....................................................LVTLSVLTAW..CFSFLIVF.TIPLDVTS..TLYRQCl.aEhklaldaagn............................................................................................................................................asttanitpppECQEPW.G..MV....P...E.....S.V.FP.NL...WRIIYWSSQFLTW................LI..MP.LMQ.S....Y....L........K........A.......G..D...F....T.I.KG...................................................KLK.S....ALIE..N...A...IYYG..S...Y..L..FI..CG.VL..LI.........YIAV.K.G.VP.LDWQ......K............................................................................................................LKAIAS..SA..SNTW.G.L.FLL....ILLLGYA.LVEV.......................................PRSLWN...................NA.KPG..FTLQYAYFK..AA..KLS...TD..KAE.A.E...EHVDD...IL...ESLQC.I.SRV.V..P.NNH...................................................................-ELR..PC.VETIMR..........................................................................................................................................KV..PI.E..LQ.E.RASRNFSR.TGG..SGMGAT..SSTi..................................lpSEKALVRIH.K.QV.............................................IK.SLQTLQRTEA.LWS...VQVDTV..LHLE....................................................................................................................DVARNIHSAerrfksefpr.............................................................................................................................qrtqlerifySATLQWYW.E..CL...L...K...APFL....KT....LC....VV.T.A.TMSAMVVWSEVT..FFS........................................................RDP..VL....SI.FA.N...VI..-..Y.L..A.KE.SY..D.FFTI........EVFSMM....VL.C..Y..F...F.YC.TYSTIL....RIRF....LN................L.Y.YLAP...HHQTNEH..SLIFSGML......LCRLTP...P.MC....LNF.L..GLI.HMDSHIipe.................................rmmETYY.TRIMG....H..MDV........I...GI....IS..NGFN....IY...FP.MCML.AFCLSTWF...................................................................................................................................................................................................................
E3QCK2_COLGM/19-516                  ............................................................................................................l-ALLLISVIVLL.I......LRHF..LPL...R...TTPA....................................................FYLVPIFFAL..WLPACMVL.LVPIDLAS..SARTDD...Eat.............................................................................................................................................................rgI-----.-..WL....P...Q.....R.L.LL.VS...WRITYWLTFALTW................FI..LP.ILG.E....Y....S........D........S.......G..Y...R....E.P.ND...................................................CLK.Y....SLRQ..N...A...QYHA..M...V..L..GT..AA.VG..LA.........YLFI.R.-.YN.PSPT......T............................................................................................................LKTSFM..AL..AYFY.G.L.VFA....IYLMGHG.LVAV.......................................PRRLFR...................YS.SIS..GRLRRLQIR..AP..KLY...EK..MED.S.L...LNLED...IE...LQVSE.L.GRR.K..T.GSA...................................................................VKFS..EW.IDELVE..........................................................................................................................................SA..NM.P..ES.Q.PR------.TAV..GSVDSR.aLPTv...................................iTEKFMADLS.R.RL.............................................MR.ARHARSRYVN.DWN...DLLKEA..SETQ....................................................................................................................AILDSAASKklefsspsph.............................................................................................................................agfwdrftihTPYTRYLY.Y..YH...F...E...PYAC....IA....LG....AF.L.A.VASALIIWSEVI..KAA........................................................-FP..QL....SV.IR.L...TV..V..H.H..W.VG.EK..G.QVGFa......gQLISVL....WL.L..Y..M...C.AA.TFITMT....EVKT....WR................G.R.ALVR...-RNTAYE..SAFWYSGQ......VAKLSV...P.LS....YNF.M..TFL.SRDIYQ.......................................KTRF.YSFLG....Q.lIDF........T...A-....MG..RWAD....YL...FP.IFVL.LPVAATLF...................................................................................................................................................................................................................
A8NST7_BRUMA/26-262                  .............................................................................................................LLFICLYLISYS.I......IRIL..KER...S...DNDElyagge........................................dffvfrVSLWMCTWSL..AVSMGAAT.LLPFSVIG..SEII--...Qa...............................................................................................................................................................yPDSYYF.Q..WL....N...W.....P.L.IH.SL...WNYIFALSNLSLF................IL..LP.FAY.F....F....I........E........S.......Q..G...F....K.G.HG...................................................---.K....GIMT..R...V...YETV..A...V..C..IL..LI.IV..LIc......laDVVY.S.L.FL.TESD......Sislsi.................................................................................................ltftsvNLPFLY..SC..VSLL.G.V.LTL....LITTPIG.LARMfs...................................vvS-----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------nhllatehqkiidpleeaifrleyqtlkrrlrrnnl...............................................................................................................................................................................
F4P8T4_BATDJ/331-539                 .............................................................................kryrviknrerqfrkdviildyhykkleecyr------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................-----FQS.G..NI...L...L...QYIK....LF....LA....CL.S.T.LLTLLWTIHIGL..YVIpsll...............................................qqrgqAVN..PV....SP.FL.N...DM..-..L.N..L.TQ.GV..P.VVGI........-FLYAL....FT.F..Y..L...L.FC.VLKGNA....KLGM...rLV................F.I.TVHPl.vVGETLMS..GLVFNAGI......ILLCSL...P.LA....---.-..---.QFCNVAfag.................................yaqYTSN.QSIFG....V.sIST........L...KG....IS..VGFD....VC...VY.VMLG.FMVITF--fy.................................................................................................................................................................................................................
F0YBA6_AURAN/286-817                 .........................................................................................................lsvv--WVFLFVGVVY.F......LYAT..ADR...R...LVPL....................................................HTIVLVGLGA..FSMVAILT.VGPFDVAL..TLVGRR..sDsdstr.......................................................................................................................................................vdsfeR-----.-..--....H...S.....K.V.LR.KM...YVDVYWICFAMSL................AG..LP.YAE.E....Y....D........A........S.......G..H...V....A.A.LG...................................................KLL.D....SGRR..M...A...VMWL..A...M..G..LG..GL.LF..LG.........LVLG.S.G.EV.ESAD......A............................................................................................................FNVTLI..AC..SNTA.N.S.LVL....VLLLGVG.AVEL.......................................PKALWI...................AG.DAD..RDLARCYTA..AA..CEF...AN..LKE.A.S...VACSN...AA...GDAIK.T.LEA.V..D.KGRareakrgagg...............................................dlsffaaffdV---..--.---SLE..........................................................................................................................................AC..AA.A..LR.E.DCAALGAD.GFR..SGAAGA.aAINkrt...............................gdtDADAVADCR.R.RL.............................................AA.ARAAYASALG.AVD...KIKART..FYLE....................................................................................................................DLVKSRDAGtvaws.......................................................................................................................................fgappSTRNGWLW.H..CR...G...K...PILL....KC....AA....VC.A.A.VASACLLVSQIG..AATan....................................................tsAAL..DC....SA.FA.V...MA..-..R.S..G.AR.RN..G.DSGA........AAASLL....CL.T..Y..M...VgVCgTAMGLV....KLRG....--................F.L.DVNT...SKKTPPK..VLCFATRN......CGKLAA...P.LL....YNY.L..ATL.HE----.......................................----.-----....-..---........-...--....--..----....--...--.----.--------vgssaappplhdddarrdmrlafdrfysakmdavtphfdrvaaslvvvvallh..............................................................................................................................................................
S0DWL4_GIBF5/17-255                  ...........................................................................................................av-AVVLCFAAAII.T......TFTW..QTP...R...ERSA....................................................VVSIVAIVSL..TSLLATVL.LLPVDIAL..VSATAS...Atlgakkdw................................................................................................................................................atperidsiL-----.-..--....-...-.....Y.T.LK.VV...YYSLYSFDALLCL................IV..IP.FAY.F....W....H........E........E.......Y..D...E....I.E.VEee...............................................grTLS.S....RFLA..A...A...KYTL..F...F..V..AF..VV.VL..FLl.......gFFVP.A.-.-A.----......Gdsseshwdldy.....................................................................................fkklvaqnhgekALTFAL..GL..LLTL.G.T.LLY....VVYTGAG.LALL.......................................PISFIKa................apS-.ISG..PQLHQN---..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------tasqleqnrerqrqie...................................................................................................................................................................................................
W7FR96_PLAFA/10-153                  ............................................................................................................v-AFILLIFISSW.I.....fYNYF..VNY...H...ESTI....................................................LAALTFIISL..STCFILVL.FIPIDIYL..-VSNGN..lEis.............................................................................................................................................................hlE-----.-..-I....T...Q.....K.V.IS.KF...YHSMFWVLIFEAY................VL..VP.FSY.F....Y....L........K........N.......K..K...S....Y.K.NEfddn..........................................vvpfeNTI.E....SLKK..T...I...YFIL..L...L..I..VL..SI.IG..LI.........Y---.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------rpgh...............................................................................................................................................................................................................
C4LUH4_ENTHI/7-480                   .............................................................................................................LLVAILSIIILL.L......MFQF..IDP...L...KTKW....................................................YVTFFVFLGW..GMSFAIPI.LLPIDISS..SLFDKC..vEqq.............................................................................................................................................................nkVCDEPF.T..YV....D...K.....K.T.LV.VL...WNLLYWGTTILCW................TA..IP.FLQ.S....Y....C........S........A.......G..D...F....H.V.LE...................................................RIK.T....SLRE..N...I...IFYL..V...V..G..FV..CG.VF..LI.........LFLI.W.N.--.-ENG......D............................................................................................................WLGIAI..AA..ANAW.G.L.IMV....IGMMGYG.IVAV.......................................PARLIK...................NI.SSK..HYLNSLYSE..IN..DLT...EE..HEE.E.E...GILSE...LI...TLVKK.A.DEI.I..P.ITD...................................................................P-MR..KC.VLIIIN..........................................................................................................................................EI..DP.K..RY.E.A-------.---..TEPSRD..FVK.....................................SYENLSELH.A.NI.............................................QF.QQLKVKQIFY.TLH...SNVDQV..LKYE....................................................................................................................SINNKK---.................................................................................................................................................APLFQRIY.F..NV...I...K...KIVS....VI....AL....IL.F.I.IYSLTVFSSELL..LPF........................................................NLP..IL....SP.LY.Y...II..Q..S.I..E.SS.AF..L.LL--........-IVITV....FV.I..Y..I...A.WC.VYQTLI....SMKL....FD................Y.Y.QLFN...NRLSDPG..SMLFSAAY......LCRLCA...P.LA....LNI.L..HMI.KFDGVHfn...................................gtQTAF.QSVMS....S..MED........I...PF....FG.qNSFN....DF...FP.VCIV.IVSAF---sll................................................................................................................................................................................................................
H2U0U7_TAKRU/247-447                 ............................................................................................lsrklnsstascwvkmn------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.-ME...AMQKE-..--YQ....................................................................................................................AVHNKRLSLe...............................................................................................................................................mRRKASPWQ.R..NL...G...Y...PLAM....LT....LL....AL.T.V.MCVLMVCINVLE..LLL........................................................-DE..AA....LP.RG.M...ED..P..H.L..G.MA.SF..S.MFGSl......gAAVQVL....LI.L..Y..L...M.VS.SVVGFY....SSPF....--................F.T.GILP..rAKDTNLT..QIIANCMS......LLILSSa.lP.VF....SRI.I..GIT.RF----.......................................----.-DLLG....D..FGR........Y...NW....LG..-NFY....VV...FL.YNMM.FAGLTS--as.................................................................................................................................................................................................................
A4I1F8_LEIIN/8-278                   .......................................................................................................vlivlv--ALVCVGLTIY.T......FIYF..QSE...E...DSKWd..................................................yVPKAVAGLGL..ILAMGSIL.LVPYDVAN..------...Spd.............................................................................................................................................................ptVAHKYV.Q..TL....N...-.....-.-.TQ.LM...WEIVLWMMAVMAV................VV..CP.FFM.F....F....Y........E........A.......Y..D...P....D.K.PS...................................................-FG.T....QVSH..G...V...ISTV..I...I..A..FL..FA.LI..VGl.......cYHFQ.G.V.AD.IAFQ......Aykgnpqmalpessti.............................................................................syvgnsikstitvsvsIYTYCI..GM..LCFF.G.W.IFF....FFYGGAG.IVAY.......................................PMSLIQ...................NF.KSR..P----KAIG..AS..RFA...EE..MAI.I.L...AKADA...ML...ELCTG.L.QQE.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------srgsisrstknkinilrnevy..............................................................................................................................................................................................
W3X9A5_9PEZI/26-267                  ............................................................................................................v-AVVLALFVGAL.V......TFTW..QAH...R...DRSA....................................................VVSAVTMISL..TALLATIL.LLPVDIAL..VSSTTD...Talgvkkdw.................................................................................................................................................atstrihnI-----.-..--....-...L.....N.T.LR.IV...YYSLYSFDALLCL................VV..IP.FSY.F....W....Yee....ydE........V.......E..E...Q....E.G.NQ...................................................TFG.S....RLWG..A...F...KYTI..A...F..I..LL..VV.II..FL.........IGFF.V.-.PA.AGNR......Egkhldldffk........................................................................................rlldenhgekALTFGI..GL..LITL.G.T.LLY....VLYTGAG.LALL.......................................PVSFIK...................S-.APS..ISAPQLSEN..TA..SQL...EQ..NRE.R.Q...RQL--...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------emrna..............................................................................................................................................................................................................
J9HY79_9SPIT/327-434                 ..........................................................................................................tya------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........ELASLI....PL.V..Y..L...V.AA.TNYGLF....QLKV....SN................I.Y.ALHK...NKSTDPS..CLLFSSIF......VMRLAV...P.IS....YNF.L..QLT.QMN---.......................................DAAV.YRVMG....P..VRY........V...KF....LG..EGFN...qWV...FP.VCLV.LMVVLTAF...................................................................................................................................................................................................................
C9SY77_VERA1/18-264                  ...........................................................................................................av--IALCLLIASI.T......TFTW..QAP...R...DRSA....................................................LVSTVAIVSL..TALLATIL.LLPVDIAL..VSSTTS...Atlgvkkdw.................................................................................................................................................atesrvhnI-----.-..--....-...L.....Q.T.LR.IV...YYSLYSFDALLCL................LV..IP.FTY.F....F....Y........Eey....deI.......E..D...E....E.G.TR...................................................PFA.A....RLVS..A...L...KYTA..V...F..V..AL..VL.IL..FL.........VGFF.V.-.PA.AGHD......Skagwdldyfq........................................................................................rllaenngqkALAFTL..GL..LVTL.G.T.LLY....VVYTAAG.LALL.......................................PMSFIK...................S-.APA..ISAPQLTES..TA..TAL...EQ..NQE.R.Q...RQLE-...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------mrnagrqdg..........................................................................................................................................................................................................
W5I732_WHEAT/1-408                   .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.MK.TL...WLVVYIIDAVLVF................LV..IP.FAM.F....Y....Y........E........G.......D..Q...D....K.S.VG...................................................---.-....KRLK..S...A...LIWV..V...A..S..AV..VC.GL..VLg......ilYALI.G.K.VD.FTVR......Hlsssvqafpnpnqfgaftsgqpci...........................................................apltrqcsantappnsqttwtmratFPEYVV..AL..ATIV.G.S.VLF....TIFGGVG.IACL.......................................PLSLIF...................S-.---..---FVRRPK..AV..ITR...SQ..YIK.E.A...TELGK...KA...KELKK.A.AEA.L..H.QEE...................................................................RSGN..--.------..........................................................................................................................................--..--.-..--.-.-----KGR.KWR..------..---.....................................--KNVKAVE.K.EL.............................................LL.LENDMNALEE.MYP...QGEKAE..----....................................................................................................................---------.................................................................................................................................................----ATWA.F..TV...L...A...YIGK....LI....FG....IV.G.L.IVSIAWVAHIII..YLL........................................................VDP..PL....SS.FL.N...EI..F..I.K..L.DS.VW..G.LLGT........-AAFAF....FC.F..Y..L...L.IA.VIAGEM....MLGL...kLV................F.I.TIHPm.kWGGTLMN..SFLFNVGL......ILLCS-...-.--....---.I..SVI.QFCATAfay.................................yaqATAA.QEIFG....H.tLQS........L...RG....IK..YLYK...yNV...FQ.YGFV.ALAILTLF...................................................................................................................................................................................................................
U6H622_9EIME/57-352                  ntrpkpggiaarrrraqqqlqqlqqqqqqqqqaaaadpqpgeaaaaaaadatqqqrtaaaarpppppppsasppptaaaagagaaaaaaggggaaaaeskgeiihrkcs------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...---EK...HH...RKMQQ.M.QQQ.M..Q.QQQ...................................................................QQQQ.mQH.QQQHKH..........................................................................................................................................QQ..QQ.H..HQ.E.QHQHQQQQ.HHQ..------..---.....................................EQQQHHHLQ.Q.QQ.............................................QQ.QHQQHHQQQQ.EQQ...QQQQQH..QQHQ....................................................................................................................HHQQQQEQHhhhqqqqqqqq...........................................................................................................................eqqqeerrmhgQYQILLLM.L..LL...L...M...VLLL....MV....LL....LL.M.M.VLLVVVVVMVVV..VVM........................................................-RS..P-....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------ytcyaedaaaaaaaaaaataataaaa.........................................................................................................................................................................................
M3TWQ5_ENTHI/1-171                   .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.-MV....IGMMGYG.IVAV.......................................PARLIK...................NI.SSK..HYLNSLYSE..IN..DLT...EE..HEE.E.E...GILSE...LI...TLVKK.A.DEI.I..P.ITD...................................................................P-MR..KC.VLIIIN..........................................................................................................................................EI..DP.K..RY.E.A-------.---..TEPSRD..FVK.....................................SYENLSELH.A.NI.............................................QF.QQLKVKQIFY.TLH...SNVDQV..LKYE....................................................................................................................SINNKKA--.................................................................................................................................................-PLFQRIY.F..NV...I...K...KIVS....VI....AL....IL.F.I.IYSLTV------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------fs.................................................................................................................................................................................................................
F1L9B3_ASCSU/1-87                    .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...M.VA.SLVGVY....SVPL....--................L.R.RLRP..rKGKTTMT..FIIANCTT......VLVLSSa.lP.VL....ART.L..GIT.TF----.......................................----.-DLLG....A..YGS........F...NW....LS..-NFT....LV...WT.YNVA.FAIATVS-c..................................................................................................................................................................................................................
A2YAR5_ORYSI/201-689                 ..................................................................................................llslpltvgmv----------VA.T......LRYF..AG-...P...AVPL....................................................HVLATVGYAW..LCSLSFIV.LVPADIST..TITGSQ...E................................................................................................................................................................gD-----.-..--....-...-.....-.-.VG.FF...WSWTYWSTFFLSW................SI..VP.TLQ.G....Y....E........D........A.......G..D...F....T.V.KE...................................................RLK.T....SIHK..N...L...VYYK..I...I..G..SI..GL.VG..VI.........LIIT.M.R.HD.WAGG......-............................................................................................................IMGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PKNIWK...................TA.DWT..RRQKFLYHR..IA..NMA...GK..FDN.A.H...QEYCH...AI...AVVQA.T.SKQ.M..T.KRE...................................................................P-LR..PF.MDIIDD..........................................................................................................................................ML..AQ.M..LR.D.DPLFKPSG.GKL..GEDDMD..YDT.....................................DENTMASLR.R.QL.............................................RR.ANEEYYRCKS.KYT...SYVMEA..LELE....................................................................................................................DTIKNYEQRdanewkyvsgl...........................................................................................................................resrsctlgsfLDFIEFIW.R..CI...L...R...KQLL....KV....LA....VI.L.G.CISAAILLAEPT..LLP........................................................SDV..DL....SL.FS.V...LT..N..V.V..G.--.-K..Q.EVLV........QVVAFI....PL.M..Y..M...C.IC.TYYSLF....RIGM....MV................V.Y.SLTP...-RQTSSV..SLLMICSM......VARYAA...P.IS....YNF.L..NLI.HLGGNS.......................................KTTF.EKRMG....N.iDDV........V...PF....FG..RSFN....RI...YP.LIMV.VYTL----lva................................................................................................................................................................................................................
A0A024R0Z6_HUMAN/48-268              ......................................................................................................vddedat------------.-......----..---...-...-VNK....................................................IALELCTFTL..AIALGAVL.LLPFSIIS..------...Nevl...........................................................................................................................................................lslPRNYYI.Q..WL....N...G.....S.L.IH.GL...WNLVFLFSNLSLI................FL..MP.FAY.F....F....T........E........S.......E..G...F....A.G.SR...................................................---.K....GVLG..R...V...YETV..V...M..L..ML..LT.LL..VLg......mvWVAS.A.I.VD.KNKA......Nresly..................................................................................................dfweyYLPYLY..SC..ISFL.G.V.LLL....LVCTPLG.LARMfsvtgkllvkprl.............ledleeqlycsafE-----...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------eaaltrricnptscwlpldmellhrq.........................................................................................................................................................................................
F1P229_CHICK/13-271                  .............................................................................................................LLFAVLYIVSYF.I......ITRY..KRK...A...DEQEdeda............................................ivnrISLFLSTFTL..AVSAGAVL.LLPFSIIS..------...Neil...........................................................................................................................................................lsfPQNYYI.Q..WL....N...G.....S.L.IH.GL...WNLASLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................---.K....GIRA..R...I...LETL..V...M..L..IL..LA.LL..ILg......ivWVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRMftvmg.............................qllvkPTILEDld...............eqMY.IIT..LEEEAIQRK..LN..GIS...ST..LEN.Q.T...VELER...EL...EKVKC.K.KTN.L..E.RR-...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------kk.................................................................................................................................................................................................................
Q2TM95_NICSY/6-99                    ......................................................................................................lislplt-------LGMVL.V......TLRY..FAG...P...DVPR....................................................YVLFTVGYAW..FCSLSIII.LVPADIWT..TIIGHE..kG.................................................................................................................................................................G-----.-..--....-...-.....-.-.IA.FF...WSWSYWSTFVLTW................AV..VP.TIQ.G....F....E........D........A.......G..D...F....T.V.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------...................................................................................................................................................................................................................
YC8B_SCHPO/61-498                    ..........................................................................................................lll-LLLIPALFTLI.W......IYKY..IEP...H...SLIS....................................................IPGIFVFLGL..YVPFVVTL.LIPIDVTW..------...-.................................................................................................................................................................------.-..--....-...-.....D.V.SL.SI...WRFLYWLTFVLSW................II..LP.FVQ.G....Y....M........E........S.......K..F...S....T.P.RS...................................................RLS.D....SFYK..N...L...RYYL..L...L..T..FL..TC.VV..IA.........YLRF.A.L.RT.MSFS......N............................................................................................................FKELVI..SL..TYFW.G.L.LFV....IFLLGNG.FVYV.......................................PVSMWK...................KA.FIT..KRAALLERQ..AV..GVY...SK..LQA.R.L...ESYSL...PS...SSISL.N.NGR.N..Q.SSS...................................................................-DFF..--.------..........................................................................................................................................--..TS.-..--.-.--------.---..------..---.....................................SLTDHAFNP.H.SS.............................................PN.GMSNVIALQT.TWN...QMVKEYnrIMLI....................................................................................................................KTAKASGSYrlylp......................................................................................................................................dsyipiHPVVAYAF.Y..VW...I...L...PAFR....IL....FS....IF.M.A.SMSVIIVVSEVF..L--........................................................-HT..QY....SL.VG.I...IL..Q..K.F..T.NS.SA..T.SIFV........---SFL....FV.Y..Y..M...R.YC.TYKSLM....RTQFa..pHY................Y.Y.ALVP...FRATNTA..SLIYFASQ......LCRLTL...P.LC....YNF.V..SLQ.PY----.......................................PTQF.HQFYG....E.sIDL........L...P-....LG..NLIS....KR...YP.TFIL.LPIIFS--mi.................................................................................................................................................................................................................
K3XVJ1_SETIT/7-494                   ................................................................................................islpltvgmvaat------------.-......LRYF..AG-...P...AVPA....................................................RVLAVVGYAW..LCSLSFVV.LVPTDIWM..AISGNQ..kS.................................................................................................................................................................D-----.-..--....-...-.....-.-.VG.FF...WSWSYWSTFILAW................SI..VP.TLQ.G....Y....E........D........S.......G..D...F....T.F.KE...................................................RLK.T....SIQK..N...M...TYYA..T...V..G..ST..GL.FG..LI.........LIIV.M.R.HD.W-VR......G............................................................................................................ILGFAM..AC..SNTF.G.L.VTG....AFLLGFG.LSEI.......................................PRNIWR...................NA.DWT..LRLQFLSHK..VA..KMA...KE..LDH.A.Q...QEYCS...AI...FVVQA.T.SNQ.M..S.KRD...................................................................P-LR..PC.MDIIDN..........................................................................................................................................ML..AR.M..LQ.D.DAAFKPSG.GKL..GENDMD..YDT.....................................DNKTMATLR.R.QL.............................................RR.AHEEYYRRKS.DYM...NCVMEA..LELE....................................................................................................................DTIRNYEQRdasgwkylssf...........................................................................................................................renrsgtlgsfLDSTEFFW.R..CL...L...R...KQLV....RV....LS....VI.L.G.CTSASILLAEAT..LLP........................................................SNV..DL....SL.FS.N...LI..N..A.V..G.--.-K..H.EVLV........QVAAFV....PL.M..Y..M...C.IC.TYYSLF....RIGM....ML................F.Y.SLTP...-GQTSSV..SLLMICSM......VARYAP...P.IS....YNF.L..NLI.HLGGNA.......................................KTTF.EKRMG....N.iDDV........V...PF....FG..RTFN....KI...YP.LIMV.VYTLL---va.................................................................................................................................................................................................................
L8I748_9CETA/4-459                   .............................................................................................................LIFAILYIVSYF.I......ITRY..KRK...S...DEQEdeda............................................ivnrISLFLSTFTL..AVSAGAVL.LLPFSIIS..------...Neil...........................................................................................................................................................lsfPQNYYI.Q..WL....N...G.....S.L.IH.GL...WNLASLFSNLCLF................VL..MP.FAF.F....F....L........E........S.......E..G...F....A.G.LK...................................................---.K....GIRA..R...I...LETL..V...M..L..IL..LA.LL..ILg......ivWVAS.A.L.ID.NDAA......Smesly..................................................................................................dlwefYLPYLY..SC..ISLM.G.C.LLL....LLCTPVG.LSRM.......................................F-T---...................--.---..-VMGQLLV-..--..---...--..KPT.I.L...EDLDE...QI...YIITL.E.EEA.L..Q.---...................................................................RRLS..--.-EGGVAr........................................................................................................................................gKA..PE.P..RS.A.GG---LQK.PVL..SGVCRG.rSPAp..................................ppGLSSSVEY-.-.NV.............................................TE.LEQELENVKI.LKK...KLERRK..----....................................................................................................................---------.................................................................................................................................................--KASAWE.R..NL...V...Y...PAVM....VL....LL....IE.T.S.ISVLLVACNILC..LLV........................................................-DE..TA....MP.KG.T...RG..P..G.I..G.NA.SL..S.AFGFv......gAALEII....LI.F..Y..L...M.VS.SVVGFY....SLRV....--................F.G.NFIP..kKDDTTMT..KIIGNCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAIVTTLC...................................................................................................................................................................................................................
K7HF71_CAEJA/11-311                  ..........................................................................................................nsm------------.-......---Y..STI...R...KQNP....................................................IVTISTFIGW..YFSLIIIF.VLPLDVAI..TFFHKC...Etdrqrilnas.............................................................................................................................................lagtpspiipECELPG.G..YV....P...D.....K.V.LF.DL...WRVVYWSAQMLTW................LI..LP.LLQ.S....Y....V........T........A.......G..N...F....T.I.FG...................................................KIR.A....AVIN..N...A...LYYG..I...Y..S..LC..FL.AI..LI.........YAMI.K.G.VS.INIE......N............................................................................................................VKVILV..SA..SNTW.G.L.FLL....VVLLGHG.LVEL.......................................PRSLWH...................HG.NRH..YRLRRTYFD..IE..KLA...SE..KSE.A.E...ENVKE...MY...KRVRI.L.FNS.M..K.SDT...................................................................NGQR..RK.VRTILS..........................................................................................................................................KF..SD.E..II.D.NLFPSRQV.IDN..ANKEED..--Gg..................................fcSEAKLISLH.K.KS.............................................IY.AVQTLNNTTA.LWK...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------...................................................................................................................................................................................................................
H9GMJ5_ANOCA/210-426                 .............................................................................edldeqlnctgfeeaaisrkiksgktscwlsf------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................--------Dmevlrqqyla.............................................................................................................................ihahritletRRKASAWQ.R..NL...G...Y...PLAM....LS....LL....SL.T.G.ISVLVVCFHVLE..LLL........................................................-DD..AA....MP.RG.I...QD..A..P.L..G.KV.SF..S.VFGSf......gAALQVI....LI.F..Y..L...M.VS.SVVGFY....SSPL....--................F.T.KLLP..eRHDTAMT..KIIGNCVS......LLVLSSa.lP.VL....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...FL.YNML.FAGLTTLC...................................................................................................................................................................................................................
F1QUZ2_DANRE/40-584                  ............................................................................................................i-EIVVVFFLALF.L......LHRY..GDF...K...KQQR....................................................MVLFGTLLAW..YLCFLIVF.ILPLDVST..TIYNQCl.iDqeaqtqtpsvspvlse.................................................................................................................................qmtanasispakstqrVCYKPW.S..YI....P...D.....G.I.MP.VF...WRVVYWTSQCLTW................LL..LP.FMQ.S....Y....A........R........S.......G..G...F....T.I.TG...................................................KIK.T....ALIE..N...A...IYYG..T...Y..L..FI..FG.SL..LI.........YVAV.H.-.PQ.WHLSw....yE............................................................................................................LQTIGI..TA..ANTW.G.L.FLL....VLLLGYG.LVEI.......................................PRSYWE...................AS.RQG..HLLIKTYFK..AA..KLM...TE..KAD.S.E...ENLED...VM...EEVRK.I.NES.I..K.YNH...................................................................P-LR..KN.VDTILR..........................................................................................................................................KC..PL.E..YQ.E.KMGRNMDD.FED..FDDKQN..SYP.....................................TERSLSKLH.K.QV.............................................IY.AVQRHNRTRV.QWQ...ILLEQA..FHLE....................................................................................................................DVAKNETSTsrqfvhsfapl...........................................................................................................................epvgwfrryiyTPTAEWYW.E..CL...L...K...QWFY....RV....LA....VV.L.A.LFSVAVVWSECT..FFS........................................................THP..VL....SL.FA.V...FI..-..Q.L..A.ER.DY..N.YLYI........EMACFI....TI.F..F..L...C.TC.VYSTVF....RIRV....FN................Y.Y.YLAS...HHQTDAY..SLQFSGML......FCRLTP...P.LC....LNF.L..GLI.HMDSAIshq.................................akkQTAY.TSIMG....S..MRV........L...SF....IA..NGFY....IY...YP.MLIV.ILCIATYF...................................................................................................................................................................................................................
W9Z916_9EURO/34-300                  ............................................................................................................t-AIVLLLSAASL.F......VYLY..QTH...R...DRSI....................................................FVTIVCIFTI..TSLLATVL.LLPVDVAL..VSSTSS...Sklgrrkd..................................................................................................................................................wanqdkvdN-----.-..-I....T...-.....F.T.LR.VV...YYFLYSLDAILCL................LI..IP.FTY.F....W....Y........Eey....deV.......A..Q...E....E.G.SQ...................................................TFG.S....RFWA..A...F...KYTM..V...F..I..FL..CV.AI..FLvg....ffvP--V.-.-.--.ARHR......Egahfdldffk........................................................................................kllaenhgerALTFAL..GL..LITI.G.I.IIY....CFYTAAG.LALL.......................................PLTLIK...................TA.PGI..SAPALTEST..AA..QLE...SN..-LE.R.Q...R----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------qlegraqgnpdglsskdqreldalvreertlr...................................................................................................................................................................................
G6D6E7_DANPL/25-457                  .............................................................................................................LLFILLYLLSFI.L......IEKF..RRR...D...SEDYftaded........................................evkvyrISLWLCTFSL..AVSLGSAL.LLPVSIVS..------...Nevl...........................................................................................................................................................ilyPNSYYV.K..WL....N...S.....S.L.IQ.GL...WNHVFLFSNLSLF................VF..LP.FAY.L....F....S........E........S.......T..G...F....P.G.CR...................................................---.-....GLKG..R...V...YETF..I...V..L..AL..LG.VA..MLg......laYVIS.A.W.LE.GDRS......Sldal...................................................................................................lnlwtYLPFLY..SC..VSFV.G.V.LML....LVFTPLG.FVRL.......................................F-----...................--.---..--------G..VV..GGV...LV..KPQ.F.L...RDLNE...EY...YVYSF.E.EDT.I..R.---...................................................................RRIN..NA.VNTGVG..........................................................................................................................................YI..SP.E..P-.-.-M---Y--.PDR..GDISAP.vTPD.....................................VSKDGISVN.K.ET.............................................PL.LRLSNGALQA.GLN...QRLRQV..VAMR....................................................................................................................K----EVES.................................................................................................................................................QRKTSSFQ.R..NV...V...Y...PLAM....LL....LL....AL.T.T.ITVLMVLQNTLE..LLI........................................................-GI..KA....LP.LS.T...RQ..F..T.L..G.IA.SL..S.KLGWa......gASLEAG....LI.L..Y..L...H.AA.SLTGLG....T-PL....RA................L.R.VLPR...ARRTPLA..RIIALCTV......LLAHSTa.qP.LL....VKI.L..GV-.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------gyis...............................................................................................................................................................................................................
A0A023GC12_9ACAR/1-143               .............................................................................................................------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.----------MT..FFI........................................................RSP..MV....SL.FG.V...FH..-..R.A..A.EQ.RH..D.YLAI........EVVSVV....TL.G..Y..L...C.VC.AYYTVF....RVRV....LN................Y.Y.YLAP...HHLTDAY..SLVFAGML......LCRLTP...P.LC....LNF.L..GLL.HLDTHVsse................................shrvETAY.TEIMG....H..LDL........I...PI....VA..RGFN....LY...FP.TLIC.VLCLATW-w..................................................................................................................................................................................................................
B0WAG8_CULQU/6-528                   ..........................................................................................................vfs--VCLALLLASI.S......LWRY..GCI...Q...RQHP....................................................IVTFSVLTAW..SFSFLIVF.TIPLDVTS..TVYRQCi.lEqnstkst..................................................................................................................................................aatghngsTCQRPW.G..MV....E...D.....E.V.FP.NL...WRIIYWSSQFLTW................LI..MP.LMQ.S....Y....L........K........A.......G..D...F....T.I.KG...................................................KLK.S....ALVD..N...A...IYYG..S...Y..L..FI..CG.IL..LI.........YLAL.Q.-.PS.ISLDw....qK............................................................................................................LKAIAS..SA..SNTW.G.L.FLL....VLLLGYA.LVEV.......................................PRSLWN...................NS.KPG..FTLQYAYFK..LS..KLS...SE..KAE.A.E...EHVDD...VL...ESLQS.A.SRA.I..P.PRH...................................................................-ELR..TA.LETIIR..........................................................................................................................................KV..PT.E..LM.E.RAR-----.--R..VSRDDG..SPVa..................................vpSEKALVRLH.R.QV.............................................IK.SLQTLQRTEA.LWN...VQVNKV..LHLE....................................................................................................................DVAKNAVSLdhrfktefpk.............................................................................................................................hrtgfaratySPTMEWYW.E..CV...V...K...APFL....KV....LA....VI.T.G.FLSCIVVWSELT..FFN........................................................REP..VL....SI.FA.S...VL..-..N.L..A.KH.NY..D.FVTI........EIFSMM....TL.C..Y..L...C.YC.AYSTVF....RIKF....LN................L.Y.YLAA...HHQTNEY..SLIFSGML......LCRLTP...P.MC....LNF.L..GLI.HMDSHIike.................................rilETHY.TQIMG....H..MDV........L...GI....IS..DGFN....IY...FP.MVML.AFCLATWF...................................................................................................................................................................................................................
K4AJH4_SETIT/342-443                 ..........................................................................................................evt------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.-A.SYLGIL....FFPAv.llIT................N.Q.SICF..rWGGTLMN..SFLFNVGL......ILLCS-...-.--....---.I..SVI.QFGATAfay.................................yaqATAA.QEIFG....H.tLQS........L...RG....IK..YLYK...yNV...FQ.YGFV.ALAFLTLF...................................................................................................................................................................................................................
E1FXZ4_LOALO/241-439                 ...................................................................leeavfrleyqtlkrrlrrnnqggdvslpdpflpqkplrgyq------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................-----VVL.Q..TV...K...Y...VSAI....VV....LL....LL.T.T.ITVLMVLINTLQ..LLF........................................................---..GF....RA.LP.V...YA..Q..Y.M..E.VN.SR..H.TLGIf......gAVVEVI....II.W..Y..I...M.IA.AMIGVY....SVPL....--................L.R.RIRP..qLHKTSMT..RVIANCTT......VLVLSSa.lP.VL....ART.L..GIT.TF----.......................................----.-DLVG....A..YGS........F...MW....LS..-NFT....LV...WT.YNVA.FAFVTV--sc.................................................................................................................................................................................................................
W5MLV2_LEPOC/344-451                 ...............................................................................................gfrpshglvcffrg------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........----CM....LI.M..Y..L...M.VS.SVVGFY....SSPL....--................F.T.GLLP..rTQDTTLT..QIIGNCVA......LLVLSSa.lP.VF....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........Y...NW....LG..-NFH....IV...FL.YNMA.FAGLTSAC...................................................................................................................................................................................................................
V7PX45_9APIC/11-282                  ............................................................................................................i-FVLIIFILCGI.F......YNYF..VKQ...N...ESTL....................................................LTLVVFILSL..STTFTLVL.FIPIDIYL..-VSNGN..lEi...............................................................................................................................................................sN-----.L..EI....S...Q.....K.L.IS.RF...YNSMFWTLIFEAY................IL..VP.FSY.F....Y....L........K........N.......K..K...S....Y.K.NEfddn..........................................levceNVF.E....SLKK..T...I...YFIF..F...L..V..AV..SI.IG..LI.........YRPG.H.-.-K.IPME......Kgkeldyisd.........................................................................................lfdvkhtgesAILFLM..GC..VVFI.G.V.SFW....VSYTSYG.LACL.......................................PIELLK...................QK.NIE..YDKKEIEYR..FE..NL-...--..-KE.K.E...AMIKK...KY...NTLNE.I.KDD.D..R.DEI...................................................................LKIN..-N.MKRLLS..........................................................................................................................................KY..NY.K..LQ.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------eiekisesw..........................................................................................................................................................................................................
V9L4U4_CALMI/16-192                  ..........................................................................................................plc------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................---AEWHW.Q..CW...L...R...GCWY....RL....VA....VV.L.A.VFAVIVVWSECT..FFS........................................................TKP..VL....SL.FA.V...FI..-..Q.L..S.ER.TH..N.YLYI........EMACFI....SI.F..F..L...S.HC.VYSTVF....RIRV....FN................Y.Y.YLEP...HRQTDAY..SLLFSGML......FCRLTP...P.LC....LNF.L..GLI.HMDSAIshq.................................nreQTAY.TSIMG....S..MRV........I...SF....IA..DGFY....IY...YP.MLIL.ILCIASYF...................................................................................................................................................................................................................
C9ZK11_TRYB9/11-245                  ..........................................................................................................vvc--SLLCLAIAIY.V......LYYF..SSE...D...DHEGs..................................................yLTKVIIVFGI..LLAIGVVL.LLPFDASN..------...Ard.............................................................................................................................................................ptVGSKYV.N..TL....N...T.....D.L.--.-M...WEIVLWSLAAMAL................VV..VP.FTV.F....F....Y........E........A.......Y..D...P....D.D.ES...................................................-FS.K....QCGQ..A...I...TLTL..I...V..S..FV..FI.VI..TAv.......cFLSF.G.T.AL.VPVE......Lyealpqivddidrvs..............................................................................ynttsdkdkfevhvsIFTYVV..GE..LCLV.G.W.IAF....FFYAGVG.LVSV.......................................PVDLIRg.................fI-.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------nrpkpisgstfaqemaviaakgdt...........................................................................................................................................................................................
W5K3G8_ASTMX/231-450                 ...........................................................................ledldeqmyciqlqeealqhklngasfnshlqpn------------.-......----..---...-...----....................................................----------..--------.--------..------...-.................................................................................................................................................................------.-..--....-...-.....-.-.--.--...-------------................--..--.---.-....-....-........-........-.......-..-...-....-.-.--...................................................---.-....----..-...-...----..-...-..-..--..--.--..--.........----.-.-.--.----......-............................................................................................................------..--..----.-.-.---....-------.----.......................................------...................--.---..---------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.-S.............................................QH.LYKELDNVRS.QRH...KLER--..----....................................................................................................................---------.................................................................................................................................................KKKASAWE.K..NL...L...Y...PIVM....LI....LL....AG.T.A.ISVFLVALNILY..LLV........................................................-DE..TA....LP.KG.S...AT..P..G.I..H.PV.DK..S.NSGYei....isAPYNPV....LL.I..Y..L...M.VS.SVVGFY....SLRI....--................F.Q.GLTP..rQDDTTMT..SIIGCCVS......ILVLSSa.lP.VM....SRT.L..GIT.RF----.......................................----.-DLLG....D..FGR........F...NW....LG..-NFY....IV...LS.YNLL.FAVVTTLC...................................................................................................................................................................................................................
K1WGC1_MARBU/17-517                  ...........................................................................................................ta--LLVISLGVLL.L......LRHY..LPL...R...TTPA....................................................YLLVPIFFAL..SLPASIIL.LVPIDLAS..SARNQD...Agg............................................................................................................................................................srgI-----.-..WL....P...D.....R.A.LL.VG...WRISYWLTFALTW................FI..LP.VLA.E....Y....A........D........A.......G..Y...R....D.P.KG...................................................RLL.Y....SLRA..N...A...QYQA..L...V..L..GA..GI.IG..MI.........YVFV.S.-.YQ.ASLN......S............................................................................................................LKGTVM..VL..AYVW.G.L.MLA....IYLMGHG.LVAL.......................................PRRLFR...................NA.SIS..GRLRRIQAN..AA..KVH...EK..MED.A.I...RLLED...CE...AQVAA.L.AQR.K..T.GSA...................................................................SKFK..DW.IEELADn........................................................................................................................................sHL..PE.S..RP.H.TLTRRMSE.PQV..NVP---..--Hv...................................iTERYLAELS.R.QL.............................................DR.ARHSRARYLD.EWD...GLLRDA..VETQ....................................................................................................................AILDSAGSKkieigqaspd.............................................................................................................................arflerftilTPYTRYLY.L..YF...L...L...PYMR....IA....LG....VF.L.S.MASFCIVWSEVI..KSV........................................................-NP..LL....SI.IA.V...TV..V..H.H..P.TS.ER..G.QIGFa......gQVIAAC....WI.L..Y..M...C.MA.ALTSLT....EVKV....WR................G.R.ALVK...-RNTHGE..SAMWYSMQ......VAKLSV...P.LA....FNF.L..TFL.APDIYS.......................................ETVF.YQFLG....K.lIKL........T...Q-....LG..ERFD....WL...FP.TFIL.IPVCATLF...................................................................................................................................................................................................................
Q4CQJ4_TRYCC/10-258                  ..........................................................................................................lil-VILLCVGLSVY.L......LFYF..TSE...E...DDGEa..................................................yGAKVIVVLGM..VISMGVVL.LLPLDVSN..------...S................................................................................................................................................................vDPTIPN.K..YI....N...T.....L.N.MT.LM...WQIVLWILFSMTF................II..VP.FVM.F....Y....Y........E........A.......Y..D...P....D.Y.NR...................................................-IR.K....QIIQ..A...I...LYTI..G...I..L..SI..FF.II..CGi.......cYTFI.G.I.AI.IPVL......Tyeglpqlisdmewis..............................................................................yngtgkvinieipvhFFTYCV..GI..MCFL.G.W.IAF....LFYGGLG.IISF.......................................PLDLIFg................fiKR.TKS..IHI------..--..---...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---........................................................---..--....--.--.-...--..-..-.-..-.--.--..-.----........------....--.-..-..-...-.--.------....----....--................-.-.----...-------..--------......------...-.--....---.-..---.------.......................................----.-----....-..---........-...--....--..----....--...--.----.--------srfkeemnlialksdillelslnlqkkcr......................................................................................................................................................................................
LMBD1_ASPNC/15-256                   ............................................................................................................i-VVAVLVMVASV.F......IYTY..QTP...R...DRSS....................................................VVTFTCIVAI..TSLLATVL.LLPVDVAL..TSSTTS..sKlgqrkpw..................................................................................................................................................atqdevdkI-----.-..--....-...V.....S.L.LT.AV...YYLLYSLDAFLCL................LA..IP.FVY.F....W....YeeydevavE........S.......G..E...Q....S.A.AK...................................................RLW.T....AFKY..T...I...SFIA..I...V..V..VL..FI.VG..FL.........VPVA.N.I.KD.SKVS......Dylrkll...............................................................................................aenrgerVLTFTL..GL..LITM.G.L.FLY....ILYTSTG.LAVL.......................................PMRMIR...................A-.--A..PSVSDMTWK..AS..TS-...--..---.-.-...-----...--...-----.-.---.-..-.---...................................................................----..--.------..........................................................................................................................................--..--.-..--.-.--------.---..------..---.....................................---------.-.--.............................................--.----------.---...------..----....................................................................................................................---------.................................................................................................................................................--------.-..--...-...-...----....--....--....--.-.-.------------..---.........................