KEGG   Polaromonas naphthalenivorans: Pnap_0409Help
Entry
Pnap_0409         CDS       T00459                                 

Definition
(GenBank) transposase, IS4 family
Organism
pna  Polaromonas naphthalenivorans
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
complement(419263..419430)
Genome map
AA seq 55 aa AA seqDB search
MRGADTFAESPFTLHRLDDFVPGNHSLRPIRQTVNEAQVLMDALFAGMYEADIKG
NT seq 168 nt NT seq  +upstreamnt  +downstreamnt
atgcgaggagccgacaccttcgccgaaagcccgttcacgctgcatcgcctggatgacttt
gtcccaggcaaccattcgctgcgcccgatacgccagacggtcaacgaggcgcaggtgttg
atggatgcgctgtttgccgggatgtacgaggcggacatcaaagggtga

DBGET integrated database retrieval system