KEGG   Pyrolobus fumarii: Pyrfu_R0052Help
Entry
Pyrfu_R0052       tRNA      T01620                                 

Definition
(GenBank) tRNA-Leu
Organism
pfm  Pyrolobus fumarii
SSDB OrthologParalogGene clusterGFIT
Position
complement(join(1841239..1841278,1841339..1841379))
Genome map
NT seq 81 nt NT seq  +upstreamnt  +downstreamnt
gggcccgtcgtctagcctggactaggatgcggggttcagggctccccgtgatccggggtt
caaatccccgcgggcccacca

DBGET integrated database retrieval system