KEGG   Pasteurella multocida 36950: Pmu_02030Help
Entry
Pmu_02030         tRNA      T01729                                 

Definition
(GenBank) tRNA-Lys
  KO
K14229  tRNA Lys
Organism
pmp  Pasteurella multocida 36950
Pathway
pmp00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pmp00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Pmu_02030
Non-coding RNAs [BR:pmp03100]
 Transfer RNA
  tRNA
   Pmu_02030
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
210043..210118
Genome map
NT seq 76 nt NT seq  +upstreamnt  +downstreamnt
gggtcgttagctcagtcggtagagcagcggacttttaatccgttggtcgaaggttcgaat
ccttcacgacccacca

DBGET integrated database retrieval system