KEGG   Polynucleobacter necessarius subsp. necessarius: Pnec_0545Help
Entry
Pnec_0545         gene      T00683                                 

Definition
(GenBank) pseudogene
Organism
pne  Polynucleobacter necessarius subsp. necessarius
SSDB OrthologParalogGene clusterGFIT
Position
485756..485887
Genome map
NT seq 132 nt NT seq  +upstreamnt  +downstreamnt
gtggaattagagcagtggatgaaatctcgaaatctactcagtgctgacgcacctaacttc
gcacgctacaacccgccttggactttaccctttatgcgccgcaacgaagtcatgattagt
ctgcgcgactaa

DBGET integrated database retrieval system