KEGG   Polynucleobacter necessarius subsp. necessarius: Pnec_0605Help
Entry
Pnec_0605         gene      T00683                                 

Definition
(GenBank) pseudogene
Organism
pne  Polynucleobacter necessarius subsp. necessarius
SSDB OrthologParalogGene clusterGFIT
Position
524642..525518
Genome map
NT seq 877 nt NT seq  +upstreamnt  +downstreamnt
atgaaaatcggatttatcggacttggcaatatgggcttaccaatggccttgaatttgatt
aaagcaggccatcaagtatctggctttgatttggtgaagagtcagatggatgcattcgct
gctgcaggaggcatcgttgcggataacgccaatgacacagcaatagaggctgacgtgttg
atcagtatgctacctgcctcacgccatgttgaaggcttatatcttagcgacacaggttta
ttggcaagcgctaatcctaaaaccttgttgattgattgctcaaccatttcacctaaggtt
gcacaagcggttgctgctgcagctaaggcaaaaggctttgtcatgattgatgcgccagtt
tcgggcggtactgcaagtgcgcaagctgacacattaacatttatggtgggtggtgacgct
ggagcagtcgaatgtgcccgcccattattggaaaaaatgggtaagaatatttttcatgct
ggtgcgaatggagcagggcagatcgttaaggtatgcaacacatgtgctgggtattcagat
gattggcacgagtgaggctttgcgcctaggcattgctaatggctttgaccctaaagtgct
ttctgacatcatgtctaagagttcggggcgcaattgggcgttggaattatacaacccttg
cccgggcgtgatggataacgttccgtcatcaaagggctacgcaggtggttttggggtaga
tctcatgctcaaagatttaggcctagcagtcgagaatgcagaaaatctagatgctagtgt
cccgcttggaaaattagcccagcaactatacgagacccacagcaaagcaggaaatggtca
gcttgatttctcaagcgtgtttaatcaaaaaaagtaa

DBGET integrated database retrieval system