KEGG   Paenibacillus mucilaginosus 3016: PM3016_1770Help
Entry
PM3016_1770       CDS       T01757                                 

Definition
(GenBank) hypothetical protein
Organism
pmq  Paenibacillus mucilaginosus 3016
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
2002161..2002289
Genome map
AA seq 42 aa AA seqDB search
MSELGRYTKKISTRDGRTYAISLMPGRESLLLFRLFFCKQEP
NT seq 129 nt NT seq  +upstreamnt  +downstreamnt
atgtccgaattaggtagatataccaaaaagataagcactagggacggccgaacttacgcc
atttccttgatgcccggccgggagagcttgctgctcttccggctgtttttttgtaaacag
gaaccatag

DBGET integrated database retrieval system