KEGG   Prochlorococcus marinus MIT 9211: P9211_12921Help
Entry
P9211_12921       CDS       T00616                                 

Definition
dTDP-4-dehydrorhamnose 3,5-epimerase (EC:5.1.3.13)
Orthology
K01790  
dTDP-4-dehydrorhamnose 3,5-epimerase [EC:5.1.3.13]
Organism
pmj  Prochlorococcus marinus MIT 9211
Pathway
Streptomycin biosynthesis
Metabolic pathways
Biosynthesis of secondary metabolites
Brite
KEGG Orthology (KO) [BR:pmj00001]
 Metabolism
  Metabolism of terpenoids and polyketides
   00523 Polyketide sugar unit biosynthesis
    P9211_12921
  Biosynthesis of other secondary metabolites
   00521 Streptomycin biosynthesis
    P9211_12921
Enzymes [BR:pmj01000]
 5. Isomerases
  5.1  Racemases and epimerases
   5.1.3  Acting on carbohydrates and derivatives
    5.1.3.13  dTDP-4-dehydrorhamnose 3,5-epimerase
     P9211_12921
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
CyanoBase: 
UniProt: 
Position
1166796..1167227
Genome map
AA seq 143 aa AA seqDB search
MDISSSQKIIQMPLKRIGVEGGDVLHVLKSTDRQYNCFNEAYFSIIKSGSIKAWKKHQRM
TLNIVVPIGNVQFIFYEDQKLILNTIIGEDNYCLLTIRPGIWFGFKGLSESDSYILNIAD
IIHDGNEVERQPLNFLKFLPVQK
NT seq 432 nt NT seq  +upstreamnt  +downstreamnt
atggatataagtagcagtcaaaaaataatacaaatgcctctaaaaagaataggagtagaa
ggaggagatgttctacatgtacttaaatcaacagacagacaatataattgttttaatgaa
gcttacttctcaataataaagtctggatcaatcaaagcatggaaaaagcaccaaagaatg
acccttaacattgtcgttcctataggaaatgtacaattcatattttatgaagatcaaaag
ctcatactaaataccataatcggagaagataactactgtttactgactatcagacctgga
atctggttcggatttaaaggtttatctgaaagcgatagttatatactaaatattgctgac
attattcatgatggcaatgaagtggaaagacaaccactgaatttccttaagttcttacct
gttcaaaaatga

DBGET integrated database retrieval system