KEGG   Polaromonas naphthalenivorans: Pnap_R0005Help
Entry
Pnap_R0005        tRNA      T00459                                 

Definition
(GenBank) tRNA-Ile
  KO
K14227  
tRNA Ile
Organism
pna  Polaromonas naphthalenivorans
Pathway
Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:pna00001]
 Genetic Information Processing
  Translation
   00970 Aminoacyl-tRNA biosynthesis
    Pnap_R0005
Non-coding RNAs [BR:pna03100]
 Transfer RNA
  tRNA
   Pnap_R0005
BRITE hierarchy
SSDB OrthologParalogGene clusterGFIT
Position
427076..427152
Genome map
NT seq 77 nt NT seq  +upstreamnt  +downstreamnt
gggtctgtagctcagctggttagagcaccgtcttgataaggcgggggtcgttggttcgag
tccaaccagacccacca

DBGET integrated database retrieval system