KEGG   Polymorphum gilvum: SL003B_1757Help
Entry
SL003B_1757       CDS       T01458                                 

Gene name
rpmD
Definition
(GenBank) 50S ribosomal protein L30
  KO
K02907  large subunit ribosomal protein L30
Organism
pgv  Polymorphum gilvum
Pathway
pgv03010  Ribosome
Module
pgv_M00178  Ribosome, bacteria
Brite
KEGG Orthology (KO) [BR:pgv00001]
 Genetic Information Processing
  Translation
   03010 Ribosome
    SL003B_1757 (rpmD)
Ribosome [BR:pgv03011]
 Ribosomal Proteins
  Mitochondria/ Chloroplast
   Large subunit
    SL003B_1757 (rpmD)
  Bacteria
    SL003B_1757 (rpmD)
  Archaea
    SL003B_1757 (rpmD)
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: Ribosomal_L30
Motif
Other DBs
NCBI-ProteinID: ADZ70184
UniProt: F2IUV5
Position
1849427..1849621
Genome map
AA seq 64 aa AA seqDB search
MANTEKTITVEQIGSPLRRPQDQRATLIGLGLNKMHRRSTLKDTPEVRGMINKIPHLVRI
VEDA
NT seq 195 nt NT seq  +upstreamnt  +downstreamnt
atggcgaacaccgaaaagaccattacggtcgagcagatcggcagcccgctgcgccgtccg
caggaccagcgggcgaccctgatcgggctcggcctgaacaagatgcaccgtcgctcgacg
ctgaaggacactccggaagtgcgcggcatgatcaacaagatcccgcatctcgtgcgcatc
gtcgaagacgcgtga

DBGET integrated database retrieval system