KEGG   Pseudoalteromonas haloplanktis: PSHAatRNA79Help
Entry
PSHAatRNA79       tRNA      T00282                                 

Definition
tRNA-Ser
Orthology
K14233  
tRNA Ser
Organism
pha  Pseudoalteromonas haloplanktis
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pha00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    PSHAatRNA79
Non-coding RNAs [BR:pha03100]
 Transfer RNA
  tRNA
   PSHAatRNA79
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
I:complement(1761799..1761889)
Genome map
NT seq 91 nt NT seq  +upstreamnt  +downstreamnt
ggagagatggcagagtggtcgaatgcaccggtcttgaaaaccggcatgggtttatagccc
atctagggttcaaatccctatctctccacca

  All links  
No link information was found.   
DBGET integrated database retrieval system