KEGG   Polynucleobacter necessarius subsp. necessarius: Pnec_0451Help
Entry
Pnec_0451         gene      T00683                                 

Definition
(GenBank) pseudogene
Organism
pne  Polynucleobacter necessarius subsp. necessarius
SSDB OrthologParalogGene clusterGFIT
Position
400971..402186
Genome map
NT seq 1216 nt NT seq  +upstreamnt  +downstreamnt
gtgaaaaaattagttaccttgttattgaccgcgattgcctttagtgtgtgcgccgcagag
aggcctgttgtcaagattgaagccggtagcttgcaaggcgtggttgagtacaacatgcag
gtattaaaaacattccgtatgcggctcctccattgggtgatttgcccccagccaactact
ccctggcaagggactcctgacgccagtcaatttggagattcttgcccacagccatacgtg
aagaatttaagtgccggccttgctttgcaaatgggtcaagcgtagtatcgctgcattcgg
cggaaactcagataacgtgaccatttttggggagtctgccggcgggagaagtgtaacttg
gttgatggtctctgaagctgctagaggtttatttcataaggcgattgcagaaagcgccca
acaaagtccaatacgcggccttacagaaaagcgtctgggcatgcctcccggagcggaagt
agcttccaaattcatgtcatcgcttagagtgaaatccctaaaagaattgagaggtatgtc
tgtacaaaaattggtgttgtctggttctgactttgaaaaaggagaatttggaggcccaat
gattgatggtcaaattattaaaggtgaccctatacctttgtttgctgctggtcagcaggc
aaaggtgccctttatgattggcactaactcttgggattctagctttttggttccaggtca
gcccactatgacaggccttgcaaaaatgttccgtgaggatccaaagattttggcccagct
ctatggcaatgttcaagataaatgtatcgcgccatcagatactatgggtgatatattgta
tcgaggcagcactaaactccttgccgatagcatgaatggtattgcgcctggatatgcata
ctattttgattgcttaaccaaaaatattcgacctgcttaccctggtgttccacacacctt
tgaaattagttacgtatttggcagttatccgctaatgccacaagcgcccgatactgttga
gtctggagtggatcgctgtgggcggatagataaagcaatagtcgaattaaagagcaaaag
tgtttgggcaaagtattggtaccccattaccaacaagaatgatccgcaagacatagcttt
gtctgaaaagatgtctgctagttggactgcatttgcaaaaactggcaacccaaatgtcgg
cggtcaagccgagtga

DBGET integrated database retrieval system