KEGG   Paenibacillus mucilaginosus 3016: PM3016_1776Help
Entry
PM3016_1776       gene      T01757                                 

Definition
(GenBank) pseudogene
Organism
pmq  Paenibacillus mucilaginosus 3016
SSDB OrthologParalogGene clusterGFIT
Position
2008207..2009550
Genome map
NT seq 1344 nt NT seq  +upstreamnt  +downstreamnt
atgctggatgtaagagagctgggagctgtggaaggcgggaaggccgactgtacggcggtc
ttccaggaggcggtcgaccgggccaaggccacgggagacaagatttttgttcccatcggc
acctaccggatcgagggacagctgcgcggactcgacaacgtcttcatcgaaggcgtcgcc
tcgaacaagcagtactggtcgcaggaggatgattttgccaccggggcttcggtgctggtg
ggaggaggagcgaacgtgctcttcgcggaggatgtgcagcgggctacgatcgacaacctg
tgcttcaccgatttcgccaagattgcggagcggacgagcccgcggtcgatgcggtttcgc
aactgctcgttcaagaacatggtcgtgctcgacgcgccgtcaggggagaagggggcgtac
cacaacttccgcttcttcggttgcgactttacgaactacgggatcgacgtcacattcaag
ggccggatcatcgactccgtctggaaggactgcacgttcgtcggtgcggcggccttcgat
ctcgtgcaggccaaggcgaacctgatcgcccacaaccggttcgaatggatcgaccggagc
ttcgccatcgcgatgtatgcatgcgagtataaccagattatcgagaatttttttgaccgg
gtgatgggcaacgccatcgtgctgcggcaggggaaccggcacattcacgtgtcggagaac
ctgttcaaccggtgcggcagcggactgacctccggcgggaagcctgcggatcccccgctg
acggagacggcgcatgctttcattcagctctacggggagttcgagaatgtgagcattcag
aacaatgtgttctgccggggcagcagcggtgaccgcggaggggaagagacgccgaagtac
gtgctgtcgaaggagcggaatattcccgggtgtctttttacgttcagggggaatctgacg
gagagtgcctgcacggaccggctgctgtatgtggacggggagcagtatggcaaaatgtcc
gcggacacggacgccgtgttcagcgccttgaccgaggatgtcgtcgatctggcgcggatc
agccgcgggccggtcaccgtctacaacagcgccgccgtgaaggtgacggagattccgctc
catctcatcgtgcataatgcggggggccggattaagctggcgccgggcggcatccaagcc
gggctggtctacggcggccgggtgaacggacggccccggtactcgcgcgacgagatcctt
ttcgagagcgtggagccctccgggccgaggggaaggccggcggcagccgcctcgtctacg
aggtgccggtcccccgcagcatga

DBGET integrated database retrieval system