KEGG   Polynucleobacter necessarius subsp. necessarius: Pnec_0553Help
Entry
Pnec_0553         CDS       T00683                                 

Definition
(GenBank) heavy metal translocating P-type ATPase
Organism
pne  Polynucleobacter necessarius subsp. necessarius
SSDB OrthologParalogGene clusterGFIT
Motif
Pfam: 
Motif
Other DBs
NCBI-ProteinID: 
UniProt: 
Position
complement(492879..493004)
Genome map
AA seq 41 aa AA seqDB search
MGQSLSLQSIASLEGSTHHSTVMEQAQACFEAGQTVFSLNE
NT seq 126 nt NT seq  +upstreamnt  +downstreamnt
atggggcaaagtctcagcctgcaaagcattgcatctttagaaggcagcactcaccactct
acagttatggaacaggcacaagcatgctttgaggctggacaaaccgttttcagtcttaat
gaataa

DBGET integrated database retrieval system