KEGG   Pasteurella multocida 36950: Pmu_02860Help
Entry
Pmu_02860         gene      T01729                                 

Definition
(GenBank) pseudogene
Organism
pmp  Pasteurella multocida 36950
SSDB OrthologParalogGene clusterGFIT
Position
complement(291416..292339)
Genome map
NT seq 924 nt NT seq  +upstreamnt  +downstreamnt
atgattttactcgcacagggcaaaaaacaagcagaaattgccaaagcactgggacgtagc
tccagcaccatttctcgcgagctgaaacgacacgctctagaaagctacagtgcaacgaac
gcacaaaacagctatttgaagcatcgtcaaaatagcaaagcacagcgcaaattagagcag
cctgaatatttcaatttggtgcaagaaaagttcctaacgcaaaactggtcgcccgaacaa
atcagcgcacgattaaaattgtaaaaatctgaattatccattagttattcaaccatttat
cgtggtatttattcagggttgtttgatataggcgaacgcaaagccagtcgcaaactgcgc
cacaaaggcaaaacacggcatacaaaaaatcatcatgaaaaacgtggcaaaattcagata
tccaaccatttgaacgaccgtcccatttcggcgcaaaatcgcagtcgctttggacattgg
gaagccgataccgtactgggtaaagcgggtggagcttgtttgctgacgctgacggaacgc
aaaagtcgttttgagttggtgaagaaaattcctgccaaaaaagccgaagcagtccaaaaa
gccatgattgaattgctggattcacatatattgcggtcaattacgccagaccgtggtaaa
gaatttgcccaacatcgtttggtaacagaagcactgggtgtagaattttacttccccgag
ccgcatcaaccgtggacacggggaacgaatgaaaacacaaatgggttacttcgtgaatac
tttccgaagcaccaagacatcaatcagtggagcgaagttgatattcaacaggtggtcaat
aaactgaatttacgaccgcgtaaatgtttgggttggaaaacaccttatgaagtttacttc
aaaaaaacgttgcacttggtttga

DBGET integrated database retrieval system