KEGG   Polynucleobacter necessarius subsp. necessarius: Pnec_0535Help
Entry
Pnec_0535         CDS       T00683                                 

Definition
(GenBank) conserved hypothetical protein
Organism
pne  Polynucleobacter necessarius subsp. necessarius
SSDB OrthologParalogGene clusterGFIT
Motif Motif
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
481758..482003
Genome map
AA seq 81 aa AA seqDB search
MDGRRSPFPLVLFLTLRYENLINFESNDDNKVNCIRKETIWFAPSIGRWVARESSGSYNI
QGQIGAEILEDSYQWQLSSYK
NT seq 246 nt NT seq  +upstreamnt  +downstreamnt
atggatgggagaaggtcaccattcccgctggtactttttttaactttacgttatgaaaat
ctcattaattttgaaagtaatgacgacaataaagtgaactgtatacgcaaagaaactatc
tggtttgctcctagcattggtcgctgggtggctcgcgagtcctctggttcttataatatt
caaggtcaaatcggggcagaaattttagaggatagctatcaatggcaactcagctcctac
aagtaa

DBGET integrated database retrieval system