KEGG   Pseudoalteromonas haloplanktis: PSHAatRNA79Help
Entry
PSHAatRNA79       tRNA      T00282                                 

Definition
tRNA-Ser
Orthology
K14233  
tRNA Ser
Organism
pha  Pseudoalteromonas haloplanktis
Pathway
Aminoacyl-tRNA biosynthesis
Class
Genetic Information Processing; Translation; Aminoacyl-tRNA biosynthesis [PATH:pha00970]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 
Position
I:complement(1761799..1761889)
Genome map
NT seq 91 nt NT seq  +upstreamnt  +downstreamnt
ggagagatggcagagtggtcgaatgcaccggtcttgaaaaccggcatgggtttatagccc
atctagggttcaaatccctatctctccacca

DBGET integrated database retrieval system