KEGG   Polynucleobacter necessarius subsp. necessarius: Pnec_0546Help
Entry
Pnec_0546         gene      T00683                                 

Definition
(GenBank) pseudogene
Organism
pne  Polynucleobacter necessarius subsp. necessarius
SSDB OrthologParalogGene clusterGFIT
Position
complement(485884..486756)
Genome map
NT seq 873 nt NT seq  +upstreamnt  +downstreamnt
atgtttagctacagacatgcgtttcatgccggcagtcatgcagacattcttaagcacctc
accttaattcatttggtagagtatttacaagagaagcctggtgcactcaccatagtagat
acccatgctggcgtcggcatttacagtttgcaagacggtttctcaactgtcagtaaagag
gcggatggcggaatctttctgcccagacctgcaagcattcgaacactccaattgcagaaa
gcattcaagcgtatttaaagtgcattgagacggagaaagctgatggggagctcactacct
atccaggatccccctttattcttgctcgtctactacgcccgcaagaccgcctcaaattat
ttgaactacatccaaaggaaatagatatcctacgccacaatattagcgagctcaagcaag
caaaacaaattgatatctatgctgaagatagttttgccagactaaaaggcttacttcccc
caccaagcagacgcggtctagtattaatagacccctcttacgaagataagcaggactatc
gatatctcgagactgccatagaagaagctttacaacgctttgccacgggctgctatgcga
tttggtatccagtaatctctagacgagaatctgcagccctgccggatcgtttaaaaaatt
gccgccgcccataagcgttcatggctccatacagaattacgcgttgaaaatgcacccagc
gagcgacgcctgcagtccagtgacatgttcattatcaatccaccctggacactagaaaag
catttggctcaatccctacccactctcacgaaggctctaggtatcaatggcggtggccag
tttttattaaagagttttgaagctaagaattag

DBGET integrated database retrieval system