KEGG   Pasteurella multocida 36950: Pmu_02620Help
Entry
Pmu_02620         tRNA      T01729                                 

Definition
(GenBank) tRNA-Ile
  KO
K14227  
tRNA Ile
Organism
pmp  Pasteurella multocida 36950
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pmp00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Pmu_02620
Non-coding RNAs [BR:pmp03100]
 Transfer RNA
  tRNA
   Pmu_02620
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
268415..268491
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gggtctgtagctcaggtggttagagcgcacccctgataagggtgaggtcggtggttcaag
tccactcagacccacca

DBGET integrated database retrieval system