KEGG   Polymorphum gilvum: SL003B_1757Help
Entry
SL003B_1757       CDS       T01458                                 

Gene name
rpmD
Definition
50S ribosomal protein L30
Orthology
K02907  
large subunit ribosomal protein L30
Organism
pgv  Polymorphum gilvum
Pathway
Ribosome
Module
Ribosome, bacteria
Class
Genetic Information Processing; Translation; Ribosome [PATH:pgv03010]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif Motif
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
1849427..1849621
Genome map
AA seq 64 aa AA seqDB search
MANTEKTITVEQIGSPLRRPQDQRATLIGLGLNKMHRRSTLKDTPEVRGMINKIPHLVRI
VEDA
NT seq 195 nt NT seq  +upstreamnt  +downstreamnt
atggcgaacaccgaaaagaccattacggtcgagcagatcggcagcccgctgcgccgtccg
caggaccagcgggcgaccctgatcgggctcggcctgaacaagatgcaccgtcgctcgacg
ctgaaggacactccggaagtgcgcggcatgatcaacaagatcccgcatctcgtgcgcatc
gtcgaagacgcgtga

DBGET integrated database retrieval system