KEGG   Pyrolobus fumarii: Pyrfu_R0011Help
Entry
Pyrfu_R0011       tRNA      T01620                                 

Definition
(GenBank) tRNA-Cys
  KO
K14222  tRNA Cys
Organism
pfm  Pyrolobus fumarii
Pathway
pfm00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pfm00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Pyrfu_R0011
Non-coding RNAs [BR:pfm03100]
 Transfer RNA
  tRNA
   Pyrfu_R0011
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
complement(join(127788..127828,127858..127896))
Genome map
NT seq 80 nt NT seq  +upstreamnt  +downstreamnt
gccggggtgcccgagcggtcgaaggggcggggctgcagtaaccccgttaatcccgggttc
gaatcccggccccggctcca

DBGET integrated database retrieval system