KEGG   Pseudomonas mendocina NK-01: MDS_2854Help
Entry
MDS_2854          CDS       T01473                                 

Definition
cytochrome c class I
Orthology
K08738  
cytochrome c
Organism
pmk  Pseudomonas mendocina NK-01
Pathway
Sulfur metabolism
Metabolic pathways
Two-component system
Class
Metabolism; Energy metabolism; Sulfur metabolism [PATH:pmk00920]
Environmental Information Processing; Signal transduction; Two-component system [PATH:pmk02020]
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
UniProt: 
Position
3157269..3157424
Genome map
AA seq 51 aa AA seqDB search
MKNKGISWDAESFEAFIAKPQAYVTGTYMPFAGLKESEARHSLGCYISKLH
NT seq 156 nt NT seq  +upstreamnt  +downstreamnt
atgaagaacaagggaattagctgggatgcagagtccttcgaggcgttcattgcaaaacct
caagcttacgtcaccggaacctacatgccctttgcaggactgaaagaatccgaggcccgt
cacagcctcggctgttatatctccaagctgcattga

DBGET integrated database retrieval system